Molecular cloning and functional characterization of cathepsin D from sea cucumber Apostichopus japonicus

Fish & Shellfish Immunology 70 (2017) 553e559

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Molecular cloning and functional characterization of cathepsin D from sea cucumber Apostichopus japonicus Cuiping Yu, Yue Cha, Fan Wu, Xianbing Xu, Lei Qin, Ming Du* School of Food Science and Technology, National Engineering Research Center of Seafood, Dalian Polytechnic University, Dalian 116034, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 11 July 2017 Received in revised form 27 August 2017 Accepted 1 September 2017 Available online 20 September 2017

Cathepsin D (CTSD, EC 3.4.23.5) belongs to aspartic protease family, which is located in lysosomes and is distributed in diverse tissues and cells. CTSD has a wide variety of physiological functions, owing to its proteolytic activity in degradating proteins and peptides. In the current study, the full length cDNA of sea cucumber (Apostichopus japonicus) cathepsin D (AjCTSD) was firstly cloned, then the association between AjCTSD and sea cucumber autolysis was investigated. The full length cDNA of AjCTSD was 2896 bp, with an open reading frame (ORF) for 391 amino acids. AjCTSD was widely expressed in body wall, muscle and intestine; the expression level was the highest in intestine, followed by muscle and body wall. Compared to fresh tissues, AjCTSD expression levels were significantly increased in all examined autolytic tissues. The purified recombinant AjCTSD promoted the degradation of sea cucumber muscle. In conclusion, AjCTSD contributed to sea cucumber muscle autolysis. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Apostichopus japonicus Cathepsin D Gene expression Autolysis

1. Introduction Sea cucumbers (Holothuroidea) are the most commonly consumed echinoderms because of their good flavor and medicinal value. Sea cucumbers are highly valued food and traditional medicine in Asian countries [1]. However, sea cucumbers are very susceptible to external stimulation, such as high temperature, high salinity, nutritional deficiencies, sunlight exposure and ultraviolet radiation [2e5]. When the external conditions change, sea cucumbers are easy to undergo autolysis, resulting in heavy losses in aquaculture and food processing. There are many cathepsins in lysosomes. Cathepins are divided into three categories: cysteine proteases, serine proteases and aspartate proteases (including cathepsin D and E) [6]. The important roles of aspartic proteases are to degrade intracellular and endocytosed proteins. Cathepsin D (CTSD, EC 3.4.23.5) belongs to the aspartic protease family and widely distributed in lysosomes. Due to the capability of degrading structural and functional proteins and peptides, CTSD has a wide variety of physiological functions. Previous research found that CTSD plays vital roles in protein degradation, apoptosis and autophagy [7]. CTSD locates in lysosomes and widely expresses in various cells and tissues of

* Corresponding author. E-mail address: [email protected] (M. Du). http://dx.doi.org/10.1016/j.fsi.2017.09.011 1050-4648/© 2017 Elsevier Ltd. All rights reserved.

mammals [8,9]. To date, there are many reports about the significant roles of CTSD in muscle degradation. The purified CTSD was reported to degrade myosin, actin and tropomyosin in muscle of rat, rabbit, canine and herring [10e13]. In addition, CTSD participates in post mortem degradation of myofibrillar proteins in sea bass white muscle [14], and breakdown of the muscle structure [15]. A previous study in our laboratory found that lysosomal cathepsin L (EC 3.4.22.15) degraded collagen fibers of sea cucumber, and thus participated in autolysis [16]. Since the biological function of CTSD is to cleave and degrade proteins non-specifically in a strongly acidic milieu of lysosomes. In view of these circumstances, we hypothesize that CTSD also participate in autolysis of sea cucumber. In order to get more information of CTSD in Apostichopus japonicus, this study was aimed to clone and characterize full length cDNA of CTSD by RACE technique, and perform the bioinformatics and phylogenetic analysis of CTSD. CTSD was then expressed in vitro to produce recombinant CTSD which was evaluated for the ability of muscle tissues degradation by SDS-PAGE. Furthermore, we investigated the expression pattern of AjCTSD, and its association with sea cucumber autolysis.

554

C. Yu et al. / Fish & Shellfish Immunology 70 (2017) 553e559

2. Materials and methods 2.1. Animal materials Fresh sea cucumbers (Apostichopus japonicus, 100 ± 5 g) were purchased in a local market, and immediately transported to the laboratory on ice. Six sea cucumbers were randomly divided into two groups. One group of three sea cucumbers was defined as fresh group, fresh sea cucumbers were executed on ice. Tissues of body wall, muscle and intestine were harvested and rapidly frozen at
80  C for further use. In order to induce autolysis, another three sea cucumbers were irradiated by a UV lamp (15 w, 0.5 m) for 30 min, and left at room temperature (20 ± 2  C) for 3 h according to a protocol developed in our laboratory [16]. This group was defined as autolysis group. Tissues were also harvested and rapidly frozen at
80  C for further use.

Conserved domains were predicted with the simple modular architecture research tool (SMART) (http://www.smart. emblheidelbergde/). Multiple sequence alignments were created using the ClustalW Multiple Alignment program (http://www.ebi.ac.uk/clustalw/). Phylogenetic tree was performed using a neighbour-joining method, 1000-replicate. 2.5. Plasmid construction The AjCTSD full length coding sequence without signal peptide (Leu 17-Val 391) was amplified and subcloned into the pMD18-T vector (TaKaRa, Dalian, China) for completely sequencing. Subsequently, the fragments were subcloned into the pGEX-4T-1 vector (Amersham Pharmacia Biotech, Amersham, UK) with a GST Flag tag. The recombinant plasmids were confirmed by sequencing. The primers used are shown in Table 1.

2.2. RNA extraction and 30 RACE-ready cDNA synthesis 2.6. Expression and purification of recombinant AjCTSD Total RNA was prepared using TRNzol (Tiangen Biotech Co., Ltd., Beijing, China) from muscle tissues. Agarose gel electrophoresis and OD260/280 ratio were used to evaluate the integrity and purity of RNA. Subsequently, first-strand cDNA was synthesized using SMARTer® RACE 50 /30 Kit (Clontech, Palo Alto, CA, USA) with 30 coding sequence (CDS) Primer A. 2.3. Cloning of the full length cDNA of AjCTSD On the basis of a 1305 bp fragment of the AjCTSD gene obtained from GenBank: Apostichopus japonicus cathepsin D (CTSD) gene, partial CDS (NCBI accession number: JF430592.1 GI: 334562336), 30 -rapid amplification of cDNA ends (RACE) for amplification of AjCTSD full length cDNA was performed using SMARTer® RACE 50 / 30 Kit (Clontech, USA). The following nested PCR program was used: first, 5 cycles of 94  C for 30 s, 72  C for 3 min; then, 5 cycles of 94  C for 30 s, 70  C for 30 s, 72  C for 3 min; finally, 25 cycles of 94  C for 30 s, 68  C for 30 s, 72  C for 3 min. Gene specific primers (30 GSP1 and 30 GSP2) for nested PCR were designed from the initial 1305 bp fragment sequence and shown in Table 1. 2.4. Bioinformatics and phylogenetic analysis Sequence was spliced by Sequencher 4.2 (GeneCodes Corporation, Ann Arbor, MI, USA). Amino acid sequences were deduced using the Expert Protein Analysis System (http://www.expasy.org/). The molecular mass (MW) and theoretical isoelectric point (pI) of AjCTSD were analyzed using Prot-Param tool (http://www.expasy. ch/tools/protparam.html). Signal peptide was predicted by SignalP4.1 Server (http://www.cbs.dtu.dk/services/SignalP/). Prediction of the potential N-linked glycosylation sites were analyzed by NetNGlyc 1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/).

The recombinant plasmid containing coding sequence of AjCTSD without signal peptide was transformed into E. coli BL21 (DE3) cells. The transformed cells were cultured at 37  C in LB medium to the optical density of 0.6 at 600 nm (OD 600). After inducing the cells at 20  C using 0.1 mM isopropyl-b-d-thiogalactopyranoside (IPTG) for 12 h, cells were then harvested using a bacterial activity-keeping lysis buffer (Shanghai Sagon Biotech, Shanghai, China). Recombinant AjCTSD protein was subsequently purified by affinity chromatography using glutathione-Sepharose as described previously [17]. Cell lysate was incubated with glutathione Sepharose beads at 4  C with rotation for 4 h. After incubation, the beads were then washed thoroughly with washing buffer, and bound proteins were then eluted with elution buffer. The purity and concentration of rAjCTSD was analyzed by 10% SDS-PAGE and Coomassie brilliant blue method, respectively. 2.7. Recombinant AjCTSD activity analysis Recombinant AjCTSD activity analysis was performed as described previously [18]. Recombinant AjCTSD of 0.1 mg/ml was auto-activated at pH of 3.5 for 3 h. Muscle tissues taken from fresh sea cucumbers (0.5e2 g) were homogenized by hand in a glass tissue-grinder. After UV-irradiation, the irradiated mince was added with an equal volume of 0.2 M McIIvaines buffer [19]. Then samples were mixed thoroughly with purified 0.1 mg/ml of activated rAjCTSD, 1 mM of Pepstatin A, 0.1 mg/ml of activated rAjCTSD and 1 mM of Pepstatin A simultaneously. The mixture was further incubated at 25  C and pH 4 for 6 h. The irradiated muscle tissues mince with further incubation served as positive control. The unirradiated muscle tissues mince without further incubation served as negative control. Aliquots (5 ml) were then analyzed by 10% SDS-

Table 1 Oligonucleotide primer sequences. Primer names

Primer sequence (50 -30 )

Amplification target

Universal Primer Mix (long) Universal Primer Mix (short) AjCTSD30 RACE GSP1 AjCTSD30 RACE GSP2 AjCTSD-F AjCTSD-R AjCTSD qRT-F AjCTSD qRT-R Ajb-actin qRT-F Ajb-actinqRT-R

TAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC TGAGTATCGGTGGTAAAGACGCTGGGT CAGGCACTTCTCTCATTGCTGGACCG ACGCGTCGACCTGCAAAGAATTCCGTTGTTTAAAG (Sal I) ATAAGAATGCGGCCGCTCAATATTACTTACAAACCTGCACC (Not I) GTTCTCTTTCTTGTTGGGCT CCAATGGCTTCAAGGTCACT AGGTTCCGTTGCCCAGAGAC GGAAAGGACAAAGTTGGCGT

For 30 RACE

For AjCTSD For qRT-PCR of AjCTSD For qRT-PCR of Ajb-actin

C. Yu et al. / Fish & Shellfish Immunology 70 (2017) 553e559

PAGE.

555

tissues; the simultaneous addition of 1 mM Pepstatin A weakened the enzymatic degradation.

2.8. Quantitative real-time PCR 3.4. The expression pattern of AjCTSD To determine the expression pattern of AjCTSD, tissues of intestine, muscle and body wall were separated from fresh and autolytic sea cucumbers. Total RNA was prepared using TRNzol reagent, and reverse transcription PCR was conducted using FirstStrand cDNA Synthesis kit (TaKaRa, Dalian, China). SYBR® Premix Ex Taq™ kit (TaKaRa, Dalian, China) was used to perform the quantitative real-time PCR reactions. The following PCR program was used: 95  C for 30 s, followed by 40 cycles of 95  C for 5 s, 60  C for 30 s and 72  C for 25 s. Primer sequences were listed in Table 1. The data are calculated with the 2-DDCT method [20] using b-actin mRNA as the internal control.

Quantitative real-time PCR was performed to determine the AjCTSD expression pattern and its association with autolysis. The results showed that AjCTSD were expressed widely in intestine, muscle and body wall tissues. Among the three kinds of detected tissues, the mRNA expression level was relatively high in the intestine, following the muscle and body wall (Fig. 6). In addition, expression of AjCTSD in the intestine, muscle and body wall all increased significantly in autolysis groups. The sharpest increase was also observed in intestine, followed by muscle and body wall (Fig. 6).

2.9. Statistical analysis

4. Discussion

All data are presented as mean ± SD (n ¼ 3). The statistical significance of the differences was investigated by t-test. Differences of *P < 0.05 or **P < 0.01 were considered significant or extremely significant.

In lysosomes, pro-cathepsin D was hydrolyzed by its own and other enzymes to produce mature cathepsin D finally [21]. Several studies found that pro-cathepsin D was necessary to fold correctly, activate and transport to lysosomes [22]. AjCTSD contained a potential N-terminal 16-aa signal peptide, and an 18-aa propeptide domain. Multiple sequence alignments showed that signal peptide and propeptide of AjCTSD had low similarity compared with other species. This demonstrates that transportation and maturation of CTSD have evolved [23]. Aspartic proteases (EC 3.4.23) have two highly conserved aspartates in the active site D(T/S)G(T/S) [24]. In this study, the predicted AjCTSD contains two active site motifs DTG that are characteristic of aspartic proteases. These two sites together with their flanking regions are evolutionally conservative in CTSD from various species. This confirmed the correctness of the bioinformatics identification of AjCTSD. When sea cucumbers suffer external stimulation, they are easy to undergo autolysis. Tissue autolysis is the typical characteristic of sea cucumbers, in which proteases should be one of the key members. In this study, muscle tissues showed the main three protein bands about 200, 98, and 42 kDa in weights, which were reported to be myosin heavy chains, paramyosin, and actin according to our previous study [25]. Moreover, the above three proteins all degraded significantly in the autolysis process, which was also consistent with this previous report [25]. Previous studies have indicated that cathepsin D participated in muscle degradation in fishes [14,15,26,27]. In order to determine the proteolytic activity of AjCTSD, it was recombinantly expressed in E. coli and purified for further determination. The irradiated muscle tissues mince was hydrolyzed by purified rAjCTSD and the proteolytic activity was inhibited by the aspartic protease inhibitor Pepstatin A. This indicates that CTSD contributed to muscle tissues degradation. Cathepsin D was previously thought to be a “housekeeping enzyme”. It is a constitutive protein in almost all eukaryotic cells whose main function is to remove the unrequired proteins [28e31]. The tissue expression analysis revealed that AjCTSD were widely expressed in sea cucumber. These results were consistent with previous studies in sweetfish [32], rock bream [33], lampreys [18], turbot [34], rainbow trout [29], channel catfish [35], Miiuy croaker [36] and implied fundamental functions of AjCTSD in these species. The AjCTSD mRNA expression profile gives us important information to speculate its function. The data of quantitative real-time PCR indicated that the relative expression of AjCTSD in intestine was obviously higher than that in muscle and body wall. The sea cucumber intestine contains many endogenous enzymes which are regarded as the dominant autolysis effectors. Obviously, results in this study demonstrated that AjCTSD is involved in digestion and

3. Results 3.1. AjCTSD cDNA sequence analysis In this study, 1591 bases (1306e2896 bp) were amplified using 30 -RACE. The determined full length cDNA coding for the AjCTSD had been submitted to the GenBank database (MF120287). The cDNA of AjCTSD was 2896 bp, containing 190 bp 5-un-translated region (UTR), 1176 bp ORF and 1530 bp 30 -UTR. A polyadenylation signal, AATAAA, is found 13 bases upstream from the polyadenylation site. The ORF of 1176 bp was predicted to encode a protein of 391 residues. The estimated MW was 42358.57 Da and pI was 5.01. AjCTSD contained a signal peptide from 1 to 16 aa, a propeptide domain from 17 to 34 aa, a aspartyl protease domain from 68 to 391 aa. In addition, AjCTSD had two active sites Asp87 and Asp276, and two N-glycosylation sites (Asn124 and Asn237) (Fig. 1). 3.2. AjCTSD shares moderate homology with the CTSD from other species Sequence alignment of AjCTSD with CTSD from other species reveals a moderate degree of amino acid sequence similarity (Todarodes pacificus 54.80%, followed by the Pteria penguin 54.55%, Chelonia mydas 54.02%, and Pinctada maxima 53.81%; Fig. 2). In addition, two active sites were evolutionally conservative. The potential N-glycosylation sites were relatively conserved, the one near N-terminus was absolutely conserved but the other one did not exist in Danio rerio and Palaemon carinicauda. The phylogenetic tree demonstrated that AjCTSD showed relatively closest relationship to the Chelonia mydas, Homo sapiens, Danio rerio and Salmo salar (Fig. 3). 3.3. The recombinant AjCTSD could degrade muscle tissues of sea cucumber SDS-PAGE showed that recombinant AjCTSD displayed a major band of about 68 kDa when induced with IPTG (Fig. 4, lane 1) and purified by glutathione-Sepharose column (Fig. 4, lane 4). Fig. 5 showed that muscle tissues degradation was inhibited by 1 mM of Pepstatin A which is an inhibitor of aspartic proteinases. 0.1 mg/ml of purified recombinant AjCTSD promoted degradation of muscle

556

C. Yu et al. / Fish & Shellfish Immunology 70 (2017) 553e559

Fig. 1. Nucleotide sequence and deduced amino acid sequence of AjCTSD. Nucleotide sequence was in lowercase and amino acid sequence in uppercase letter. The stop codon (TAA) is indicated with an asterisk. The signal peptide is in gray box. Two N-glycosylation sites and one catalytic residue are indicated in blue and purple. A polyadenylation signal sequence AATAAA and poly (A) tail indicated in green. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

C. Yu et al. / Fish & Shellfish Immunology 70 (2017) 553e559

557

Fig. 2. Alignments of predicted AjCTSD with cathepsin D from other organisms using CLUSTAL Omega software. The NCBI accession numbers of the amino acid sequences are as follows: Homo sapiens, AAA51922; Chelonia mydas, EMP29355; Salmo salar, ACH70630; Danio rerio, CAK11131; Todarodes pacificus, BAD15111; Palaemon carinicauda, AGJ03549; Azumapecten farreri, ACL13150; Pteria penguin, AEI58895; Pinctada margaritifera, AFE48185; Pinctada maxima, AEI58896. Dashes represent gaps inserted into the alignment. Identical (*) and similar(. or:) residues are indicated, respectively. The active sites and N-glycosylation sites are indicated by gray and yellow boxes. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

558

C. Yu et al. / Fish & Shellfish Immunology 70 (2017) 553e559

Fig. 3. Phylogenetic analysis of AjCTSD and other species. The branch of AjCTSD is marked with an asterisk.

Fig. 4. SDS-PAGE analysis of recombinant AjCTSD. Lane M, marker; lane 1, supernatant of BL21 containing pGEX-4T-1-AjCTSD after induction with IPTG; lane 2, total protein of BL21 containing pGEX-4T-1-AjCTSD without IPTG induction; lane 3, total protein of E. coli BL21 containing pGEX-4T-1 after induction with IPTG; lane 4, GST-AjCTSD purified by glutathione-Sepharose.

Fig. 6. The mRNA expression level of AjCTSD after autolysis. The significant differences of AjCTSD expression between the autolysis groups and the fresh groups are indicated by asterisks (*: P < 0.05; **: P < 0.01).

protein degradation. The relative expression of AjCTSD gene was obviously up-regulated in the autolysis tissues, suggesting that AjCTSD gene was involved in autolysis. This study may be helpful to elucidate the autolysis mechanism of sea cucumber, but the precise cleavage sites and cleavage products of AjCTSD need further research. In conclusion, the full length cDNA of cathepsin D from sea cucumber (Apostichopus japonicus) was cloned and characterized. We also found that cathepsin D contributed to autolysis of sea cucumber muscle tissues. Acknowledgements The work was supported by grants from The Basic Research Program of Liaoning Education Department (2016J046). References

Fig. 5. Activity analysis of recombinant cathepsin D. Lane M, marker; lane 1, unirradiated muscle tissues mince without further incubation; lane 2, irradiated muscle tissues mince with further incubation; lane 3, irradiated muscle tissues mince mixed with Pepstatin A with further incubation; lane 4, irradiated muscle tissues mince mixed with purified rAjCTSD with further incubation; lane 5, irradiated muscle tissues mince mixed with purified rAjCTSD and Pepstatin A with further incubation. MHC, myosin heavy chains; Pm, paramyosin; Ac, actin.

[1] N. Sloan, Echinoderm Fisheries of the World: a Review, AA Balkema, Rotterdam, 1985, pp. 109e124. [2] J.-F. Yang, R.-C. Gao, H.-T. Wu, P.-F. Li, X.-S. Hu, D.-Y. Zhou, B.-W. Zhu, Y.-C. Su, Analysis of apoptosis in ultraviolet-induced sea cucumber (Stichopus japonicus) melting using terminal deoxynucleotidyl-transferase-mediated dUTP nick end-labeling assay and cleaved Caspase-3 immunohistochemistry, J. Agric. food Chem. 63 (43) (2015) 9601e9608. [3] I. Wilkie, Is muscle involved in the mechanical adaptability of echinoderm mutable collagenous tissue? J. Exp. Biol. 205 (2) (2002) 159e165.

C. Yu et al. / Fish & Shellfish Immunology 70 (2017) 553e559 [4] R.B. Hill, Role of Ca (2þ) in excitation-contraction coupling in echinoderm muscle: comparison with role in other tissues, J. Exp. Biol. 204 (5) (2001) 897e908. [5] B. Zhu, J. Zheng, Z. Zhang, X. Dong, L. Zhao, M. Tada, Autophagy plays a potential role in the process of sea cucumber body wall “melting” induced by UV irradiation, Wuhan Univ. J. Nat. Sci. 13 (2) (2008) 232e238. [6] V. Turk, B. Turk, G. Guncar, D. Turk, J. Kos, Lysosomal cathepsins: structure, role in antigen processing and presentation, and cancer, Adv. enzyme Regul. 42 (2002) 285e304. [7] P. Benes, V. Vetvicka, M. Fusek, Cathepsin Ddmany functions of one aspartic protease, Crit. Rev. oncology/hematology 68 (1) (2008) 12e28. [8] T. Saku, H. Sakai, Y. Shibata, Y. Kato, K. Yamamoto, An immunocytochemical study on distinct intracellular localization of cathepsin E and cathepsin D in human gastric cells and various rat cells, J. Biochem. 110 (6) (1991) 956e964. [9] H. Sakai, T. Saku, Y. Kato, K. Yamamoto, Quantitation and immunohistochemical localization of cathepsins E and D in rat tissues and blood cells, Biochimica Biophysica Acta (BBA)-General Subj. 991 (2) (1989) 367e375. [10] J. Bird, W. Schwartz, A. Spanier, Degradation of myofibrillar proteins by cathepsins B and D, Acta Biol. medica Ger. 36 (11e12) (1976) 1587e1604. [11] A. Okitani, T. Matsumoto, Y. Kitamura, H. Kato, Purification of cathepsin D from rabbit skeletal muscle and its action towards myofibrils, Biochimica Biophysica Acta (BBA)-Enzymology 662 (2) (1981) 202e209. [12] T.L. Jones, E.A. Ogunro, A.M. Samarel, A.G. Ferguson, M. Lesch, Susceptibilities of cardiac myofibrillar proteins to cathepsin D-catalyzed degradation, Am. J. Physiology-Heart Circulatory Physiology 245 (2) (1983) H294eH299. [13] L.B. Nielsen, H.H. Nielsen, Purification and characterization of cathepsin D from herring muscle (Clupea harengus), Comp. Biochem. Physiology Part B Biochem. Mol. Biol. 128 (2) (2001) 351e363. [14] C. Ladrat, V. Verrez-Bagnis, J. Noel, J. Fleurence, In vitro proteolysis of myofibrillar and sarcoplasmic proteins of white muscle of sea bass (Dicentrarchus labrax L.): effects of cathepsins B, D and L, Food Chem. 81 (4) (2003) 517e525. [15] H. Godiksen, M. Morzel, G. Hyldig, F. Jessen, Contribution of cathepsins B, L and D to muscle protein profiles correlated with texture in rainbow trout (Oncorhynchus mykiss), Food Chem. 113 (4) (2009) 889e896. [16] Y.-X. Liu, D.-Y. Zhou, D.-D. Ma, Y.-F. Liu, D.-M. Li, X.-P. Dong, M.-Q. Tan, M. Du, B.-W. Zhu, Changes in collagenous tissue microstructures and distributions of cathepsin L in body wall of autolytic sea cucumber (Stichopus japonicus), Food Chem. 212 (2016) 341e348. [17] Q. Ye, H.J. Worman, Interaction between an integral protein of the nuclear envelope inner membrane and human chromodomain proteins homologous to Drosophila HP1, J. Biol. Chem. 271 (25) (1996) 14653e14656. [18] R. Xiao, Z. Zhang, H. Wang, Y. Han, M. Gou, B. Li, D. Duan, J. Wang, X. Liu, Q. Li, Identification and characterization of a cathepsin D homologue from lampreys (Lampetra japonica), Dev. Comp. Immunol. 49 (1) (2015) 149e156. [19] H.T. Wu, D.M. Li, B.W. Zhu, J.J. Sun, J. Zheng, F.L. Wang, K. Konno, X. Jiang, Proteolysis of noncollagenous proteins in sea cucumber, Stichopus japonicus, body wall: characterisation and the effects of cysteine protease inhibitors, Food Chem. 141 (2) (2013) 1287e1294. [20] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2
DDCT method, methods 25 (4) (2001)

559

402e408. [21] G.E. Conner, D. cathepsin, Handbook of Proteolytic Enzymes, second ed., Elsevier Inc., 2004. [22] H. Takeshima, M. Sakaguchi, K. Mihara, K. Murakami, T. Omura, M. Himeno, Y. Nishimura, Intracellular targeting of lysosomal cathepsin D in COS cells, J. Biochem. 118 (5) (1995) 981e988. [23] W.-W. Li, X.-K. Jin, L. He, H. Jiang, Y.-N. Gong, Y.-N. Xie, Q. Wang, Molecular cloning, characterization, expression and activity analysis of cathepsin L in Chinese mitten crab, Eriocheir sinensis, Fish shellfish Immunol. 29 (6) (2010) 1010e1018. [24] P.B. Szecsi, The aspartic proteases, Scand. J. Clin. Laboratory Investigation 52 (sup210) (1992) 5e22. [25] C.-C. Zhao, Y. Yang, H.-T. Wu, Z.-M. Zhu, Y. Tang, C.-P. Yu, N. Sun, Q. Lv, J.R. Han, A.-T. Li, Characterization of proteolysis in muscle tissues of sea cucumber Stichopus japonicus, Food Sci. Biotechnol. 25 (6) (2016) 1529e1535. €l, J. Fleurence, Relative contribution [26] C. Delbarre-Ladrat, V. Verrez-Bagnis, J. Noe of calpain and cathepsins to protein degradation in muscle of sea bass (Dicentrarchus labrax L.), Food Chem. 88 (3) (2004) 389e395. ret, C. Delbarre-Ladrat, M. de Lamballerie-Anton, V. Verrez-Bagnis, [27] R. Che Calpain and cathepsin activities in post mortem fish and meat muscles, Food Chem. 101 (4) (2007) 1474e1479. [28] M. Garcia, N. Platet, E. Liaudet, V. Laurent, D. Derocq, J.P. Brouillet, H. Rochefort, Biological and clinical significance of cathepsin D in breast cancer metastasis, Stem Cells 14 (6) (1996) 642e650. [29] S. Brooks, C. Tyler, O. Carnevali, K. Coward, J. Sumpter, Molecular characterisation of ovarian cathepsin D in the rainbow trout, Oncorhynchus mykiss, Gene 201 (1) (1997) 45e54. [30] J.H. Cho, I.Y. Park, H.S. Kim, W.T. Lee, M.S. Kim, S.C. Kim, Cathepsin D produces antimicrobial peptide parasin I from histone H2A in the skin mucosa of fish, FASEB J. 16 (3) (2002) 429e431. [31] N.V. Margaryan, D.A. Kirschmann, A. Lipavsky, C.M. Bailey, M.J. Hendrix, Z. Khalkhali-Ellis, New insights into cathepsin D in mammary tissue development and remodeling, Cancer Biol. Ther. 10 (5) (2010) 457e466. [32] J. Yu, L. Chang-Hong, L. Xin-Jiang, C. Jiong, Characterization and expression of sweetfish (Plecoglossus altivelis) cathepsin D, Zoological Res. 35 (4) (2014) 294. [33] K.-M. Choi, S.H. Shim, C.-M. An, B.-H. Nam, Y.-O. Kim, J.-W. Kim, C.-i. Park, Cloning, characterisation, and expression analysis of the cathepsin D gene from rock bream (Oplegnathus fasciatus), Fish shellfish Immunol. 40 (1) (2014) 253e258. [34] A. Jia, X.-H. Zhang, Molecular cloning, characterization and expression analysis of cathepsin D gene from turbot Scophthalmus maximus, Fish shellfish Immunol. 26 (4) (2009) 606e613. [35] T. Feng, H. Zhang, H. Liu, Z. Zhou, D. Niu, L. Wong, H. Kucuktas, X. Liu, E. Peatman, Z. Liu, Molecular characterization and expression analysis of the channel catfish cathepsin D genes, Fish shellfish Immunol. 31 (1) (2011) 164e169. [36] X. Liu, G. Shi, D. Cui, R. Wang, T. Xu, Molecular cloning and comprehensive characterization of cathepsin D in the Miiuy croaker Miichthys miiuy, Fish Shellfish Immunol. 32 (3) (2011) 464e468.