- Email: [email protected]
Phenoloxidase from the sea cucumber Apostichopus japonicus: cDNA cloning, expression and substrate specificity analysis
Fish & Shellfish Immunology 36 (2014) 344e351
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Phenoloxidase from the sea cucumber Apostichopus japonicus: cDNA cloning, expression and substrate specificity analysis Jingwei Jiang, Zunchun Zhou*, Ying Dong, Hongjuan Sun, Zhong Chen, Aifu Yang, Shan Gao, Bai Wang, Bei Jiang, Xiaoyan Guan Liaoning Key Lab of Marine Fishery Molecular Biology, Liaoning Ocean and Fisheries Science Research Institute, Dalian, Liaoning 116023, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 July 2013 Received in revised form 30 September 2013 Accepted 5 December 2013 Available online 17 December 2013
Phenoloxidase (PO) is a crucial component of the immune system of echinoderms. In the present study, the full-length cDNA of PO (AjPO) was cloned from coelomocytes of the sea cucumber Apostichopus japonicus using 30 - and 50 -rapid amplification of cDNA ends (RACE) PCR method, which is 2508 bp, with an open reading frame (ORF) of 2040 bp encoding 679 amino acids. AjPO contains a transmembrane domain, and three Cu-oxidase domains with copper binding centers formed by 10 histidines, one cysteine and one methionine respectively. Phylogenetic analysis revealed that AjPO was clustered with laccase-type POs of invertebrates. Using the isolated membrane proteins as crude AjPO, the enzyme could catalyze the substrates catechol, L-3,4-dihydroxyphenylalanine (L-DOPA), dopamine and hydroquinone, but failed to oxidize tyrosine. The results described above collectively proved that AjPO was a membrane-binding laccase-type PO. The quantitative real-time PCR (qRT-PCR) analysis revealed that AjPO mRNA was expressed in muscle, body wall, coelomocytes, tube feet, respiratory tree and intestine with the highest expression level in coelomocytes. AjPO could be significantly induced by lipopolysaccharide (LPS), peptidoglycan (PGN), Zymosan A and polyinosinic-polycytidylic acid (PolyI:C), suggesting AjPO is closely involved in the defense against the infection of bacteria, fungi and double-stranded RNA viruses. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Sea cucumber (Apostichopus japonicus) Phenoloxidase cDNA cloning mRNA expression Substrate specificity
1. Introduction Phenoloxidase (PO), a key component of the innate immunity of invertebrates, was mainly found in the humoral fluid and responsible for the conversion of phenol substrates to unstable quinones, which afterwards were transformed into melanin following a nonenzymatic pathway [1e3]. The melanin and a number of intermediate metabolites generated during melanization were involved in pathogen extermination, wound healing, phagocytosis, and encapsulation [4e6]. The melanization may be initiated by three different types of POs, which were laccase type, catechol oxidase type and tyrosinase type respectively [7]. The three different types of POs showed remarkable difference in substrate specificity, the
Abbreviations: PO, phenoloxidase; AjPO, Apostichopus japonicus phenoloxidase; ORF, open reading frame; RACE, rapid amplification of cDNA ends; L-DOPA, L-3,4dihydroxyphenylalanine; PBS, phosphate buffered saline; qRT-PCR, quantitative real-time PCR; LPS, lipopolysaccharide; PGN, peptidoglycan; PolyI:C, polyinosinicpolycytidylic acid; dsRNA, double-stranded RNA; REPH, mRNA expression of PO in hemocytes; Cytb, cytochrome b; SE, standard error; UTR, untranslated region. * Corresponding author. Tel./fax: þ86 411 84691884. E-mail address: [email protected] (Z. Zhou). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.12.001
laccase-type was capable of oxidizing both p-diphenols and odiphenols, the catechol oxidase-type could just oxidize o-diphenols, and the tyrosinase-type showed high affinity to both monophenols and o-diphenols [8,9]. Since the first genetic study of PO in the freshwater crayfish Pacifastacus leniusculus in 1995, the gene cloning of PO has been performed in a variety of invertebrates, notably in insects and crustaceans [10,11]. These studies showed that most gene sequences of invertebrate POs had an open reading frame (ORF) of approximately 2000 bp in length, and the deduced amino acid sequences contained two conserved copper centers [1,12,13]. In addition, the functional analysis of PO indicated that the PO mRNA expression had a close relationship to the challenge of microbial polysaccharide or pathogens [14e16]. For example, the stimulation of lipopolysaccharide (LPS) caused a remarkable decrease in the mRNA expression of PO in hemocytes (REPH) in the scallop Chlamys farreri during 3e6 h after injection [17]; in contrast, the stimulation of LPS induced an increase in REPH in the crab Scylla serrata [18]. Furthermore, the challenges by Vibrio anguillarum in the crab Eriocheir sinensis and Vibrio alginolyticus in the crab Portunus trituberculatus both resulted in a dramatic enhancement of REPH at 12 and 48 h post infection [19,20], while
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
the challenges by Aeromonas hydrophila and Vibrio harveyi in the prawn Macrobrachium rosenbergii caused a significant increase in REPH at 24 h and subsequent a decrease at 48 h post infection [21]. As far as virus challenge is concerned, the white spot syndrome virus infection induced an up-regulation of REPH in the crayfish Procambarus clarkii and a down-regulation in the shrimp Litopenaeus vannamei respectively at 48 h post infection [22,23]. All these studies suggested that invertebrate PO was closely involved in the immune response against pathogens infection. In addition, the temporal variation of REPH showed great difference in one species with different challenges or different species with the same challenge, suggesting that the immune action of PO had specificities to both immune challenge and species. Sea cucumber Apostichopus japonicus is one of the most important commercial species in North China, and its culture is susceptible to the diseases caused by pathogens like bacteria and viruses [24e26]. The present study reports the cloning of fulllength cDNA, the determination of substrate specificity, and the transcripts expression analysis of PO (AjPO) from A. japonicus. We aimed to provide primary data on PO as a potential immune index in this sea cucumber. 2. Materials and methods 2.1. Experimental animals and immune challenges One-year old healthy sea cucumbers (with average body weight 13.2 2.4 g) were collected from Dalian in China and kept in seawater aquaria at 15e18 C, pH 8.1e8.3 and salinity of 31& for one week before use. The immune challenges were conducted by coelomic injection using LPS (Sigma), peptidoglycan (PGN, Sigma), Zymosan A (Sigma) and polyinosinic-polycytidylic acid (PolyI:C, Sigma) as stimulants, which were dissolved in phosphate buffered saline (PBS, pH ¼ 7.4) at a concentration of 1 mg/ml, 100 mg/ml, 300 mg/ml and 100 mg/ml respectively. Tested animals were injected with 500 ml of each stimulant solution respectively, and controls were injected with 500 ml PBS instead of stimulants, then 15 animals in each group were sampled randomly at 4 h, 12 h, 24 h, 48 h and 72 h postinjection. Tissues including body wall, muscle, coelomocytes, tube feet, intestine and respiratory tree were isolated and collected into 3 pools of 5 individuals each. Successively, the mixed tissues were preserved in RNAlater (Invitrogen) and stored at 80 C for RNA extraction. 2.2. Total RNA extraction and cDNA synthesis The total RNA of different tissues was extracted using the RNAprep pure Tissue Kit (TIANGEN) following the manufacturer’s instructions. The concentration and quality of total RNA were detected by NanoPhotometer (Implen GmbH) and agarose gel electrophoresis. To synthesize first strand cDNA, 25 pmol Oligo dT Primer, 50 pmol random 6 mers, 4 ml 5 PrimeScriptÔ buffer, 900 ng total RNA and 1 ml PrimeScriptÔ RT enzyme Mix I (PrimeScriptÔ RT reagent Kit, TaKaRa) were mixed in a 20 ml reaction system and incubated at 37 C for 15 min, and then at 85 C for 5 s, the products were used as cDNA samples and stored at 80 C for the quantification of gene expression. 2.3. Full-length cDNA cloning Based on the partial sequence of AjPO identified from the transcriptome sequencing analysis of A. japonicus [27], the primers for 30 - and 50 -rapid amplification of cDNA ends (RACE)
345
Table 1 The primers used in this study. Primer name
Sequence (50 -30 )
Purpose
PO-3 PO-5 UPM long
30 -RACE PCR 50 -RACE PCR 50 - & 30 -RACE PCR
UPM short PO-rt-1s
CGTTGTTCTGTGATGCTAGAGTTGCG AAGCCGGTCCTTTGCCCTTTCCAT CTAATACGACTCACTATAGGGCA AGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC CAGCAGTTACAAGTGGGATG
PO-rt-1a
CCAGTCACGAAGACCAGAAT
CytbQ-F CytbQ-R
TGAGCCGCAACAGTAATC AAGGGAAAAGGAAGTGAAAG
50 - & 30 -RACE PCR Quantitative realtime PCR Quantitative realtime PCR Reference gene Reference gene
PCR were designed (Table 1). The cDNA templates for 30 - and 50 RACE PCR were synthesized respectively by employment of the total RNA from coelomocytes using the SMART PCR cDNA Synthesis Kit (Clontech) following the manufacturer’s instructions. The 30 - and 50 -RACE PCR were performed in a hot-lid thermocycler using SMART RACE cDNA Amplification Kit (Clontech) according to the instructions, and a touch-down PCR was employed with the following thermal cycling profiles: one cycle of initial denaturation at 94 C for 3 min; followed by 5 cycles of 94 C for 30 s, 72 C for 3 min; next 5 cycles of 94 C for 30 s, 70 C for 30 s, 72 C for 3 min; next 25 cycles of 94 C for 30 s, 68 C for 30 s, 72 C for 3 min; and a final extension of 72 C for 10 min. The specific PCR products were purified by Gel Extraction Kit (Omega), and then cloned into PMD-19T vector (TaKaRa). After transforming into the competent cells of Escherichia coli JM109, the recombinants were spread on the LB-agar Petri dish containing 100 mg/ml ampicillin. Positive clones containing the expected-size inserts were screened by colony PCR and then subjected for DNA sequencing. 2.4. Sequence analysis The similarity searches were performed using the BLASTX program at the National Center for Biotechnology Information (http:// ncbi.nlm.nih.gov/blast/). ORF was predicted using Open Reading Frame Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Translation and protein analysis were performed by ExPaSy tools (http://www.expasy.org/tools/). The protein motifs’ features were predicted by Simple Modular Architecture Research Tool (SMART, http://smart.emblheidelberg.de/) [28]. Multiple sequences alignments were generated by ClustalW2 (http://www.ebi.ac.uk/Tools/ msa/clustalw2/). An NJ phylogenic tree based on the deduced amino acid sequences was constructed using MEGA 4.0 program, and the reliability of the branching was tested by bootstrap resampling with 1000 pseudo-replicates [29]. 2.5. Substrate specificity analysis Using ProteoExtractÒ Native Membrane Protein Extraction Kit (Merck), the membrane proteins were isolated from coelomocytes and then used as crude AjPO for the determination of substrate specificity. Briefly, 10 ml of the crude AjPO solution was added to 190 ml of 15 mmol/L catechol, L-3, 4-dihydroxyphenylalanine (LDOPA), dopamine, hydroquinone and tyrosine that were dissolved in PBS respectively, and controls were performed by replacement of crude AjPO with the same volume of PBS. Subsequently, melanochrome formation was determined spectrophotometrically at 492 nm every 3 min for 27 min using a Sunrise microplate reader (Tecan) [30]. The measurement for each substrate was performed in triplicate.
346
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
Fig. 1. Full-length cDNA sequence and deduced amino acid sequence of AjPO. The deduced amino acid sequence is shown under the nucleotide sequence. The predicted transmembrane domain is underlined. The Cu-oxidase domains are shaded by light gray, and among these domains, the 10 histidines, 1 cysteine and 1 methionine that are predicted to bind copper are highlighted in yellow. The polyadenylation signal (AATAAA) and a long polyA are enclosed in solid lines at the C-terminal part. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Structural features of AjPO. Conserved domains of AjPO are predicted by SMART program. Transmembrane domain predicted by the TMHMM2 program is shown in blue, and the three Cu-oxidase domains predicted by Pfam are presented in dark gray. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
347
Fig. 3. Multiple alignment of the deduced amino acid sequences of laccase-type PO. The numbers 1, 2, and 3, above the sequence indicate the amino acids involved in coordinating the T1, T2, and T3 copper centers. Residues identical in all ten sequences are boxed in black. Conservative substitutions are boxed in gray. The predicted signal peptides are in bold type. The predicted transmembrane domains are shown with an underline. Abbreviations are as follows: NvPO, Nasonia vitripennis PO (NP_001155158.1); HsPO, Harpegnathos saltator PO (EFN87217.1); MsPO, Manduca sexta PO (AAN17506.1); DpPO, Danaus plexippus PO (EHJ67706.1); BmPO, Bombyx mori PO (DAA06286.1); NcPO, Nephotettix cincticeps PO (BAJ06131.1); SpPO, Strongylocentrotus purpuratus PO (XP_789287.3); Ag PO, Anopheles gambiae PO (EU380796.1); CgPO, Crassostrea gigas PO (ACH42090.1).
348
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
Table 2 POs from different species used for phylogenetic analysis. Species
Representative PO
Abbreviations
Types
Accession number
Bacteria
Bacillus sp. LS04 PO Enterobacter sp. JJDP1 PO N.crassa (strain TS) PO Trametes versicolor PO Suberites domuncula PO Crassostrea gigas PO Illex argentinus PO Sepia officinalis PO Pinctada fucata PO Nephotettix cincticeps PO Macrotermes barneyi PO Macrobrachium rosenbergii PO Penaeus monodon PO Eriocheir sinensis PO Scylla serrata PO Strongylocentrotus purpuratus PO Halocynthia roretzi PO Ciona intestinalis PO Cyprinus carpio PO Rana nigromaculata PO Gallus gallus PO Mus musculus PO Homo sapiens PO
BlPO EJPO NCrPO TvPO SdPO CgPO IaPO SoPO PfPO NCiPO MbPO MrPO PmPO EsPO SsPO SpPO HrPO CiPO CcPO RnPO GgPO MmPO HsPO
Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Tyrosinase type Non-tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type
GU972589.1 JX570669.1 M18334.1 Y18012.1 AJ574915.1 EU678320.1 AB107880.1 AJ297474.1 DQ112679.1 BAJ06131.1 AFD33366.1 DQ182596.1 AF521948.1 EF493829.1 DQ435606.1 XP_789287.3 D63950.1 XM_002123004.2 JQ670941.1 D12514 D88349.1 M20234.1 M74314.1
Fungi Porifera Mollusca
Insecta Crustacea
Echinodermata Urochordata Teleostei Amphybia Aves Mammalia
2.6. Quantitative real-time PCR The expression patterns of AjPO mRNA in different tissues were determined using quantitative real-time PCR (qRT-PCR) in an Mx3005pÔ detection system (Applied Stratagene) with cytochrome b (Cytb) gene as the internal reference gene [31]. After challenge with LPS, PGN, Zymosan A and PolyI:C, the AjPO mRNA
expression in coelomocytes was also detected respectively. The qRT-PCR was performed using the SYBR Premix Ex TaqÔ II Kit (TaKaRa) in a reaction mixture of 20 ml, which was composed of 1 ml of cDNA template, 0.4 mM of each primer, 10 ml of 2 SYBR Premix Ex TaqÔ II (Tli RNaseH Plus), and 0.4 ml of ROX Reference Dye II. The temperature profile of qRT-PCR was 95 C for 30 s, followed by 40 cycles of 95 C for 10 s, 55 C for 25 s and 72 C for 25 s. The genespecific primers of AjPO designed for qRT-PCR were selected based on their amplification specificity by melting curve analysis (Table 1), and the amplicon was also confirmed according to the size using agarose gel electrophoresis. 2.7. Statistical analysis All the statistical analyses for the expression level of AjPO mRNA were normalized by the Cytb gene. The crossing-point values obtained from qRT-PCR were converted to fold differences using relative quantification method with the Relative Expression
Fig. 4. Phylogenetic tree of AjPO. The deduced amino acid sequence of AjPO is aligned with other known POs by the ClustalW program and the tree is constructed using MEGA 4.0 software with neighbor-joining method. The bootstrap sampling is performed with 1000 replicates. The information of POs and abbreviations are listed in Table 2.
Fig. 5. Substrate specificity of AjPO. The reactions of AjPO with catechol, L-DOPA, dopamine and hydroquinone are determined in triplicate using the microplate method at 492 nm. Values are shown as means SD (n ¼ 3).
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
349
respectively); however, no signal peptide was detected (Fig. 2). Among these Cu-oxidase domains, AjPO was predicted to contain 10 histidines residues, 1 cysteine residue and 1 methionine residue (565, 638, 643 and 650 in T1 copper center, and 186, 188, 230, 232, 568, 570, 637 and 639 in T2/T3 copper center), which were important for the binding of copper ions (Fig. 1). These residues were highly conserved among the laccase-type POs in invertebrates (Fig. 3). 3.2. Phylogenetic analysis of AjPO After phylogenic analysis based on POs from different species (Table 2), we detected two major distinct groups (Fig. 4): (a) tyrosinase-type POs from vertebrates and several invertebrates; (b) non-tyrosinase-type POs from invertebrates, fungi and bacteria. Among these POs, AjPO was close to the laccase-type PO in both S. purpuratus and insects. 3.3. Substrate specificity of AjPO Fig. 6. The distribution of AjPO mRNA in different tissues. Expression levels in all tissues are presented relative to that in respiratory tree (1). Values are shown as means SE (n ¼ 5). Abbreviations are as follows: M, muscle; BW, body wall; C, coelomocytes; F, tube feet; RT, respiratory tree; I, intestine.
Software Tool 384 v.2 [32]. Pairwise fixed reallocation randomization test was performed to compare the data from control and treatment groups, and the level of significance was defined as p < 0.05. 3. Results 3.1. Cloning and characterization of cDNA The full-length cDNA of AjPO (GenBank Accession No. KF040052) is 2508 bp in length, containing a 50 -untranslated region (UTR) of 92 bp, a 30 -UTR of 376 bp, and an ORF of 2040 bp encoding 679 amino acids with deduced molecular weight of 75.2 kDa and pI of 5.44 (Fig. 1). BLASTX results revealed that AjPO was homologous to the laccase-type POs in Strongylocentrotus purpuratus, Macrotermes barneyi and Nephotettix cincticeps with identities of 39%, 37% and 35% respectively. Structure prediction by SMART showed that AjPO had a transmembrane domain (31-53aa) and three conserved Cu-oxidase domains (133-252aa, 263-418aa and 500-658aa
The crude AjPO was able to catalyze catechol, L-DOPA, dopamine and hydroquinone. The largest velocity of melanochrome formation was detected in dopamine, followed by L-DOPA, hydroquinone, and catechol (Fig. 5). However, no reaction with tyrosine was detected. 3.4. Expression analysis of AjPO in different tissues Using qRT-PCR method, the transcripts of AjPO were detected in muscle, body wall, coelomocytes, tube feet, respiratory tree and intestine, with the expression levels of 0.2, 2.5 3.4, 3.0, 1.0 and 0.8 fold respectively (Fig. 6). 3.5. Expression patterns of AjPO after immune challenge The temporal expression of AjPO transcripts in the coelomocytes was detected respectively after the challenges of LPS, PGN, Zymosan A and PolyI:C (Fig. 7). In PBS group, the expression levels of AjPO showed no significant difference during the five sampling times by comparing with each other (0.8e1.2, P > 0.05); in LPS group, AjPO was significantly up-regulated at 12 and 24 h, and down-regulated at 72 h; in PGN group, AjPO was firstly downregulated to 0.1 fold at 4 h, then strongly up-regulated at 12, 24
Fig. 7. AjPO mRNA expression profile in coelomocytes post injection of LPS, PGN, Zymosan A and PolyI:C. Relative expressions of AjPO are expressed as fold changes over control samples taken at the same time interval as normalized to change in expression in the Cytb control. Values are shown as means SE (n ¼ 5). Significant differences compared with controls are indicated with an asterisk “*” at p < 0.05.
350
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
and 48 h, finally down-regulated at 72 h, and the highest expression level appeared at 12 h (11.8 fold); in Zymosan A group, AjPO was also firstly down-regulated at 4 h, and then up-regulated from 12 h, and mounted to the peak at 24 h (9.8 fold); and in PolyI:C group, AjPO was successively down-regulated at 4 and 12 h, then strongly up-regulated at 48 h, and finally down-regulated at 72 h. 4. Discussion Microbial polysaccharide challenge or pathogens infection to invertebrates caused rapid and dramatic variation of REPH [14,16,17], indicating that PO is one of the most critical immune factors in the response to pathogens infection. In echinoderms, studies about PO were mainly focused on the characterization of enzymatic activity in coelomic fluid [33e35], while the information about PO gene and its expression profiles during immune response remain largely unexplored. So far, only S. purpuratus PO gene has been studied in echinoderms [36]. To understand the important role of PO in immune response and investigate the potential role of PO as an indicator for pathogens infection in A. japonicus, we cloned the full-length cDNA of AjPO gene and characterized AjPO based on substrate specificity. In addition, we also examed the distribution of AjPO mRNA in different tissues and the temporal expression patterns of AjPO mRNA in coelomocytes after four immune challenges. The full-length cDNA of AjPO encodes a PO protein of 679 amino acids, which is similar to that in numerous invertebrates including Eriocheir sinensis [19], artemia Artemia sinica [37], S. purpuratus (XP_789287.3), oyster Crassostrea gigas (ACH42090.1), mosquito Anopheles gambiae [13], and others. However, for the identity of sequence, AjPO is more similar to the laccase-type POs in S. purpuratus (XP_789287.3) and some insects such as M. barneyi (AFD33366.1) and N. cincticeps (BAJ06131.1). The phylogenic tree also suggests that AjPO has a close relationship to the laccase-type POs. AjPO was predicted to have a typical transmembrane domain at the N-terminal part lacking the signal peptide, suggesting that this enzyme may be membrane bound, similar to that in A. gambiae [13]. The structure of AjPO is different from that in S. purpuratus, C. gigas and ant Harpegnathos saltator. In S. purpuratus (XP_789287.3), PO has both transmembrane domain and signal peptide, while in C. gigas (ACH42090.1) and H. saltator (EFN87217.1), POs have only transmembrane domain at the C-terminal part. Moreover, AjPO was also predicted to have three Cuoxidase domains with copper binding centers formed by 10 histidines, one cysteine and one methionine respectively, indicating that AjPO is a typical laccase-type PO [38]. The substrate specificity analysis showed that the isolated membrane proteins could oxidize o-diphenols (catechol, L-DOPA, and dopamine) and p-diphenols (hydroquinone), but failed to oxidize monophenols (tyrosine), suggesting that laccase-type PO exists among these membrane proteins. Collectively, we could conclude that AjPO is a membranebinding laccase-type PO. Expression analysis indicated that AjPO mRNA was expressed in all the examined tissues, and was most highly expressed in coelomocytes, suggesting that AjPO is a widely distributed and essential immune factor in A. japonicus. Its immune function may be achieved mainly depending on the coelomocytes. The temporal profiles of AjPO transcripts showed that AjPO was very sensitive to the immune stimulations. The significant upregulation of AjPO at 12 h post injection of LPS, PGN, Zymosan A, which represent Gram-negative bacteria, Gram-positive bacteria and fungi respectively, and at 24 h post injection of PolyI:C, which represent double-stranded RNA (dsRNA) viruses, suggest that AjPO might be more efficient in the response against bacterial and fungal invasions comparing to virus infection. The downregulation of AjPO at 4 h was simultaneously found in PGN,
Zymosan A and PolyI:C groups, similar to that in C. farreri after challenge with LPS [17] and in E. sinensis after challenge with V. anguillarum [19]. These results suggest that the infection of pathogens such as Gram-positive bacteria, fungi and dsRNA viruses might cause a depression on AjPO expression at the beginning, however, this depression was not found in the LPS group, mainly because that AjPO response system might develop a better adaptability to the stimulation of Gram-negative bacteria. In addition, the depression on AjPO expression was also found in the groups of LPS, PGN and PolyI:C at 72 h post injection, which may resulted from the excessive expression of AjPO in the previous response process. It has been reported that in invertebrates the excessive expression of PO is harmful to the organism itself and will trigger the relative cascade reactions to decrease the PO expression [1]. Comparatively, the successive down-regulation of AjPO at 4 and 12 h made the AjPO transcripts profile in PolyI:C group distinguishable from that in the other three challenge groups, suggesting that AjPO have the potential values as an indicator in the infection of dsRNA viruses. In this study, the full-length cDNA of PO from A. japonicas was cloned, and the substrate specificity and mRNA expression profile of AjPO were characterized. These results are expected to provide basic knowledge on AjPO. The prokaryotic expression and antibody production of this PO in further study are expected to explore the immune and disease-warning function of PO in sea cucumber. Acknowledgments This work was supported by grants from National Nature Science Foundation of China (31272687), State 863 High-Technology R & D Project of China (2012AA10A412), Science & Technology Project of Liaoning Province (2011203005), and Doctoral Startup Foundation of Liaoning Province (20111072). References [1] Cerenius L, Söderhäll K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [2] Muñoz P, Meseguer J, Esteban MA. Phenoloxidase activity in three commercial bivalve species. Changes due to natural infestation with Perkinsus atlanticus. Fish Shellfish Immunol 2006;20:12e9. [3] Aladaileh S, Nair SV, Raftos DA. Induction of phenoloxidase and other immunological activities in Sydney rock oysters challenged with microbial pathogen-associate molecular patterns. Fish Shellfish Immunol 2007;23: 1196e208. [4] Newton K, Peters R, Raftos D. Phenoloxidase and QX disease resistance in Sydney rock oysters (Saccostrea glomerata). Dev Comp Immunol 2004;28: 565e9. [5] Zhao PC, Li JJ, Wang Y, Jiang HB. Broad-spectrum antimicrobial activity of the reactive compounds generated in vitro by Manduca sexta phenoloxidase. Insect Biochem Mol Biol 2007;27:952e9. [6] Cerenius L, Babu R, Söderhäll K, Jiravanichpaisal P. In vitro effects on bacterial growth of phenoloxidase reaction products. J Invertebr Pathol 2010;103:21e 3. [7] Barret FM. Phenoloxidases from larval cuticle of the sheep blowfly, Lucilia cuprina: characterization, developmental changes, and inhibition by antiphenoloxidase antibodies. Arch Insect Biochem Physiol 1987;5:99e118. [8] Liu GX, Yang LL, Fan TJ, Cong RS, Tang ZH, Sun WJ, et al. Purification and characterization of phenoloxidase from crab Charybdis japonica. Fish Shellfish Immunol 2006;20:47e57. [9] Cong RS, Sun WJ, Liu GX, Fan TJ, Meng XH, Yang LL, et al. Purification and characterization of phenoloxidase from clam Ruditapes philippinarum. Fish Shellfish Immunol 2005;18:61e70. [10] Aspän A, Huang TS, Cerenius L, Söderhäll K. cDNA cloning of a prophenoloxidase from the freshwater crayfish Pacifastacus leniusculus and its activation. Proc Natl Acad Sci USA 1995;92:939e42. [11] Söderhäll K, Cerenius L. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr Opin Immunol 1998;10:23e8. [12] Wu S, Wang SH, Wang YL, Zhang ZP. Phenoloxidase in mollusca and crustacean. Chin J Zool 2009;44:137e46 [in Chinese]. [13] Gorman MJ, Dittmer NT, Marshall JL, Kanost MR. Characterization of the multicopper oxidase gene family in Anopheles gambiae. Insect Biochem Mol Biol 2008;38:817e24.
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351 [14] Lourenço AP, Zufelato MS, Bitondi MMG, Simões ZLP. Molecular characterization of a cDNA encoding prophenoloxidase and its expression in Apis mellifera. Insect Biochem Mol Biol 2005;35:541e52. [15] Cerenius L, Bangyeekhun E, Keyser P, Söderhäll I, Söderhäll K. Host prophenoloxidase expression in freshwater crayfish is linked to increased resistance to the crayfish plaque fungus, Aphanomyces astaci. Cell Microbiol 2003;5: 353e7. [16] Hauton C, Hammond JA, Smith VJ. Real-time PCR quantification of the in vitro effects of crustacean immunostimulants on gene expression in lobster (Homarus gammarus) granular haemocytes. Dev Comp Immunol 2005;29:33e42. [17] Zhou Z, Ni DJ, Wang MQ, Wang LL, Wang LL, Shi XW, et al. The phenoloxidase activity and antibacterial function of a tyrosinase from scallop Chlamys farreri. Fish Shellfish Immunol 2012;33:375e81. [18] Ko CF, Chiou TT, Vaseeharan B, Lu JK, Chen JC. Cloning and characterisation of a prophenoloxidase from the haemocytes of mud crab Scylla serrata. Dev Comp Immunol 2007;31:12e22. [19] Gai YC, Zhao JM, Song LS, Li CH, Zheng PL, Qiu LM, et al. A prophenoloxidase from the Chinese mitten crab Eriocheir sinensis: gene cloning, expression and activity analysis. Fish Shellfish Immunol 2008;24:156e67. [20] Cheng P, Li JT, Li J, Liu P, Gao BQ, Wang QY. Molecular cloning and characterization of prophenoloxidase gene in swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2010;28:106e12. [21] Arockiaraj J, Gnanam AJ, Pothikasalam G, Milton J, Pasupuleti M, Bhatt P, et al. A novel prophenoloxidase, hemocyanin encoded copper containing active enzyme from prawn: gene characterization. Gene 2013;524:139e51. [22] Li YH, Deng W, Yang KL, Wang WM. The expression of prophenoloxidase mRNA in red swamp crayfish, Procambarus clarkii, when it was challenged. Genomics 2012;99:355e60. [23] Ai HS, Huang YC, Li SD, Weng SP, Yu XQ, He JG. Characterization of a prophenoloxidase from hemocytes of the shrimp Litopenaeus vannamei that is down-regulated by white spot syndrome virus. Fish Shellfish Immunol 2008;25:28e39. [24] Deng H, Zhou ZC, Wang NB, Liu C. The syndrome of sea cucumber (Apostichopus japonicus) infected by virus and bacteria. Virologica Sinica 2008;23:63e7. [25] Li CH, Feng WD, Qiu LH, Xia CG, Su XR, Jin CH, et al. Characterization of skin ulceration syndrome associated microRNAs in sea cucumber Apostichopus japonicus by deep sequencing. Fish Shellfish Immunol 2012;33:436e41.
351
[26] Liu HZ, Zheng FR, Sun XQ, Hong XG, Dong SL, Wang B, et al. Identification of the pathogens associated with skin ulceration and peristome tumescence in cultured sea cucumbers Apostichopus japonicus (Selenka). J Invertebr Pathol 2010;105:236e42. [27] Zhou ZC, Dong Y, Sun HJ, Yang AF, Chen Z, Gao S, et al. Transcriptome sequencing of sea cucumber (Apostichopus japonicus) and the identification of gene-associated markers. Mol Ecol Resour 2013. http://dx.doi.org/10.1111/ 1755-0998.12147. [28] Letunic I, Doerks T, Bork P. SMART 6: recent updates and new developments. Nucleic Acids Res 2009;37:229e32. [29] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [30] Söderhäll K. Fungal cell wall b-1,3-glucans induce clotting and phenoloxidase attachment to foreign surfaces of crayfish haemocyte lysate. Dev Comp Immunol 1981;5:565e73. [31] Yang AF, Zhou ZC, Dong Y, Jiang B, Wang XY, Chen Z, et al. Stability comparison of cytb and b-actin gene expression in sea cucumber Apostichopus japonicus. J Agric Sci Technol 2010;12:79e84 [in Chinese]. [32] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST(c)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30. [33] Cauicatti C, Seymour J. Evidence for phenoloxidase activity in Holothuria tubulosa (Echinodermata) brown bodies and cells. Parasitol Res 1991;77:50e 3. [34] Wang YN, Liu XW, Liu YP, Chang YQ. Analysis of phenoloxidase activity in the coelomic fluid of Strongylocentrotus intermedius. J Agric Sci Technol 2011;13: 116e20 [in Chinese]. [35] Liu HG, Zheng FR, Sun XQ, Tang XX. Effect of sodium selenite on some enzymes of coelomic fluid to the immune response of holothurian Apostichopus japonicus. J Fisher China 2012;36:98e105 [in Chinese]. [36] Tu Q, Cameron RA, Worley KC, Gibbs RA, Davidson EH. Gene structure in the sea urchin Strongylocentrotus purpuratus based on transcriptome analysis. Genome Res 2012;22:2079e87. [37] Fan TJ, Wang LY, Fan XY, Xu B, Yu MM, Jiang GJ. A prophenoloxidase from Artemia sinica: cDNA cloning, expression and activity analysis during early development. Fish Shellfish Immunol 2011;31:1059e64. [38] Dittmer NT, Kanost MR. Insect multicopper oxidases: diversity, properties, and physiological roles. Insect Biochem Mol Biol 2010;40:179e88.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Phenoloxidase from the sea cucumber Apostichopus japonicus: cDNA cloning, expression and substrate specificity analysis Jingwei Jiang, Zunchun Zhou*, Ying Dong, Hongjuan Sun, Zhong Chen, Aifu Yang, Shan Gao, Bai Wang, Bei Jiang, Xiaoyan Guan Liaoning Key Lab of Marine Fishery Molecular Biology, Liaoning Ocean and Fisheries Science Research Institute, Dalian, Liaoning 116023, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 July 2013 Received in revised form 30 September 2013 Accepted 5 December 2013 Available online 17 December 2013
Phenoloxidase (PO) is a crucial component of the immune system of echinoderms. In the present study, the full-length cDNA of PO (AjPO) was cloned from coelomocytes of the sea cucumber Apostichopus japonicus using 30 - and 50 -rapid amplification of cDNA ends (RACE) PCR method, which is 2508 bp, with an open reading frame (ORF) of 2040 bp encoding 679 amino acids. AjPO contains a transmembrane domain, and three Cu-oxidase domains with copper binding centers formed by 10 histidines, one cysteine and one methionine respectively. Phylogenetic analysis revealed that AjPO was clustered with laccase-type POs of invertebrates. Using the isolated membrane proteins as crude AjPO, the enzyme could catalyze the substrates catechol, L-3,4-dihydroxyphenylalanine (L-DOPA), dopamine and hydroquinone, but failed to oxidize tyrosine. The results described above collectively proved that AjPO was a membrane-binding laccase-type PO. The quantitative real-time PCR (qRT-PCR) analysis revealed that AjPO mRNA was expressed in muscle, body wall, coelomocytes, tube feet, respiratory tree and intestine with the highest expression level in coelomocytes. AjPO could be significantly induced by lipopolysaccharide (LPS), peptidoglycan (PGN), Zymosan A and polyinosinic-polycytidylic acid (PolyI:C), suggesting AjPO is closely involved in the defense against the infection of bacteria, fungi and double-stranded RNA viruses. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Sea cucumber (Apostichopus japonicus) Phenoloxidase cDNA cloning mRNA expression Substrate specificity
1. Introduction Phenoloxidase (PO), a key component of the innate immunity of invertebrates, was mainly found in the humoral fluid and responsible for the conversion of phenol substrates to unstable quinones, which afterwards were transformed into melanin following a nonenzymatic pathway [1e3]. The melanin and a number of intermediate metabolites generated during melanization were involved in pathogen extermination, wound healing, phagocytosis, and encapsulation [4e6]. The melanization may be initiated by three different types of POs, which were laccase type, catechol oxidase type and tyrosinase type respectively [7]. The three different types of POs showed remarkable difference in substrate specificity, the
Abbreviations: PO, phenoloxidase; AjPO, Apostichopus japonicus phenoloxidase; ORF, open reading frame; RACE, rapid amplification of cDNA ends; L-DOPA, L-3,4dihydroxyphenylalanine; PBS, phosphate buffered saline; qRT-PCR, quantitative real-time PCR; LPS, lipopolysaccharide; PGN, peptidoglycan; PolyI:C, polyinosinicpolycytidylic acid; dsRNA, double-stranded RNA; REPH, mRNA expression of PO in hemocytes; Cytb, cytochrome b; SE, standard error; UTR, untranslated region. * Corresponding author. Tel./fax: þ86 411 84691884. E-mail address: [email protected] (Z. Zhou). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.12.001
laccase-type was capable of oxidizing both p-diphenols and odiphenols, the catechol oxidase-type could just oxidize o-diphenols, and the tyrosinase-type showed high affinity to both monophenols and o-diphenols [8,9]. Since the first genetic study of PO in the freshwater crayfish Pacifastacus leniusculus in 1995, the gene cloning of PO has been performed in a variety of invertebrates, notably in insects and crustaceans [10,11]. These studies showed that most gene sequences of invertebrate POs had an open reading frame (ORF) of approximately 2000 bp in length, and the deduced amino acid sequences contained two conserved copper centers [1,12,13]. In addition, the functional analysis of PO indicated that the PO mRNA expression had a close relationship to the challenge of microbial polysaccharide or pathogens [14e16]. For example, the stimulation of lipopolysaccharide (LPS) caused a remarkable decrease in the mRNA expression of PO in hemocytes (REPH) in the scallop Chlamys farreri during 3e6 h after injection [17]; in contrast, the stimulation of LPS induced an increase in REPH in the crab Scylla serrata [18]. Furthermore, the challenges by Vibrio anguillarum in the crab Eriocheir sinensis and Vibrio alginolyticus in the crab Portunus trituberculatus both resulted in a dramatic enhancement of REPH at 12 and 48 h post infection [19,20], while
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
the challenges by Aeromonas hydrophila and Vibrio harveyi in the prawn Macrobrachium rosenbergii caused a significant increase in REPH at 24 h and subsequent a decrease at 48 h post infection [21]. As far as virus challenge is concerned, the white spot syndrome virus infection induced an up-regulation of REPH in the crayfish Procambarus clarkii and a down-regulation in the shrimp Litopenaeus vannamei respectively at 48 h post infection [22,23]. All these studies suggested that invertebrate PO was closely involved in the immune response against pathogens infection. In addition, the temporal variation of REPH showed great difference in one species with different challenges or different species with the same challenge, suggesting that the immune action of PO had specificities to both immune challenge and species. Sea cucumber Apostichopus japonicus is one of the most important commercial species in North China, and its culture is susceptible to the diseases caused by pathogens like bacteria and viruses [24e26]. The present study reports the cloning of fulllength cDNA, the determination of substrate specificity, and the transcripts expression analysis of PO (AjPO) from A. japonicus. We aimed to provide primary data on PO as a potential immune index in this sea cucumber. 2. Materials and methods 2.1. Experimental animals and immune challenges One-year old healthy sea cucumbers (with average body weight 13.2 2.4 g) were collected from Dalian in China and kept in seawater aquaria at 15e18 C, pH 8.1e8.3 and salinity of 31& for one week before use. The immune challenges were conducted by coelomic injection using LPS (Sigma), peptidoglycan (PGN, Sigma), Zymosan A (Sigma) and polyinosinic-polycytidylic acid (PolyI:C, Sigma) as stimulants, which were dissolved in phosphate buffered saline (PBS, pH ¼ 7.4) at a concentration of 1 mg/ml, 100 mg/ml, 300 mg/ml and 100 mg/ml respectively. Tested animals were injected with 500 ml of each stimulant solution respectively, and controls were injected with 500 ml PBS instead of stimulants, then 15 animals in each group were sampled randomly at 4 h, 12 h, 24 h, 48 h and 72 h postinjection. Tissues including body wall, muscle, coelomocytes, tube feet, intestine and respiratory tree were isolated and collected into 3 pools of 5 individuals each. Successively, the mixed tissues were preserved in RNAlater (Invitrogen) and stored at 80 C for RNA extraction. 2.2. Total RNA extraction and cDNA synthesis The total RNA of different tissues was extracted using the RNAprep pure Tissue Kit (TIANGEN) following the manufacturer’s instructions. The concentration and quality of total RNA were detected by NanoPhotometer (Implen GmbH) and agarose gel electrophoresis. To synthesize first strand cDNA, 25 pmol Oligo dT Primer, 50 pmol random 6 mers, 4 ml 5 PrimeScriptÔ buffer, 900 ng total RNA and 1 ml PrimeScriptÔ RT enzyme Mix I (PrimeScriptÔ RT reagent Kit, TaKaRa) were mixed in a 20 ml reaction system and incubated at 37 C for 15 min, and then at 85 C for 5 s, the products were used as cDNA samples and stored at 80 C for the quantification of gene expression. 2.3. Full-length cDNA cloning Based on the partial sequence of AjPO identified from the transcriptome sequencing analysis of A. japonicus [27], the primers for 30 - and 50 -rapid amplification of cDNA ends (RACE)
345
Table 1 The primers used in this study. Primer name
Sequence (50 -30 )
Purpose
PO-3 PO-5 UPM long
30 -RACE PCR 50 -RACE PCR 50 - & 30 -RACE PCR
UPM short PO-rt-1s
CGTTGTTCTGTGATGCTAGAGTTGCG AAGCCGGTCCTTTGCCCTTTCCAT CTAATACGACTCACTATAGGGCA AGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC CAGCAGTTACAAGTGGGATG
PO-rt-1a
CCAGTCACGAAGACCAGAAT
CytbQ-F CytbQ-R
TGAGCCGCAACAGTAATC AAGGGAAAAGGAAGTGAAAG
50 - & 30 -RACE PCR Quantitative realtime PCR Quantitative realtime PCR Reference gene Reference gene
PCR were designed (Table 1). The cDNA templates for 30 - and 50 RACE PCR were synthesized respectively by employment of the total RNA from coelomocytes using the SMART PCR cDNA Synthesis Kit (Clontech) following the manufacturer’s instructions. The 30 - and 50 -RACE PCR were performed in a hot-lid thermocycler using SMART RACE cDNA Amplification Kit (Clontech) according to the instructions, and a touch-down PCR was employed with the following thermal cycling profiles: one cycle of initial denaturation at 94 C for 3 min; followed by 5 cycles of 94 C for 30 s, 72 C for 3 min; next 5 cycles of 94 C for 30 s, 70 C for 30 s, 72 C for 3 min; next 25 cycles of 94 C for 30 s, 68 C for 30 s, 72 C for 3 min; and a final extension of 72 C for 10 min. The specific PCR products were purified by Gel Extraction Kit (Omega), and then cloned into PMD-19T vector (TaKaRa). After transforming into the competent cells of Escherichia coli JM109, the recombinants were spread on the LB-agar Petri dish containing 100 mg/ml ampicillin. Positive clones containing the expected-size inserts were screened by colony PCR and then subjected for DNA sequencing. 2.4. Sequence analysis The similarity searches were performed using the BLASTX program at the National Center for Biotechnology Information (http:// ncbi.nlm.nih.gov/blast/). ORF was predicted using Open Reading Frame Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Translation and protein analysis were performed by ExPaSy tools (http://www.expasy.org/tools/). The protein motifs’ features were predicted by Simple Modular Architecture Research Tool (SMART, http://smart.emblheidelberg.de/) [28]. Multiple sequences alignments were generated by ClustalW2 (http://www.ebi.ac.uk/Tools/ msa/clustalw2/). An NJ phylogenic tree based on the deduced amino acid sequences was constructed using MEGA 4.0 program, and the reliability of the branching was tested by bootstrap resampling with 1000 pseudo-replicates [29]. 2.5. Substrate specificity analysis Using ProteoExtractÒ Native Membrane Protein Extraction Kit (Merck), the membrane proteins were isolated from coelomocytes and then used as crude AjPO for the determination of substrate specificity. Briefly, 10 ml of the crude AjPO solution was added to 190 ml of 15 mmol/L catechol, L-3, 4-dihydroxyphenylalanine (LDOPA), dopamine, hydroquinone and tyrosine that were dissolved in PBS respectively, and controls were performed by replacement of crude AjPO with the same volume of PBS. Subsequently, melanochrome formation was determined spectrophotometrically at 492 nm every 3 min for 27 min using a Sunrise microplate reader (Tecan) [30]. The measurement for each substrate was performed in triplicate.
346
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
Fig. 1. Full-length cDNA sequence and deduced amino acid sequence of AjPO. The deduced amino acid sequence is shown under the nucleotide sequence. The predicted transmembrane domain is underlined. The Cu-oxidase domains are shaded by light gray, and among these domains, the 10 histidines, 1 cysteine and 1 methionine that are predicted to bind copper are highlighted in yellow. The polyadenylation signal (AATAAA) and a long polyA are enclosed in solid lines at the C-terminal part. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Structural features of AjPO. Conserved domains of AjPO are predicted by SMART program. Transmembrane domain predicted by the TMHMM2 program is shown in blue, and the three Cu-oxidase domains predicted by Pfam are presented in dark gray. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
347
Fig. 3. Multiple alignment of the deduced amino acid sequences of laccase-type PO. The numbers 1, 2, and 3, above the sequence indicate the amino acids involved in coordinating the T1, T2, and T3 copper centers. Residues identical in all ten sequences are boxed in black. Conservative substitutions are boxed in gray. The predicted signal peptides are in bold type. The predicted transmembrane domains are shown with an underline. Abbreviations are as follows: NvPO, Nasonia vitripennis PO (NP_001155158.1); HsPO, Harpegnathos saltator PO (EFN87217.1); MsPO, Manduca sexta PO (AAN17506.1); DpPO, Danaus plexippus PO (EHJ67706.1); BmPO, Bombyx mori PO (DAA06286.1); NcPO, Nephotettix cincticeps PO (BAJ06131.1); SpPO, Strongylocentrotus purpuratus PO (XP_789287.3); Ag PO, Anopheles gambiae PO (EU380796.1); CgPO, Crassostrea gigas PO (ACH42090.1).
348
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
Table 2 POs from different species used for phylogenetic analysis. Species
Representative PO
Abbreviations
Types
Accession number
Bacteria
Bacillus sp. LS04 PO Enterobacter sp. JJDP1 PO N.crassa (strain TS) PO Trametes versicolor PO Suberites domuncula PO Crassostrea gigas PO Illex argentinus PO Sepia officinalis PO Pinctada fucata PO Nephotettix cincticeps PO Macrotermes barneyi PO Macrobrachium rosenbergii PO Penaeus monodon PO Eriocheir sinensis PO Scylla serrata PO Strongylocentrotus purpuratus PO Halocynthia roretzi PO Ciona intestinalis PO Cyprinus carpio PO Rana nigromaculata PO Gallus gallus PO Mus musculus PO Homo sapiens PO
BlPO EJPO NCrPO TvPO SdPO CgPO IaPO SoPO PfPO NCiPO MbPO MrPO PmPO EsPO SsPO SpPO HrPO CiPO CcPO RnPO GgPO MmPO HsPO
Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Tyrosinase type Non-tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Non-tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type Tyrosinase type
GU972589.1 JX570669.1 M18334.1 Y18012.1 AJ574915.1 EU678320.1 AB107880.1 AJ297474.1 DQ112679.1 BAJ06131.1 AFD33366.1 DQ182596.1 AF521948.1 EF493829.1 DQ435606.1 XP_789287.3 D63950.1 XM_002123004.2 JQ670941.1 D12514 D88349.1 M20234.1 M74314.1
Fungi Porifera Mollusca
Insecta Crustacea
Echinodermata Urochordata Teleostei Amphybia Aves Mammalia
2.6. Quantitative real-time PCR The expression patterns of AjPO mRNA in different tissues were determined using quantitative real-time PCR (qRT-PCR) in an Mx3005pÔ detection system (Applied Stratagene) with cytochrome b (Cytb) gene as the internal reference gene [31]. After challenge with LPS, PGN, Zymosan A and PolyI:C, the AjPO mRNA
expression in coelomocytes was also detected respectively. The qRT-PCR was performed using the SYBR Premix Ex TaqÔ II Kit (TaKaRa) in a reaction mixture of 20 ml, which was composed of 1 ml of cDNA template, 0.4 mM of each primer, 10 ml of 2 SYBR Premix Ex TaqÔ II (Tli RNaseH Plus), and 0.4 ml of ROX Reference Dye II. The temperature profile of qRT-PCR was 95 C for 30 s, followed by 40 cycles of 95 C for 10 s, 55 C for 25 s and 72 C for 25 s. The genespecific primers of AjPO designed for qRT-PCR were selected based on their amplification specificity by melting curve analysis (Table 1), and the amplicon was also confirmed according to the size using agarose gel electrophoresis. 2.7. Statistical analysis All the statistical analyses for the expression level of AjPO mRNA were normalized by the Cytb gene. The crossing-point values obtained from qRT-PCR were converted to fold differences using relative quantification method with the Relative Expression
Fig. 4. Phylogenetic tree of AjPO. The deduced amino acid sequence of AjPO is aligned with other known POs by the ClustalW program and the tree is constructed using MEGA 4.0 software with neighbor-joining method. The bootstrap sampling is performed with 1000 replicates. The information of POs and abbreviations are listed in Table 2.
Fig. 5. Substrate specificity of AjPO. The reactions of AjPO with catechol, L-DOPA, dopamine and hydroquinone are determined in triplicate using the microplate method at 492 nm. Values are shown as means SD (n ¼ 3).
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
349
respectively); however, no signal peptide was detected (Fig. 2). Among these Cu-oxidase domains, AjPO was predicted to contain 10 histidines residues, 1 cysteine residue and 1 methionine residue (565, 638, 643 and 650 in T1 copper center, and 186, 188, 230, 232, 568, 570, 637 and 639 in T2/T3 copper center), which were important for the binding of copper ions (Fig. 1). These residues were highly conserved among the laccase-type POs in invertebrates (Fig. 3). 3.2. Phylogenetic analysis of AjPO After phylogenic analysis based on POs from different species (Table 2), we detected two major distinct groups (Fig. 4): (a) tyrosinase-type POs from vertebrates and several invertebrates; (b) non-tyrosinase-type POs from invertebrates, fungi and bacteria. Among these POs, AjPO was close to the laccase-type PO in both S. purpuratus and insects. 3.3. Substrate specificity of AjPO Fig. 6. The distribution of AjPO mRNA in different tissues. Expression levels in all tissues are presented relative to that in respiratory tree (1). Values are shown as means SE (n ¼ 5). Abbreviations are as follows: M, muscle; BW, body wall; C, coelomocytes; F, tube feet; RT, respiratory tree; I, intestine.
Software Tool 384 v.2 [32]. Pairwise fixed reallocation randomization test was performed to compare the data from control and treatment groups, and the level of significance was defined as p < 0.05. 3. Results 3.1. Cloning and characterization of cDNA The full-length cDNA of AjPO (GenBank Accession No. KF040052) is 2508 bp in length, containing a 50 -untranslated region (UTR) of 92 bp, a 30 -UTR of 376 bp, and an ORF of 2040 bp encoding 679 amino acids with deduced molecular weight of 75.2 kDa and pI of 5.44 (Fig. 1). BLASTX results revealed that AjPO was homologous to the laccase-type POs in Strongylocentrotus purpuratus, Macrotermes barneyi and Nephotettix cincticeps with identities of 39%, 37% and 35% respectively. Structure prediction by SMART showed that AjPO had a transmembrane domain (31-53aa) and three conserved Cu-oxidase domains (133-252aa, 263-418aa and 500-658aa
The crude AjPO was able to catalyze catechol, L-DOPA, dopamine and hydroquinone. The largest velocity of melanochrome formation was detected in dopamine, followed by L-DOPA, hydroquinone, and catechol (Fig. 5). However, no reaction with tyrosine was detected. 3.4. Expression analysis of AjPO in different tissues Using qRT-PCR method, the transcripts of AjPO were detected in muscle, body wall, coelomocytes, tube feet, respiratory tree and intestine, with the expression levels of 0.2, 2.5 3.4, 3.0, 1.0 and 0.8 fold respectively (Fig. 6). 3.5. Expression patterns of AjPO after immune challenge The temporal expression of AjPO transcripts in the coelomocytes was detected respectively after the challenges of LPS, PGN, Zymosan A and PolyI:C (Fig. 7). In PBS group, the expression levels of AjPO showed no significant difference during the five sampling times by comparing with each other (0.8e1.2, P > 0.05); in LPS group, AjPO was significantly up-regulated at 12 and 24 h, and down-regulated at 72 h; in PGN group, AjPO was firstly downregulated to 0.1 fold at 4 h, then strongly up-regulated at 12, 24
Fig. 7. AjPO mRNA expression profile in coelomocytes post injection of LPS, PGN, Zymosan A and PolyI:C. Relative expressions of AjPO are expressed as fold changes over control samples taken at the same time interval as normalized to change in expression in the Cytb control. Values are shown as means SE (n ¼ 5). Significant differences compared with controls are indicated with an asterisk “*” at p < 0.05.
350
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351
and 48 h, finally down-regulated at 72 h, and the highest expression level appeared at 12 h (11.8 fold); in Zymosan A group, AjPO was also firstly down-regulated at 4 h, and then up-regulated from 12 h, and mounted to the peak at 24 h (9.8 fold); and in PolyI:C group, AjPO was successively down-regulated at 4 and 12 h, then strongly up-regulated at 48 h, and finally down-regulated at 72 h. 4. Discussion Microbial polysaccharide challenge or pathogens infection to invertebrates caused rapid and dramatic variation of REPH [14,16,17], indicating that PO is one of the most critical immune factors in the response to pathogens infection. In echinoderms, studies about PO were mainly focused on the characterization of enzymatic activity in coelomic fluid [33e35], while the information about PO gene and its expression profiles during immune response remain largely unexplored. So far, only S. purpuratus PO gene has been studied in echinoderms [36]. To understand the important role of PO in immune response and investigate the potential role of PO as an indicator for pathogens infection in A. japonicus, we cloned the full-length cDNA of AjPO gene and characterized AjPO based on substrate specificity. In addition, we also examed the distribution of AjPO mRNA in different tissues and the temporal expression patterns of AjPO mRNA in coelomocytes after four immune challenges. The full-length cDNA of AjPO encodes a PO protein of 679 amino acids, which is similar to that in numerous invertebrates including Eriocheir sinensis [19], artemia Artemia sinica [37], S. purpuratus (XP_789287.3), oyster Crassostrea gigas (ACH42090.1), mosquito Anopheles gambiae [13], and others. However, for the identity of sequence, AjPO is more similar to the laccase-type POs in S. purpuratus (XP_789287.3) and some insects such as M. barneyi (AFD33366.1) and N. cincticeps (BAJ06131.1). The phylogenic tree also suggests that AjPO has a close relationship to the laccase-type POs. AjPO was predicted to have a typical transmembrane domain at the N-terminal part lacking the signal peptide, suggesting that this enzyme may be membrane bound, similar to that in A. gambiae [13]. The structure of AjPO is different from that in S. purpuratus, C. gigas and ant Harpegnathos saltator. In S. purpuratus (XP_789287.3), PO has both transmembrane domain and signal peptide, while in C. gigas (ACH42090.1) and H. saltator (EFN87217.1), POs have only transmembrane domain at the C-terminal part. Moreover, AjPO was also predicted to have three Cuoxidase domains with copper binding centers formed by 10 histidines, one cysteine and one methionine respectively, indicating that AjPO is a typical laccase-type PO [38]. The substrate specificity analysis showed that the isolated membrane proteins could oxidize o-diphenols (catechol, L-DOPA, and dopamine) and p-diphenols (hydroquinone), but failed to oxidize monophenols (tyrosine), suggesting that laccase-type PO exists among these membrane proteins. Collectively, we could conclude that AjPO is a membranebinding laccase-type PO. Expression analysis indicated that AjPO mRNA was expressed in all the examined tissues, and was most highly expressed in coelomocytes, suggesting that AjPO is a widely distributed and essential immune factor in A. japonicus. Its immune function may be achieved mainly depending on the coelomocytes. The temporal profiles of AjPO transcripts showed that AjPO was very sensitive to the immune stimulations. The significant upregulation of AjPO at 12 h post injection of LPS, PGN, Zymosan A, which represent Gram-negative bacteria, Gram-positive bacteria and fungi respectively, and at 24 h post injection of PolyI:C, which represent double-stranded RNA (dsRNA) viruses, suggest that AjPO might be more efficient in the response against bacterial and fungal invasions comparing to virus infection. The downregulation of AjPO at 4 h was simultaneously found in PGN,
Zymosan A and PolyI:C groups, similar to that in C. farreri after challenge with LPS [17] and in E. sinensis after challenge with V. anguillarum [19]. These results suggest that the infection of pathogens such as Gram-positive bacteria, fungi and dsRNA viruses might cause a depression on AjPO expression at the beginning, however, this depression was not found in the LPS group, mainly because that AjPO response system might develop a better adaptability to the stimulation of Gram-negative bacteria. In addition, the depression on AjPO expression was also found in the groups of LPS, PGN and PolyI:C at 72 h post injection, which may resulted from the excessive expression of AjPO in the previous response process. It has been reported that in invertebrates the excessive expression of PO is harmful to the organism itself and will trigger the relative cascade reactions to decrease the PO expression [1]. Comparatively, the successive down-regulation of AjPO at 4 and 12 h made the AjPO transcripts profile in PolyI:C group distinguishable from that in the other three challenge groups, suggesting that AjPO have the potential values as an indicator in the infection of dsRNA viruses. In this study, the full-length cDNA of PO from A. japonicas was cloned, and the substrate specificity and mRNA expression profile of AjPO were characterized. These results are expected to provide basic knowledge on AjPO. The prokaryotic expression and antibody production of this PO in further study are expected to explore the immune and disease-warning function of PO in sea cucumber. Acknowledgments This work was supported by grants from National Nature Science Foundation of China (31272687), State 863 High-Technology R & D Project of China (2012AA10A412), Science & Technology Project of Liaoning Province (2011203005), and Doctoral Startup Foundation of Liaoning Province (20111072). References [1] Cerenius L, Söderhäll K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [2] Muñoz P, Meseguer J, Esteban MA. Phenoloxidase activity in three commercial bivalve species. Changes due to natural infestation with Perkinsus atlanticus. Fish Shellfish Immunol 2006;20:12e9. [3] Aladaileh S, Nair SV, Raftos DA. Induction of phenoloxidase and other immunological activities in Sydney rock oysters challenged with microbial pathogen-associate molecular patterns. Fish Shellfish Immunol 2007;23: 1196e208. [4] Newton K, Peters R, Raftos D. Phenoloxidase and QX disease resistance in Sydney rock oysters (Saccostrea glomerata). Dev Comp Immunol 2004;28: 565e9. [5] Zhao PC, Li JJ, Wang Y, Jiang HB. Broad-spectrum antimicrobial activity of the reactive compounds generated in vitro by Manduca sexta phenoloxidase. Insect Biochem Mol Biol 2007;27:952e9. [6] Cerenius L, Babu R, Söderhäll K, Jiravanichpaisal P. In vitro effects on bacterial growth of phenoloxidase reaction products. J Invertebr Pathol 2010;103:21e 3. [7] Barret FM. Phenoloxidases from larval cuticle of the sheep blowfly, Lucilia cuprina: characterization, developmental changes, and inhibition by antiphenoloxidase antibodies. Arch Insect Biochem Physiol 1987;5:99e118. [8] Liu GX, Yang LL, Fan TJ, Cong RS, Tang ZH, Sun WJ, et al. Purification and characterization of phenoloxidase from crab Charybdis japonica. Fish Shellfish Immunol 2006;20:47e57. [9] Cong RS, Sun WJ, Liu GX, Fan TJ, Meng XH, Yang LL, et al. Purification and characterization of phenoloxidase from clam Ruditapes philippinarum. Fish Shellfish Immunol 2005;18:61e70. [10] Aspän A, Huang TS, Cerenius L, Söderhäll K. cDNA cloning of a prophenoloxidase from the freshwater crayfish Pacifastacus leniusculus and its activation. Proc Natl Acad Sci USA 1995;92:939e42. [11] Söderhäll K, Cerenius L. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr Opin Immunol 1998;10:23e8. [12] Wu S, Wang SH, Wang YL, Zhang ZP. Phenoloxidase in mollusca and crustacean. Chin J Zool 2009;44:137e46 [in Chinese]. [13] Gorman MJ, Dittmer NT, Marshall JL, Kanost MR. Characterization of the multicopper oxidase gene family in Anopheles gambiae. Insect Biochem Mol Biol 2008;38:817e24.
J. Jiang et al. / Fish & Shellfish Immunology 36 (2014) 344e351 [14] Lourenço AP, Zufelato MS, Bitondi MMG, Simões ZLP. Molecular characterization of a cDNA encoding prophenoloxidase and its expression in Apis mellifera. Insect Biochem Mol Biol 2005;35:541e52. [15] Cerenius L, Bangyeekhun E, Keyser P, Söderhäll I, Söderhäll K. Host prophenoloxidase expression in freshwater crayfish is linked to increased resistance to the crayfish plaque fungus, Aphanomyces astaci. Cell Microbiol 2003;5: 353e7. [16] Hauton C, Hammond JA, Smith VJ. Real-time PCR quantification of the in vitro effects of crustacean immunostimulants on gene expression in lobster (Homarus gammarus) granular haemocytes. Dev Comp Immunol 2005;29:33e42. [17] Zhou Z, Ni DJ, Wang MQ, Wang LL, Wang LL, Shi XW, et al. The phenoloxidase activity and antibacterial function of a tyrosinase from scallop Chlamys farreri. Fish Shellfish Immunol 2012;33:375e81. [18] Ko CF, Chiou TT, Vaseeharan B, Lu JK, Chen JC. Cloning and characterisation of a prophenoloxidase from the haemocytes of mud crab Scylla serrata. Dev Comp Immunol 2007;31:12e22. [19] Gai YC, Zhao JM, Song LS, Li CH, Zheng PL, Qiu LM, et al. A prophenoloxidase from the Chinese mitten crab Eriocheir sinensis: gene cloning, expression and activity analysis. Fish Shellfish Immunol 2008;24:156e67. [20] Cheng P, Li JT, Li J, Liu P, Gao BQ, Wang QY. Molecular cloning and characterization of prophenoloxidase gene in swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2010;28:106e12. [21] Arockiaraj J, Gnanam AJ, Pothikasalam G, Milton J, Pasupuleti M, Bhatt P, et al. A novel prophenoloxidase, hemocyanin encoded copper containing active enzyme from prawn: gene characterization. Gene 2013;524:139e51. [22] Li YH, Deng W, Yang KL, Wang WM. The expression of prophenoloxidase mRNA in red swamp crayfish, Procambarus clarkii, when it was challenged. Genomics 2012;99:355e60. [23] Ai HS, Huang YC, Li SD, Weng SP, Yu XQ, He JG. Characterization of a prophenoloxidase from hemocytes of the shrimp Litopenaeus vannamei that is down-regulated by white spot syndrome virus. Fish Shellfish Immunol 2008;25:28e39. [24] Deng H, Zhou ZC, Wang NB, Liu C. The syndrome of sea cucumber (Apostichopus japonicus) infected by virus and bacteria. Virologica Sinica 2008;23:63e7. [25] Li CH, Feng WD, Qiu LH, Xia CG, Su XR, Jin CH, et al. Characterization of skin ulceration syndrome associated microRNAs in sea cucumber Apostichopus japonicus by deep sequencing. Fish Shellfish Immunol 2012;33:436e41.
351
[26] Liu HZ, Zheng FR, Sun XQ, Hong XG, Dong SL, Wang B, et al. Identification of the pathogens associated with skin ulceration and peristome tumescence in cultured sea cucumbers Apostichopus japonicus (Selenka). J Invertebr Pathol 2010;105:236e42. [27] Zhou ZC, Dong Y, Sun HJ, Yang AF, Chen Z, Gao S, et al. Transcriptome sequencing of sea cucumber (Apostichopus japonicus) and the identification of gene-associated markers. Mol Ecol Resour 2013. http://dx.doi.org/10.1111/ 1755-0998.12147. [28] Letunic I, Doerks T, Bork P. SMART 6: recent updates and new developments. Nucleic Acids Res 2009;37:229e32. [29] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [30] Söderhäll K. Fungal cell wall b-1,3-glucans induce clotting and phenoloxidase attachment to foreign surfaces of crayfish haemocyte lysate. Dev Comp Immunol 1981;5:565e73. [31] Yang AF, Zhou ZC, Dong Y, Jiang B, Wang XY, Chen Z, et al. Stability comparison of cytb and b-actin gene expression in sea cucumber Apostichopus japonicus. J Agric Sci Technol 2010;12:79e84 [in Chinese]. [32] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST(c)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30. [33] Cauicatti C, Seymour J. Evidence for phenoloxidase activity in Holothuria tubulosa (Echinodermata) brown bodies and cells. Parasitol Res 1991;77:50e 3. [34] Wang YN, Liu XW, Liu YP, Chang YQ. Analysis of phenoloxidase activity in the coelomic fluid of Strongylocentrotus intermedius. J Agric Sci Technol 2011;13: 116e20 [in Chinese]. [35] Liu HG, Zheng FR, Sun XQ, Tang XX. Effect of sodium selenite on some enzymes of coelomic fluid to the immune response of holothurian Apostichopus japonicus. J Fisher China 2012;36:98e105 [in Chinese]. [36] Tu Q, Cameron RA, Worley KC, Gibbs RA, Davidson EH. Gene structure in the sea urchin Strongylocentrotus purpuratus based on transcriptome analysis. Genome Res 2012;22:2079e87. [37] Fan TJ, Wang LY, Fan XY, Xu B, Yu MM, Jiang GJ. A prophenoloxidase from Artemia sinica: cDNA cloning, expression and activity analysis during early development. Fish Shellfish Immunol 2011;31:1059e64. [38] Dittmer NT, Kanost MR. Insect multicopper oxidases: diversity, properties, and physiological roles. Insect Biochem Mol Biol 2010;40:179e88.