Identification and expression analysis of two Toll-like receptor genes from sea cucumber (Apostichopus japonicus)

Fish & Shellfish Immunology 34 (2013) 147e158

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Identification and expression analysis of two Toll-like receptor genes from sea cucumber (Apostichopus japonicus) Hongjuan Sun a, b, Zunchun Zhou a, *, Ying Dong a, Aifu Yang a, Bei Jiang a, Shan Gao a, Zhong Chen a, Xiaoyan Guan a, Bai Wang a, Xiuli Wang b a b

Liaoning Key Lab of Marine Fishery Molecular Biology, Liaoning Ocean and Fisheries Science Research Institute, No. 50 Heishijiao St, Dalian, Liaoning 116023, PR China College of Fisheries and Life Science, Dalian Ocean University, Dalian, Liaoning 116023, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 2 June 2012 Received in revised form 1 October 2012 Accepted 11 October 2012 Available online 24 October 2012

Toll-like receptors (TLRs) are a family of type I integral membrane glycoproteins which play pivotal roles in innate immunity. In this study, two TLRs named AjTLR3 and AjToll were cloned from sea cucumber (Apostichopus japonicus). The full-length cDNA sequences of AjTLR3 and AjToll are 3484 bp and 4211 bp, with an open reading frame (ORF) of 2679 bp and 2853 bp, encoding 892 and 950 amino acids, respectively. Both AjTLR3 and AjToll are composed of a leucine-rich repeat (LRR) domain, a transmembrane (TM) domain and an intracellular Toll/interleukin-1 receptor (TIR) domain. Evolution analysis revealed that AjTLR3 and AjToll were clustered with the vertebrate-like TLRs (V-TLRs) and the protostome-like TLRs (P-TLRs), respectively. These two genes were widely expressed in all five tested tissues (body wall, coelomocytes, tube feet, intestine and respiratory tree), but showed different expression patterns. The significantly up-regulated expressions of AjTLR3 and AjToll after peptidoglycan (PGN), lipopolysaccharides (LPS), Zymosan A and polyinosinicepolycytidylic acid (PolyI:C) challenges suggested that they were functionally involved in the immune responses to the Cram-positive bacteria, Gram-negative bacteria, fungi and double-stranded RNA (dsRNA) viruses, respectively. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Sea cucumber Apostichopus japonicus AjTLR3 AjToll Expression analysis

1. Introduction TLRs are germline-encoded pattern recognition receptors (PRRs) in innate immunity on which invertebrates rely completely for their protection against pathogens [1]. In contrast to the high specificity of the adaptive immune system in vertebrate, the natural immune system depends mainly on the PRRs to recognize the pathogenassociated molecular patterns (PAMPs) which are the conserved features of pathogens [2]. The PAMPs derived principally from pathogens include protein (flagellin), sugar (zymosan), lipid (LPS), nucleic acid (DNA and RNA) and derivatives of them [3,4]. The canonical TLRs are characterized by a pathogen-binding ectodomain (ECD) encompassing tandem leucine-rich repeats (LRRs), a transmembrane (TM) domain and a Toll/interleukin-1 receptor (TIR) domain, where downstream signal molecules are recruited [5]. Based on the different structures of ECDs, two types of TLRs were named: vertebrate-like TLRs (V-TLRs) and protostome-like TLRs (P-TLRs) [6]. A typical V-TLR consists of one set of LRRNT-

* Corresponding author. Tel./fax: þ86 411 84691884. E-mail address: [email protected] (Z. Zhou). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.10.014

LRRs-LRRCT, whereas the LRRs domain of P-TLR is divided by an extra LRRCT-LRRNT motif [6]. Genetic studies of TLR were initially performed on Drosophila melanogaster Toll, which possessed triplex functions in embryonic patterning [7,8], larval hematopoiesis [9] and immune recognition [10], subsequently the research attention was converted to the mammal TLRs which are solely dedicated to immunity [11,12]. Recently, owing to the whole-genome and transcriptome sequencing for the representative metazoans, an overview of the TLR family was available in an organism. From the most ancient metazoan phylum porifera to aves, 59 metazoan species in all are considered to possess TLR genes [13], as well as a large amount of LRR-only and TIR-only genes. The investigations of TIR and LRR domains in basal deuterostome and protostome confirm the existence of domain combinations in the evolution of TLR [14]. So far, at least 23 different TLRs have been reported in vertebrates [13]. In order to reveal the immune mechanism and evolution pathways of vertebrate TLRs, more information about TLRs from different intermediate species is needed, such as echinoderms, protochordates, urochordates and agnathans. Echinoderms represent the highest invertebrates for deuterostome superphylum, sharing the evolutionary history with chordates. Most of the immune information about echinoderms came

148

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

from genomic sequencing of Strongylocentrotus purpuratus in which a complex repertoire of immune receptors, regulators and effectors unlike other phylum was found [15]. The TLR family in sea urchin consists of 214 V-TLRs and 8 P-TLRs that are known for multiplicity and the apparent rapid diversification [16]. Now, V-TLRs in S. purpuratus have expanded to three groups: SpTLR1 (SpTLR1.1 and SpTLR1.2), SpTLR2 (SpTLR2.1) and SpTLRs found from BCM-HGSC (Baylor College of Medicine Human Genome Sequencing Center) [14]. As a sister phyla with sea urchin, sea cucumbers are members of the class Holothuroidea, which diverged from the echinoids 500 to 600 million years ago [17]. Sea cucumber Apostichopus japonicus is an economically important aquaculture species in the coasts of Bohai Sea and Yellow Sea in China. During the past decade, skin ulceration disease posed the most serious threat to the sea cucumbers cultivation [18]. Before virus particles were identified in the infected sea cucumbers by electron microscopic observation [19,20], primary pathogen agents isolated from cultured sea cucumbers were Gram-negative bacteria [21e23]. On the other hand, fungi and parasitism in culture environment are also the important pathogens caused the sea cucumber diseases. So it’s very important to identify and characterize the immune-related genes responded to pathogens. Till now, some immune-related genes in sea cucumbers have been characterized and their expression patterns after LPS challenge have been analyzed, including serum amyloid A (SAA), C-type lectin, ferritin, cathepsin, toposome, an Alpha 2 macroglobulin domain (A2M)-containing protein, DD104 protein, thymosin-beta, lysozyme, serine proteinase inhibitor, and complement C3 [24e29]. Although genome sequencing of sea cucumber was unavailable, many efforts have been performed for transcriptome sequencing [30,31]. To identify more comprehensive information about immune related genes, we have also performed a large-scale transcriptome sequencing (data not published) in which some TLR gene fragments were found. In this paper, we reported the cloning of full-length cDNA sequences, the characterization and the expression analysis of two TLRs from sea cucumber A. japonicus. It is not only useful for the evolution research of sea cucumber TLRs, but also for elaborating their roles in the immune responses against distinct pathogens infections.

2. Materials and methods 2.1. Animals and immune challenges Healthy mature sea cucumbers ranging from 12 g to 15 g in body weight were obtained from Guanglu island (Dalian, China) and kept in seawater aquaria at 15e18  C for one week before the experiments. Total RNA isolated from the coelomocytes was used to clone the full-length cDNA of TLR genes. To examine the constitutive expression of TLRs, five tissues were collected from fifteen healthy animals (3 pools of 5 individuals each) including body wall, coelomocytes, tube feet, intestine and respiratory tree. The mixed tissues were preserved in RNAlater (Invitrogen) at 4  C for 12 h, and then stored at 80  C for RNA extraction. Four different immune challenges were conducted by coelomic injection for each animal with 500 ml PolyI:C (100 mg/ml), LPS (1 mg/ml), peptidoglycan (PGN) (100 mg/ml) or Zymosan A (300 mg/ ml). PolyI:C (Sigma, P9582), LPS (Sigma, L2880), PGN (Sigma, 77140) and Zymosan A (Sigma, Z4250) were diluted with phosphate buffered saline (PBS, pH ¼ 7.4). The control group was injected with 500 ml PBS. Fifteen animals in each group were dissected at 4 h, 12 h, 24 h, 48 h and 72 h post-treated. The different tissues were also collected as above for inductive analysis with quantitative real-time PCR (qRT-PCR).

2.2. RNA extraction and cDNA synthesis Total RNA was extracted using the RNAprep pure Tissue Kit (TIANGEN BIOTECH, China) following the manufacturer’s instructions. RNase-free DNase I must be added to digest any contaminating genomic DNA. The concentration of RNA was measured by the NanoPhotometer (Implen GmbH, Munich, Germany) and the integrity of RNA was visualized on agarose gel electrophoresis. First strand cDNA was synthesized with 900 ng total RNA, 25 pmol Oligo dT Primer, 50 pmol random 6 mers, 4 ml 5  PrimeScriptÔ buffer, 1 ml PrimeScriptÔ RT enzyme Mix I (PrimeScriptÔ RT reagent Kit, TaKaRa) in a 20 ml reaction system. Reactions were incubated at 37  C for 15 min, and then at 85  C for 5 s to deactivate the enzyme. All cDNA samples were preserved at 80  C for the quantification of gene expression. 2.3. Cloning and sequencing of full-length cDNA The partial sequence of TLR was identified from the transcriptome analysis result of A. japonicus (data not published). Total RNA extracted from coelomocytes was transcribed with the SMART PCR cDNA Synthesis Kit (Clontech), following the manufacturer’s instructions. To obtain the full-length of AjTLRs, 30 - and 50 -rapid amplification of cDNA ends (RACE) PCR was performed using SMART RACE cDNA Amplification Kit (Clontech) and the primers are listed in Table 1. Touchdown-PCR was carried out using a hot-lid thermocycler with the following thermal cycling profiles: one cycle of initial denaturation at 95  C for 5 min; followed by 5 cycles of 94  C for 30 s, 72  C for 3 min; next 5 cycles of 94  C for 30 s, 70  C for 30 s, 72  C for 3 min; next 30 cycles of 94  C for 30 s, 68  C for 30 s, 72  C for 3 min; and a final extension of 72  C for 10 min. The specific PCR product was purified and ligated into pMD-19T vector (TaKaRa). After transforming into the competent Escherichia coli JM109 cells, the product was spread on the LB-agar Petri dish containing 100 mg/ml ampicillin. Positive clones containing the expected-size inserts were screened by colony PCR and then sequenced. 2.4. Sequence and phylogenetic analysis Full-length cDNA sequences were directly blasted using the BLASTX program at NCBI (http://www.ncbi.nlm.nih.gov/BLAST) to search the homologous proteins with default settings. N-glycosylation sites in TLR were predicted in NetNGly 1.0 Server [32] and the phosphorylation of Tyrosine sites was deduced by NetPhos 2.0 Server [33]. Open Reading Frame (ORF) was predicted using Open Reading Frame Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf. html). Translation and protein analysis were performed by ExPaSy tools (http://www.expasy.org/tools/). The identification and Table 1 Primers used for TLR genes cloning and expression analysis. Target

Sequence (50 / 30 )

Purpose

TLR3-3P TLR3-5P Toll-3P Toll-5P UPM

AGTGGCCAGGCGAGAGGGCCTCGTCC TGGAACAGCCGTCAAGCCTCGGTGA TTCAGGGCAGCTCATAGCCAAGCG GGGAAGACGGTAATTTCGTTATGAC Long-CTAATACGACTCACTATAGGGCA -AGCAGTGGTATCAACGCAGAGT Short-CTAATACGACTCACTATAGGGC TTGAAGCGTTGGATTTG GGACCGATGTTGGAGATA ACGAAAGCGATTTAGCC GAGCCCGTGGTGAGATG TGAGCCGCAACAGTAATC AAGGGAAAAGGAAGTGAAAG

30 -RACE PCR 50 -RACE PCR 30 -RACE PCR 50 -RACE PCR 50 - & 30 -RACE PCR

TLR3Q-F TLR3Q-R TollQ-F TollQ-R CytbQ-F CytbQ-R

50 - & 30 -RACE PCR Quantitative Real-Time Quantitative Real-Time Quantitative Real-Time Quantitative Real-Time Reference gene Reference gene

PCR PCR PCR PCR

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

annotation of TLR protein structures were conducted by the Simple Modular Architecture Reach Tool [34] (SMART, http://smart.emblheidelberg.de/) and Pfam predictions (http://pfam.sanger.ac.uk/ search). Multiple sequences alignments were generated by ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). A phylogenic tree was constructed using MEGA 4.0 program with the neighborjoining method and the reliability of the branching was tested by bootstrap resampling with 1000 pseudo-replicates [35]. 2.5. Quantitative real-time PCR The expression patterns of TLRs mRNA between different tissues and the expression profiles after challenge with PGN, LPS, Zymosan A and PolyI:C were assessed using quantitative real-time PCR (qRTPCR) in a Mx3005pÔ detection system (Applied Stratagene, USA). The qRT-PCR was conducted using the SYBR Premix Ex TaqÔ II Kit (Tli RNaseH Plus, TaKaRa) in a total volume of 20 ml containing 10 ml of 2  SYBR Premix Ex TaqÔ II (Tli RNaseH Plus), 0.4 ml of ROX Reference Dye II, 2 ml of cDNA template, and 0.4 mM of each primer. The qRT-PCR program was 95  C for 30 s, followed by 40 cycles of 95  C for 10 s, 56  C for 25 s and 72  C for 25 s. The cytochrome b (Cytb) gene was used as the internal reference gene [36]. The qRTPCR specific primers of TLRs are listed in Table 1. Optimal primer pairs were selected based on their amplification specificity by melting curve analysis. In addition, the amplicons were checked by agarose gel with a 100 bp ladder in order to confirm the correct amplicon sizes. 2.6. Statistical analysis All statistical analyses were based on AjTLRs gene expression levels normalized by Cytb gene. The crossing-point (CP) values generated after the qRT-PCR were converted to fold differences by relative quantification method using the Relative Expression Software Tool 384 v.2 (REST) [37]. Expression differences between control and treatment groups were assessed in group mean by pairwise fixed reallocation randomization test. Data for group differences were expressed as mean  standard error (SE), and each measurement was performed three times. The statistically significant difference was marked with an asterisk when P < 0.05.

149

and 108.08 kDa, where N-linked glycosylations were not taken into consideration. The estimated isoelectric point (pI) of AjTLR3 and AjToll was 6.34 and 5.00, respectively. Structure prediction by SMART indicated that both AjTLR3 and AjToll are typical type I transmembrane proteins (Fig. 2). The structure of AjTLR3 includes a putative signal peptide (1e30aa) at N-terminus, followed by an LRR domain, a transmembrane domain (671e693aa) and an intracellular TIR domain (727e876aa) at the Cterminus (Fig. 1A). Only one set of “LRRNT-LRRn-LRRCT” (n ¼ 16) was detected in the AjTLR3 ECD. AjToll is composed of thirteen LRRs, a transmembrane domain (745e767aa) and an intracellular TIR domain (797e934aa), but a signal peptide is absent at Nterminus (Fig. 1B). The LRRNT is located in the middle of the LRRs without LRRCT as a counterpart. Two and four cysteine residues are located in LRRNT and LRRCT of AjTLR3 respectively (Fig. 3A) and five cysteine residues are located in LRRNT of AjToll (Fig. 3B). The disulfide bonds probably formed between cysteine residues were capable of enhancing the stabilization of the extracellular portion [39]. The highly conserved segment (HCS) in V-TLRs is: LxxLxLxxNxL (“L” is Leu, Ile, Val or Phe and “N” is Asn, Thr, Ser or Cys and “x” is any amino acid) [40], which were also identified within the LRRs of AjTLR3 and AjToll (Fig. 3). Predicted by NetNGly 1.0 program, eight potential N-linked glycosylation sites were detected at the ECDs of both AjTLR3 and AjToll (AjTLR3: N283e N293eN316eN362eN369eN450eN571eN637; AjToll: N3eN73eN232e N246eN620eN660eN675eN695) (Fig. 1). Sequence identities were also calculated based on the alignment of different phylum TIR sequences which were the highly conserved domains during evolution (Table 2). The TIR in AjTLR3 showed the highest identity (34.8%) with Branchiostoma belcheri tsingtauense TIR, while AjToll TIR showed 51% identity with Apis mellifera TIR (Table 3). Besides, the TIR domains of the AjTLR3 and AjToll shared 28.2% identity with each other. The most critical amino acid residue (Tyr759) in TIR domain of human TLR3 for the intracellular signaling was not identified in the AjTLR3 or AjToll [41]. The phosphorylation of Tyrosine sites predicted by NetPhos 2.0 Server was Y849 in AjTLR3 and Y872, Y909, Y915, Y929 in AjToll (Fig. 4). Three light gray boxes in AjTLRs correspond to the three highly conserved motifs of IL-1 receptor family: box 1, FDA or YDA; box 2, RDXXPG; and box 3, FW [42].

3. Results

3.2. Phylogenetic analysis of AjTLRs

3.1. Characterization of cDNA sequences and deduced proteins

In order to assess evolutionary lineage, the phylogenetic tree was conducted based on the full-length TLR amino acid sequences retrieved from GenBank and SpBase (Table 2). Apparently, these two AjTLRs fell into distinct clades. AjTLR3 and the V-TLRs of S. purpuratus were frankly grouped with vertebrate TLR3, and AjTLR3 was most closely related to S. purpuratus TLR3 with high bootstrap support. While AjToll and P-TLRs of S. purpuratus were clustered in the same subgroup with other protostome Tolls (Fig. 5).

The full-length cDNAs of two A. japonicus TLRs (AjTLRs) were obtained by RACE method based on the partial fragments from transcriptome data. They were named as AjTLR3 and AjToll according to the BLASTX results. AjTLR3 showed 34%, 33% and 32% identities with the S. purpuratus TLR3, Cercocebus atys TLR3 and Xenopus (Silurana) tropicalis TLR3 respectively. AjToll was homologous to protostome Toll genes, showed 49%, 44% and 42% identities with Camponotus floridanus Toll, Tribolium castaneum Toll and Aedes aegypti Toll respectively. The full-length cDNA of AjTLR3 (GenBank Accession No. JQ412754) is 3484 bp, containing a 50 untranslated region (UTR) of 176 bp, an ORF of 2679 bp encoding 892 amino acids and a 30 -UTR of 629 bp (Fig. 1A). The length of AjToll (JQ743247) is longer than AjTLR3, consisting of 4211 bp with a 50 -UTR of 72 bp, an ORF of 2853 bp encoding 950 amino acids and a 30 -UTR of 1286 bp (Fig. 1B). As is well known, the instability of mRNAs is always related to the AU-rich elements (AREs) in 30 -UTR [38]. Four putative ATTTA, which is one of the canonical AREs, were observed in the 30 -UTRs of AjTLR3 and AjToll, respectively. The deduced molecular weight for AjTLR3 and AjToll was 100.60 kDa

3.3. AjTLRs expression in different tissues To investigate the expression profiles of AjTLR3 and AjToll, qRTPCR was used to analyze their expression levels in five tissues from healthy sea cucumbers. Transcripts of these two genes were observed in all tested tissues, but showed different expression patterns (Fig. 6). AjTLR3 was highly expressed in respiratory tree, followed by intestine, tube feet and coelomocytes, but expressed at a very low level in body wall. AjToll was also expressed at a very high level in respiratory tree, while its expression levels were similar and relative lower in other tissues.

Fig. 1. Full-length cDNA sequences and deduced amino acid sequences of AjTLR3 (A) and AjToll (B). The deduced amino acid sequence is shown under the nucleotide sequence. The predicted signal peptide is only presented in AjTLR3 marked by a box (residues 1e30). LRRs and TIR domains are shaded by light gray and the overlaps of LRRs are dark gray. The transmembrane domains are shown as underlines. The N-linked glycosylation sites in the ECDs are shown with dark gray underlay. In the 30 -UTR of AjTLRs, the motifs associated with mRNA instability (ATTTA) are shaded by dark gray.

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

Fig. 1. (continued).

151

152

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

3.4. AjTLRs expression patterns after immune challenges

Fig. 2. Structural features of AjTLR3 (A) and AjToll (B). Schematic representations of AjTLRs were predicted by SMART program. Signal peptide determined by the SignalP program is shown in red. Transmembrane (TM) domain predicted by the TMHMM2 program is in dark blue. Abbreviations indicate as follows: LRR, leucine-rich repeat; TIR, Toll/IL-1 receptor; LRRNT, leucine-rich repeat N-terminal domain; LRRTYP, leucine-rich repeats typical subfamily; LRRCT, leucine-rich repeat C-terminal domain. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

After four different challenges, the expression levels of AjTLR3 and AjToll in different tissues were detected by qRT-PCR (Fig. 7). In PGN group, both AjTLR3 and AjToll were strongly up-regulated at 4 h and 12 h in coelomocytes where their expressions were weakly in healthy tissues. Similar situations were detected after LPS challenge, and the expression levels of AjTLR3 and AjToll were rapidly up-regulated to 25 fold and 18 fold in tube feet, while the changes were less than 5 fold in other four tissues. It is interesting that AjToll was strongly up-regulated about 66 fold and 60 fold in respiratory tree and tube feet at 12 h after the Zymosan A and PolyI:C challenge respectively. Although the up-regulation levels of AjTLR3 were lower than that of AjToll in most cases, their expression profiles were very similar.

Fig. 3. Conserved residues in LRRs of AjTLR3 (A) and AjToll (B). The highly conserved segment (HCS) within the LRRs is: LxxLxLxxNxL (“L” is Leu, Ile, Val or Phe and “N” is Asn, Thr, Ser or Cys and “x” is any amino acid). The numbers represent the amino acids positions of LRRs. Cysteines in the LRRNT or LRRCT sequences are shaded by dark gray.

AAX33677.1

664e801

EEZ99324.1

Branchiostoma belcheri tsingtauense TLR1 (bbtTLR1)

797e944

ABD58972.2

Teleostei

Danio rerio TLR3 (DrTLR3) Takifugu rubripes TLR3 (TrTLR3)

756e899

AAI07956.1

749e883

AAW69373.1

Amphybia

Xenopus tropicalis TLR3 (XtTLR3)

729e875

XP_002934448.1

Mammalia

Homo sapiens TLR3 (HsTLR3) Cercocebus atys TLR3 (CaTLR3)

755e900

ABC86910.1

755e900

ABY64989.1

Gallus gallus TLR3 (GgTLR3)

692e838

ACR26371.1

Aves

17.7% 17.1%

24% 20.4%

DrTLR3

28.2% e

BbtTLR1 AjToll

e 28.2%

34.8% 32.2% Abbreviations can be seen in Table 2.

Cephalochordata

AjTLR3

XP_003731595.1

34% 30.6%

710e852

SpTLR3

TLR3

23.6% 37.8%

SPU_011823.1

SpTLR066

761e900

24.5% 34.2%

TLR066

SpTLR043

SPU_008228.1

27.7% 44.3%

743e878

SpTLR041

TLR043

20.2% 17.6%

SPU_007859.1

SpTLR2.1

742e883

16.9% 16.3%

TLR041

SpTLR1.2

XP_001182083.1

25% 43.8%

593e729

LvToll

TLR2.1

28.9% 46.3%

AAK25762.1

AaToll

783e919

28.9% 48.5%

TLR1.2

TcToll

AAK25761.1

27.6% 51%

724e880

AmToll

TLR1.1

AjTLR3 AjTol

S. purpuratus (SpTLR1.1) S. purpuratus (SpTLR1.2) S. purpuratus (SpTLR2.1) S. purpuratus (SpTLR041) S. purpuratus (SpTLR043) S. purpuratus (SpTLR066) S. purpuratus (SpTLR3)

28.9% 45.3%

ABO38434.1

DmToll

766e904

TtToll

BAF99007.1

25% 43.8%

843e981

CtToll

ACC68670.1

24.3% 43.1%

765e903

EsToll

AEK86517.1

18.4% 32.6%

1045e1182

GfToll

AEK86516.1

32.8% 43.4%

842e980

CgToll

ABK58729.1

19% 32.6%

761e899

Litopenaeus vannamei Toll (LvToll) L. vannamei Toll2 (LvToll2) L. vannamei Toll3 (LvToll3) Fenneropenaeus chinensis Toll (FcToll) Marsupenaeus japonicus Toll (MjToll) Penaeus monodon Toll (PmToll)

AjTLR3 AjTol

Echinodermata

XP_001649813.1

Table 3 Amino acid sequence identities of TIR domains in AjTLRs compared with different phylum TIR domains.

Crustacea

1092e1229

23,3% 25%

832e970

XtTLR3

AAQ64937.1

22% 22.9%

789e927

CaTLR3

Drosophila melanogaster Toll (DmToll) Apis mellifera Toll (AmToll) Tribolium castaneum Toll (TcToll) Aedes aegypti Toll (AaToll)

Insecta

21.4% 25%

BAD12073.1

GgTLR3

854e991

20.1% 22.9%

ABK88278.1

HsTLR3

854e991

20.7% 21%

Carcinoscorpius rotundicauda TLR (CrTLR) Tachypleus tridentatus Toll (TtToll)

TrTLR3

AAY27971.1

25.6% 44.6%

992e1122

PmToll

ABC73693.1

23.6% 43.1%

985e1122

MiToll

ADV16386.1

25.6% 43.8%

975e1111

FcToll

Crassostrea gigas Toll (CgToll) Chlamys farreri Toll (CfToll) Euprymna scolopes Toll (EsToll)

23.6% 39.1%

Mollusca

Merostomata

Accession number

LvToll3

Representative TLR

LvToll2

Species

25% 44.6%

Table 2 The TLR protein sequences used for phylogenetic analysis. TIR domain

153

SpTLR1.1

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

154

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

Fig. 4. Multiple alignment of TIR amino acid sequences. Gray boxes in both AjTLR3 and AjToll indicate the three conserved regions in IL-1 receptor family. Tyrosines shaded by light gray in HsTLR3 and GgTLR3 are the crucial Tyr756, Tyr759, Tyr764 and Tyr858 for the signaling pathway. While the dark gray ones represent the phosphorylation of Tyrosine sites in AjTLR3 and AjToll. Abbreviations can be seen in Table 2.

In control group (PBS injection), the expression levels of AjTLRs showed no significant difference during five sampling times by comparing with each other (0.9e1.3, P > 0.05). It is apparent that these two genes were significantly induced in response to PGN, LPS, Zymosan A and PolyI:C respectively. 4. Discussion In this paper, two different TLR genes named AjTLR3 and AjToll were simultaneously identified from A. japonicus of Holothuroidea which possesses valuable potential features for developmental and evolutionary researches [43]. As one of the most important members in mammals TLR family, TLR3 functions distinctively to recognize dsRNA [44,45]. Orthologs of mammalian TLR3 have been reported among teleost fish [46e53]. The expression changes of TLR3s have been detected after various pathogens injections including Gram-negative bacteria [49,51,54e57] and viruses [49e 53,58]. However, no significant difference was detected in adult zebrafish after infection with Gram-positive Mycobacterium marinum [46]. These results will contribute to confirming the main functions that TLR3 in teleost is responsible for defense against Gram-negative bacterial and viral infections. The function research that D. melanogaster Toll controlling immune defense in adult fruitflies has made a huge progress since its original effect on dorsoventral axis formation in embryos was found [59]. Besides profound exploration to the immune response against bacterial and fungal pathogens, its antiviral mechanism was also studied [60,61]. Toll pathway could suppress the replication of Drosophila X virus (DXV), whose genome is dsRNA [61]. Tolls were also confirmed to be involved in the innate immune response among marine invertebrates, especially crustaceans and mollusks such as white shrimp [62], Chinese shrimp [63], kuruma shrimp [64], giant tiger shrimp [65], oyster [66], Zhikong scallop [67,68] and squids [69]. The expressions of Tolls could be induced by Gram-negative bacteria (Vibrio alginolyticus [62], Vibrio anguillarum [63,66], Listonella anguillara [68], Vibrio fischeri [69]), LPS [67,68], PGN [64] and white spot syndrome virus (WSSV) [62,65]. The above research results indicated that TLR3 and Toll genes are all involved in the immune responses to Gram-negative bacteria and dsRNA viruses, and this suggests that the structures of AjTLR3 and AjToll should have some similar domains. The deduced

Fig. 5. Phylogenetic tree of AjTLR3 and AjToll. The deduced amino acid sequences of AjTLRs were aligned with other known TLRs by the ClustalW program and the tree was constructed using MEGA 4.0 software with the neighbor-joining method. The bootstrap sampling was performed with 1000 replicates. Abbreviations and the accession numbers of TLR sequences are listed in Table 2.

structure of AjTLR3 is a typical V-TLR, consisting of 1 LRRNT, 16 LRRs and 1 LRRCT motifs in the ectodomain and 1 TIR domain in the cytoplasmic region. The distribution of LRRs in AjToll was similar with Crassostrea gigas Toll, where one LRRNT was predicted to be located in the ectodomain without LRRCT [66]. In all TLRs and D. melanogaster Toll, LRRCT was more conserved than LRRNT [70,71]. At the same time, Schneider et al. have found that LRRCT plays a crucial role in D. melanogaster Toll signal pathway [71]. So it is worthy to explore the importance of the LRRCT in AjTLRs. The insertions at positions 10 and 15 of the LRR consensus sequence were related to the discrimination of PAMPs in human LRRs [39] and were highly conserved between human and teleost fish [72]. In marine invertebrates, there was no insertion at LRRs of AjTLRs, C. gigas Toll [66] and Chlamys farreri Toll [67]. But insertions were

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

Fig. 6. Relative expression of AjTLR3 (A) and AjToll (B) in different tissues. Expression levels in all tissues are presented relative to that in coelomocytes (1). Each symbol and vertical bar represents the mean  SE (n ¼ 5). The tissues are as the following from left to right: BW, body wall; C, coelomocytes; F, tube feet; I, intestine; RT, respiratory tree.

found at LRRs of Litopenaeus vannamei Toll [73] and Fenneropenaeus chinensis Toll [63]. In addition, eight potential N-glycosylation sites were predicted in ECDs of AjTLRs which were also related to ligand recognition [74]. The similar structures of the ECDs in AjTLRs may be related to the PAMPs that both of them could recognize. The mammalian TLR3, expressed in the endosome, must cooperate with the cell surface molecular CD14 to mediate the endocytosis [75]. Similarly, D. melanogaster Toll could not directly recognize the PAMPs unless mediated by Späetzle [76]. Herewith, to understand whether other molecules involved in the ligands recognition of AjTLR3 and AjToll, further studies are required to identify the subcellular localizations coupled with detailed interactions between AjTLRs and ligands. Multiple alignments were conducted on the LRRs and the TIR domains in AjTLRs, respectively. The results revealed that LRRs of AjTLRs contain the HCS: LxxLxLxxNxL. As the conserved domain for the ligands binding and signal transduction, the TIR of AjTLR3 showed the highest identity with that of B. belcheri tsingtauense TLR1 (bbtTLR1) which was homologous to vertebrate TLR3s. The novel TLR system has been exploited in B. belcheri tsingtauense, where bbtTLR1 had a highly conserved TIR domain versus intense diversified LRR regions [77]. The TIR of AjToll shared the highest identity with A. mellifera TIR, followed by T. castaneum TIR, which are protostome TIRs. The lower sequence identity between AjTLR3 and AjToll indicated that they might utilize specific TIR-containing adapter proteins to initiate signal transduction pathways. The critical amino acid residues Tyr756, Tyr759, Tyr764 and Tyr858 in TIR domain of human TLR3 were not found in the AjTLRs. Phosphorylation of these residues is essential for dsRNA-mediated

155

downstream signaling pathway [41]. Whereas the predicted phosphorylation of Tyrosine sites in AjTLR3 and AjToll was Y849 and Y872, Y909, Y915, Y929 respectively. Structures analysis indicated that the three boxes in IL-1 receptor family which are related to signal transduction were more conserved in AjToll than in AjTLR3. It is conceivable that the downstream signaling pathways between AjTLR3 and AjToll may be different. Evolution analysis revealed that AjTLR3 and AjToll fell in two different groups, one of them represents the V-TLRs and the other one is P-TLRs. In S. purpuratus, in addition to the main V-TLRs, TLRs with the characteristics of most P-TLRs were also identified. A similar situation was also found in cephalochordate amphioxus (Branchiostoma floridae) whose TLR system was consisted of an expanded V-TLR family (at least 36 TLRs) and 12 P-TLRs [78]. Because cephalochordates and echinoderms represent the oldest extant lineages for the chordate phylum and deuterostome superphylum respectively, these discoveries suggest that the ancestors of vertebrates may have a much more complex and powerful TLR system. The coexistence of P-TLRs and V-TLRs indicated that P-TLRs were presented in the common bilaterian ancestor and subsequently lost during the evolution of the vertebrate [16]. One more important conclusion was that echinoderm TLRs could serve as the original model of the vertebrate TLRs. Another reliable method assessing the functional conservation of AjTLR3 and AjToll is expression analysis. Four special immune challenges were applied to test the potential functions performed by AjTLRs. LPS, the cell wall component of Gram-negative bacteria, is the widely used immune stimulant. The synthetic analog of dsRNA PolyI:C mimics can be treated as a potent immunoregulatory agent for viral infection. Peptidoglycan, the cell wall component of Gram-positive bacteria, can be recognized by the immune system. Zymosan A is a nonbacterial, nonendotoxic agent that is derived from the cell wall of yeast. In response to these four PAMPs challenges, AjTLR3 and AjToll showed different expression patterns in different tissues. In echinoderms, the essential immune effector cells are the coelomocytes. Previously publications showed that sea cucumber coelomocytes responded differentially to LPS, Gram-positive bacteria and dsRNA [79]. Likewise, in this study, the AjTLR3 and AjToll expression profiles in coelomocytes proved that they all participated in the immune responses to PGN, LPS and PolyI:C with specific patterns. Respiratory tree serves as a peculiar structure to holothuroids. Its studies of regeneration and ultrastructural morphological observations have been conducted in A. japonicus [80], while its immune defense functions were less reported before. In this study, AjTLR3 and AjToll, the immune related genes, were predominantly expressed in respiratory tree of healthy sea cucumbers. After Zymosan A challenge, AjToll in respiratory tree was extremely significantly up-regulated about 66 fold which were considerably higher than that in other tissues. On the other hand, the expressions of AjToll were more prominent than AjTLR3 after each infection in respiratory tree. It is possible that AjToll in respiratory tree might be more sensitive to pathogens infections than AjTLR3. Being a multifunctional organ, tube feet functions as movement, adsorption, respiration and sensation. In particularly, it is an indispensable part in respiratory system which directly contacts with pathogens. Except PGN challenge, the two AjTLRs genes were all strongly up-regulated by other three immune challenges in tube feet. This specific patterns implied that AjTLR3 and AjToll could effectively perform immune responses to LPS, Zymosan A and PolyI:C respectively in tube feet organ which plays an important role in A. japonicus immune defense system. The intestine in sea cucumber plays an active role in the immune response as a barrier against pathogens that might be

Fig. 7. Fold induction of AjTLR3 and AjToll genes challenged by PGN, LPS, Zymosan A and PolyI:C (AeD) in five tissues. Relative expressions of AjTLRs were expressed as fold changes over control samples taken at the same time interval as normalized to change in expression in the Cytb control. The bars indicate mean expression of 3 tested pools (5 individuals each)  SE. Asterisks represent a significant difference at the level of P < 0.05 relative to appropriate control.

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

present or harbored within its luminal cavity. Prominently upregulation of AjToll in intestine was observed after Zymosan A challenge which might represent an important pathogen infecting the digestive tract. Taken together, AjTLRs possess broad-recognition capability in the immune responses to the challenges of PGN, LPS, Zymosan A and PolyI:C which represent the Gram-positive bacteria, Gramnegative bacteria, fungi and dsRNA viruses. After PGN challenge, AjTLR3 and AjToll expression levels were strongly induced in coelomocytes compared to other tissues. After LPS and PolyI:C challenges, AjTLRs expression levels were extremely significantly upregulated in tube feet. After Zymosan A challenge, these two genes were highly expressed in respiratory tree, while this phenomenon was not seen in respiratory tree under other three challenges. The above results suggested that AjTLR3 and AjToll expressed in different tissues were sensitive to a given pathogen. In most cases, the expression patterns of AjTLR3 and AjToll were highly similar even though the fold changes were different. Now the challenging questions we have to face are clarifying the recognition mechanisms that genes involved in response to different pathogens. Extensive biochemical and molecular biology investigations are required to explain them. Herewith, further studies in our lab are aimed at identifying and analyzing more TLR family members and TLR signal pathway molecules to clarify their evolutionary relationships and functions in innate immune responses. Acknowledgments This work was supported by grants from National Nature Science Foundation of China (30972272), State 863 HighTechnology R & D Project of China (2012AA10A412) and Science & Technology Project of Liaoning Province (2011203005). References [1] Janeway Jr CA. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harbor Symp Quant Biol 1989;54:1e13. [2] Takeda K, Akira S. Toll-like receptors in innate immunity. Int Immunol 2005; 17:1e14. [3] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783e801. [4] Kawai T, Akira S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 2010;11:373e84. [5] Akira S, Takeda K. Toll-like receptor signalling. Nat Rev Immunol 2004;4:499e 511. [6] Rock FL, Hardiman G, Timans JC, Kastelein RA, Bazan JF. A family of human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A 1998;95:588e93. [7] Morisalo D, Anderson KV. Signaling pathways that establish the dorsale ventral pattern of the Drosophila embryo. Annu Rev Genet 1995;29:371e99. [8] Hashimoto C, Hudson KL, Anderson KV. The toll gene of Drosophila, required for dorsaleventral embryonic polarity, appears to encode a transmembrane protein. Cell 1988;52:269e79. [9] Qiu P, Pan PC, Govind S. A role for the Drosophila Toll/cactus pathway in larval hematopoiesis. Development 1998;125:1909e20. [10] Ferrandon D, Imler JL, Hetru C, Hoffmann JA. The Drosophila systemic immune response: sensing and signalling during bacterial and fungal infections. Nat Rev Immunol 2007;7:862e74. [11] Medzhitov R, Preston-Hurlburt P, Janeway Jr CA. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997; 388:394e7. [12] Zhang D, Zhang G, Hayden MS, Greenblatt MB, Bussey C, Flavell RA, et al. A Toll-like receptor that prevents infection by uropathogenic bacteria. Science 2004;303:1522e6. [13] Coscia MR, Giacomelli S, Oreste U. Toll-like receptors: an overview from invertebrates to vertebrates. Invertebr Surv J 2011;8:210e26. [14] Wu BJ, Huan TX, Gong J, Zhou P, Bai ZL. Domain combination of the vertebrate-like TLR gene family: implications for their origin and evolution. J Genet 2011;90:401e8. [15] Hibino T, Loza-Coll M, Messier C, Majeske AJ, Cohen AH, Terwilliger DP, et al. The immune gene repertoire encoded in the purple sea urchin genome. Dev Biol 2006;300:349e65. [16] Rast JP, Smith LC, Loza-Coll M, Hibino T, Litman GW. Genomic insights into the immune system of the sea urchin. Science 2006;314:952e6.

157

[17] Xu X, Doolittle RF. Presence of a vertebrate fibrinogen-like sequence in an echinoderm. Proc Natl Acad Sci U S A 1990;87:2097e101. [18] Eeckhaut I, Parmentier E, Becker P, Gomez da Silva S, Jangoux M. Parasites and biotic diseases in field and cultivated sea cucumbers. Adv Sea Cucumber Aquacul Manage 2004:311e25. [19] Deng H, Zhou ZC, Wang NB, Liu C. The syndrome of sea cucumber (Apostichopus japonicus) infected by virus and bacteria. Virolog Sin 2008;23:63e7. [20] Deng H, He CB, Zhou ZC, Liu C, Tan KF, Wang NB, et al. Isolation and pathogenicity of pathogens from skin ulceration disease and viscera ejection syndrome of the sea cucumber Apostichopus japonicus. Aquaculture 2009;287:18e27. [21] Wang PH, Chang YQ, Yu JH, Li C, Xu G. Acute peristome edema disease in juvenile and adult sea cucumbers Apostichopus japonicus (Selenka) reared in North China. J Invertebr Pathol 2007;96:11e7. [22] Ma YX, Xu GR, Chang YQ, Zhang EP, Zhou W, Song LS. Bacterial pathogens of skin ulceration disease in cultured sea cucumber Apostichopus japonicus (Selenka) juveniles. J Dalian Fish Univ 2006;21:13e8 [in Chinese]. [23] Li H, Qiao G, Li Q, Zhou W, Won KM, Xu DH, et al. Biological characteristics and pathogenicity of a highly pathogenic Shewanella marisflavi infected sea cucumber (Apostichopus japonicus). J Fish Dis 2010;33:865e77. [24] Santiago P, Roig-Lopez JL, Santiago C, García-Arrarás JE. Serum amyloid A protein in an echinoderm: its primary structure and expression during intestinal regeneration in the sea cucumber Holothuria glaberrima. J Exp Zool 2000;288:335e44. [25] Santiago-Cardona PG, Berrios CA, Ramirez F, Garcia-Arraras JE. Lipopolysaccharides induce intestinal serum amyloid A expression in the sea cucumber Holothuria glaberrima. Dev Comp Immunol 2003;27:105e10. [26] Ramírez-Gómez F, Ortíz-Pineda PA, Rojas-Cartagena C, Suárez-Castillo EC, García-Ararrás JE. Immune-related genes associated with intestinal tissue in the sea cucumber Holothuria glaberrima. Immunogenetics 2008;60:57e71. [27] Yang AF, Zhou ZC, He CB, Hu JJ, Chen Z, Gao XG, et al. Analysis of expressed sequence tags from body wall, intestine and respiratory tree of sea cucumber (Apostichopus japonicus). Aquaculture 2009;296:193e9. [28] Yang AF, Zhou ZC, Dong Y, Jiang B, Wang XY, Chen Z, et al. Expression of immune-related genes in embryos and larvae of sea cucumber Apostichopus japonicus. Fish Shellfish Immunol 2010;29:839e45. [29] Zhou ZC, Sun DP, Yang AF, Dong Y, Chen Z, Wang XY, et al. Molecular characterization and expression analysis of a complement component 3 in the sea cucumber (Apostichopus japonicus). Fish Shellfish Immunol 2011;31:540e7. [30] Sun LN, Chen MY, Yang HS, Wang TM, Liu BZ, Shu C, et al. Large scale gene expression profiling during intestine and body wall regeneration in the sea cucumber Apostichopus japonicus. Comp Biochem Physiol 2011;6:195e205. [31] Du HX, Bao ZM, Hou R, Wang S, Su HL, Yan JJ, et al. Transcriptome sequencing and characterization for the sea cucumber Apostichopus japonicus (Selenka, 1867). PLoS ONE 2012;7:e33311. [32] Blom N, Sicheritz-Pontén T, Gupta R, Gammeltoft S, Brunak S. Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics 2004;4:1633e49. [33] Blom N, Gammeltoft S, Brunak S. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 1999;294:1351e62. [34] Letunic I, Doerks T, Bork P. SMART 6: recent updates and new developments. Nucleic Acids Res 2009;37:229e32. [35] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [36] Yang AF, Zhou ZC, Dong Y, Jiang B, Wang XY, Chen Z, et al. Stability comparison of cytb and b-actin gene expression in sea cucumber Apostichopus japonicus. J Agric Sci Technol 2010;12:79e84 [in Chinese]. [37] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST(c)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30. [38] Clark AR, Dean JLE, Saklatvala J. Post-transcriptional regulation of gene expression by mitogen-activated protein kinase p38. FEBS Lett 2003;546:37e44. [39] Bell JK, Mullen GE, Leifer CA, Mazzoni A, Davies DR, Segal DM. Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends Immunol 2003;24:528e33. [40] Matsushima N, Tanaka T, Enkhbayar P, Mikami T, Taga M, Yamada K, et al. Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate toll-like receptors. BMC Genom 2007;8:124. [41] Sarkar SN, Smith HL, Rowe TM, Sen GC. Double-stranded RNA signaling by Toll-like receptor 3 requires specific tyrosine residues in its cytoplasmic domain. J Biol Chem 2003;278:4393e6. [42] Slack JL, Schooley K, Bonnert TP, Mitcham JL, Qwarnstrom EE, Sims JE, et al. Identification of two major sites in the type I Interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways. J Biol Chem 2000;275:4670e8. [43] Kerr AM, Kim J. Bi-penta-bi-decaradial symmetry: a review of evolutionary and developmental trends in holothuroidea (echinodermata). J Exp Zool 1999; 285:93e103. [44] Jacobs BL, Langland JO. When two strands are better than one: the mediators and modulators of the cellular responses to double-stranded RNA. Virology 1996;219:339e49. [45] Sen GC, Sarkar SN. Transcriptional signaling by double-stranded RNA: role of TLR3. Cytokine Growth Factor Rev 2005;16:1e14. [46] Meijer AH, Krens SFG, Rodriguez IAM, He S, Bitter W, Snaar-Jagalska BE, et al. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Mol Immunol 2004;40:773e83.

158

H. Sun et al. / Fish & Shellfish Immunology 34 (2013) 147e158

[47] Bilodeau AL, Waldbieser GC. Activation of TLR3 and TLR5 in channel catfish exposed to virulent Edwardsiella ictaluri. Dev Comp Immunol 2005;29:713e21. [48] Oshiumi H, Tsujita T, Shida K, Matsumoto M, Ikeo K, Seya T. Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics 2003;54:791e800. [49] Rodriguez MF, Wiens GD, Purcell MK, Palti Y. Characterization of Toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2005;57:510e9. [50] Su JG, Jang SH, Yang CR, Wang YP, Zhu ZY. Genomic organization and expression analysis of Toll-like receptor 3 in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol 2009;27:433e9. [51] Yang CR, Su JG. Molecular identification and expression analysis of Toll-like receptor 3 in common carp Cyprinus carpio. J Fish Biol 2010;76:1926e39. [52] Huang XN, Wang ZY, Yao CL. Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2011;31: 98e106. [53] Hwang SD, Ohtani M, Hikima J, Jung TS, Kondo H, Hirono Ikuo, et al. Molecular cloning and characterization of Toll-like receptor 3 in Japanese flounder, Paralichthys olivaceus. Dev Comp Immunol 2011;37:87e96. [54] Phelan PE, Mellon MT, Kim CH. Functional characterization of full-length TLR3, IRAK-4, and TRAF6 in zebrafish (Danio rerio). Mol Immunol 2005;42: 1057e71. [55] Kadowaki N, Ho S, Antonenko S, Malefyt RW, Kastelein RA, Bazan F, et al. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med 2001;194:863e70. [56] Bilodeau AL, Peterson BC, Bosworth BG. Response of toll-like receptors, lysozyme, and IGF-I in back-cross hybrid (F1 male (blue  channel)  female channel) catfish challenged with virulent Edwardsiella ictaluri. Fish Shellfish Immunol 2006;20:29e39. [57] Baoprasertkul P, Peatman E, Somridhivej B, Liu Z. Toll-like receptor 3 and TICAM genes in catfish: species-specific expression profiles following infection with Edwardsiella ictaluri. Immunogenetics 2006;58:817e30. [58] Su JG, Zhu ZY, Wang YP, Zou J, Hu W. Toll-like receptor 3 regulates Mx expression in rare minnow Gobiocypris rarus after viral infection. Immunogenetics 2008;60:195e205. [59] Anderson KV. Toll signaling pathways in the innate immune response. Curr Opin Immunol 2000;12:13e9. [60] Zambon RA, Nandakumar M, Vakharia VN, Wu LP. The Toll pathway is important for an antiviral response in Drosophila. Proc Natl Acad Sci U S A 2005;102:7257e62. [61] Zambon RA, Vakharia VN, Wu LP. RNAi is an antiviral immune response against a dsRNA virus in Drosophila melanogaster. Cell Microbiol 2006;8:880e9. [62] Wang PH, Liang JP, Gu ZH, Wan DH, Weng SP, Yu XQ, et al. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spätzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei. Dev Comp Immunol 2012;36:359e71. [63] Yang CJ, Zhang JQ, Li FH, Ma HM, Zhang QL, Jose Priya TA, et al. A Toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection. Fish Shellfish Immunol 2008;24:564e74.

[64] Mekata T, Kono T, Yoshida T, Sakai M, Itami T. Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicus. Fish Shellfish Immunol 2008;24:122e33. [65] Arts J, Cornelissen F, Cijsouw T, Hermsen T, Savelkoul H, Stet R. Molecular cloning and expression of a Toll receptor in the giant tiger shrimp, Penaeus monodon. Fish Shellfish Immunol 2007;23:504e13. [66] Zhang LL, Li L, Zhang GF. A Crassostrea gigas Toll-like receptor and comparative analysis of TLR pathway in invertebrates. Fish Shellfish Immunol 2011;30: 653e60. [67] Qiu LM, Song LS, Xu W, Ni DJ, Yu YD. Molecular cloning and expression of a Toll receptor gene homologue from Zhikong Scallop, Chlamys farreri. Fish Shellfish Immunol 2007;22:451e66. [68] Wang MQ, Yang JL, Zhou Z, Qiu LM, Wang LL, Zhang H, et al. A primitive Tolllike receptor signaling pathway in mollusk Zhikong scallop Chlamys farreri. Dev Comp Immunol 2011;35:511e20. [69] Goodson M, Kojadinovic M, Troll J, Scheetz T, Casavant T, Soares M, et al. Identifying components of the NF-kB pathway in the beneficial Euprymna scolopeseVibrio fischeri light organ symbiosis. Appl Environ Microbiol 2005; 71:6934e46. [70] Kobe B, Deisenhofer J. The leucine-rich repeat: a versatile binding motif. Trends Biochem Sci 1994;19:415e21. [71] Schneider DS, Hudson KL, Lin TY, Anderson KV. Dominant and recessive mutations define functional domains of Toll, a transmembrane protein required for dorsaleventral polarity in the Drosophila embryo. Genes Dev 1991;5:797e807. [72] Hwang SD, Asahi T, Kondo H, Hirono I, Aoki T. Molecular cloning and expression study on Toll-like receptor 5 paralogs in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol 2010;29:630e8. [73] Yang LS, Yin ZX, Liao JX, Huang XD, Guo CJ, Weng SP, et al. A Toll receptor in shrimp. Mol Immunol 2007;44:1999e2008. [74] Weber AN, Morse MA, Gay NJ. Four N-linked glycosylation sites in human tolllike receptor 2 cooperate to direct efficient biosynthesis and secretion. J Biol Chem 2004;279:34589e94. [75] Lee HK, Dunzendorfer S, Soldau K, Tobias PS. Double-stranded RNA-mediated TLR3 activation is enhanced by CD14. Immunity 2006;24:153e63. [76] Hoffmann JA. The immune response of Drosophila. Nature 2003;426:33e8. [77] Yuan SC, Huang SF, Zhang W, Wu T, Dong ML, Yu YH, et al. An amphioxus TLR with dynamic embryonic expression pattern responses to pathogens and activates NF-kB pathway via MyD88. Mol Immunol 2009;46:2348e56. [78] Huang SF, Yuan SC, Guo L, Yu YH, Li J, Wu T, et al. Genomic analysis of the immune gene repertoire of amphioxus reveals extraordinary innate complexity and diversity. Genome Res 2008;18:1112e26. [79] Ramírez-Gómez F, Aponte-Rivera F, Méndez-Castaner L, García-Arrarás JE. Changes in holothurian coelomocyte populations following immune stimulation with different molecular patterns. Fish Shellfish Immunol 2010;29: 175e85. [80] Dolmatov IY, Ginanova TT. Post-autotomy regeneration of respiratory trees in the holothurian Apostichopus japonicus (Holothuroidea, Aspidochirotida). Cell Tissue Res 2009;336:41e58.