- Email: [email protected]
Molecular cloning, characterization and expression of a C-type lectin cDNA in Chinese mitten crab, Eriocheir sinensis
Fish & Shellfish Immunology 31 (2011) 358e363
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Molecular cloning, characterization and expression of a C-type lectin cDNA in Chinese mitten crab, Eriocheir sinensis Hao Zhang a, Liqiao Chen a, *, Jianguang Qin b, Daxian Zhao a, Ping Wu a, Chuanjie Qin a, Na Yu a, Erchao Li a a b
School of Life Science, East China Normal University, Shanghai 200062, China School of Biological Sciences, Flinders University, Adelaide, SA 5001, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 February 2011 Received in revised form 1 June 2011 Accepted 1 June 2011 Available online 12 June 2011
C-type lectins are pattern-recognition proteins which are functionally important for pathogen recognition and immune regulation in vertebrates and invertebrates. In this study, a lectin cDNA named as EsLectin was cloned and characterized from the Chinese mitten crab, Eriocheir sinensis. The full-length sequence of this Es-Lectin cDNA was 651 bp, including an open reading frame of 483 bp encoding 160 amino acids. The predicted molecular weight of the Es-Lectin was 11.8 kDa. A typical signal peptide of 21 amino acids was deduced at the N-terminus of the predicted protein. This Es-Lectin belongs to a C-type lectin and contains six cysteines, a conserved EPN motif (Glu-Pro-Asn) and an imperfect WND (Trp-AsnAsp) motif (FND, Phe-Asn-Asp). This Es-Lectin had 55% and 32% identity with other two C-type lectins in E. sinensis, and 29e36% homology with decapods. Although the Es-Lectin was also expressed in gill, hepatopancreas, intestine, muscle and stomach, its expression in haemocytes was the greatest. The expression of Es-Lectins in haemocytes increased at 1.5 h after the Aeromonas hydrophila challenge. After a slight decrease, the Es-Lectin expression in haemocytes significantly increased at 48 h post-challenge. The diverse distribution of Es-Lectin and its enhancement by bacterial challenge indicate that C-type lectins are important in the innate immune response to bacterial infection, and can be activated for innate immune response in crab at the initial stage after pathogen infection. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Chinese mitten crab Eriocheir sinensis C-type lectin Gene expression Aeromonas hydrophila
1. Introduction Most invertebrates lack acquired immunity since these animals have no immunoglobulins, or memory following the first challenge of a pathogen [1]. Therefore, the innate immune system plays a major role in defending antipathogens [2]. The mechanism to defend the invading microorganisms is to recognize the characteristic of carbohydrate structures of a pathogen and to effectively discriminate pathogens [3]. During this recognition process, the innate recognition is mediated by a special protein known as pattern-recognition receptors (PRRs) [4]. Proteins containing a Ctype lectin-like domain are among the groups of PRRs in vertebrates to regulate the entire immune system [5e7]. The C-type lectins are a large group of extracellular metazoan proteins and have a function to recognize oligosaccharides in cell surfaces [1]. These lectins contain a Ca2þ-dependent carbohydrate recognition domain (CRD) with two or three pairs of disulfide bonds to bind the carbohydrate residues of foreign pathogens
* Corresponding author. Fax: þ86 021 62233637. E-mail address: [email protected] (L. Chen). 1050-4648/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2011.06.001
[3,8,9]. The classification of the C-type lectin family is based on the architecture of the C-type lectin domain-containing proteins [10]. For example, the bovine conglutinin which was the first lectin discovered from animals is a member of the C-type lectin family [11]. In vertebrates, the C-type lectin is currently classified into 17 groups [3]. However, in invertebrates, little information is available for the classification of the C-type lectin family at gene and protein levels, though several reports on C-type lectins in invertebrates have been published [12e14]. Current literature suggests that the member of the C-type lectin domain in invertebrates is more abundant and diverse than that in vertebrates [3,15]. In crustaceans, many C-type lectins have been identified [9,16,17], and most of these lectins display anti-virus and anti-bacteria activities [18e20]. In Fenneropenaeus merguiensis, a Ca2þ-dependent lectin in hemolymph contributes to the defense response to potential pathogenic bacteria [21]. A natural lectin from the serum of the shrimp Litopenaeus vannamei plays a significant role in host immune response against bacterial infections [22]. In Penaeus japonicus, an N-acetylglucosamine (GlcNAc) specific lectin isolated from serum has an opsonic activity against bacterial infection [23]. Based on cDNA sequence, more structural information is available in decapods. Two C-type lectin-like domain (CTLD)-containing proteins
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
were identified in Eriocheir sinensis and showed different roles in innate immune response to bacterial infection [24]. In Portunus trituberculatus, a CTLD-containing protein with one CRD was isolated and designated as PtLP [9]. A C-type lectin known as PmLec with one CRD was purified from the serum of Penaeus monodon. The PmLec is specific for bacterial lipopolysaccharide and serves a patternrecognition protein and opsonin [25]. In L. vannamei, two putative CRDs were found in a C-type lectin (named LvLT) against virus infection [19]. The dual-CRD structure also exists in the C-type lectin in P. monodon (named PmLT), and its expression in haemocytes suggests a possible function as a pattern-recognition protein to defend viral and bacterial pathogens [26]. Chinese mitten crab, E. sinensis, is an important freshwater crustacean for aquaculture and has brought significant revenue to rural economy. In the past few years, attempts have been made to understand the immunological mechanism in the Chinese mitten crab because various diseases caused by bacteria, viruses and Rickettsia-like organisms have threatened the sustainability for Chinese mitten crab farming [24,27e29]. In this study, we aimed to identify the C-type lectin cDNA from E. sinensis and characterize its expression patterns in various tissues following an Aeromonas hydrophila challenge on this crab. The characterization and molecular expression of the C-type lectins from E. sinensis will provide an insight into the understanding of pathogen recognition responses in crustacean and will be useful to develop techniques to control disease outbreak in aquaculture. 2. Materials and methods 2.1. Animals Adult Chinese mitten crabs E. sinensis were obtained from a fishing ground in Shanghai and acclimatized in the laboratory for 2 weeks before carrying out the experiment. The crabs weighing 150e200 g were used for the bacterial challenge test. Haemocytes were collected in an equal volume of anticoagulant solution (NaCl 510 mM; Glucose 115 mM; Na-citrate 30 mM; EDTANa2 mM; pH 7.55) and immediately centrifuged at 800 rpm for 10 min at 4 C. After haemocytes had been sampled, other crab tissues (gill, hepatopancreas, intestine, muscle and stomach) were also collected and immediately preserved in liquid nitrogen for RNA extraction. 2.2. Preparation of bacteria The Gram-negative bacterium A. hydrophila obtained from Guangzhou Microbiology Research Institute was chosen to challenge the crab because it was the pathogenic bacterium causing aeromonosis or haemorrhagic septicemia in crab and other aquatic animals [30]. The experimental bacteria were grown in the LuriaeBertani nutrient agar, and then diluted with sterile 0.85% NaCl to reach the density of 7.2 108 CFU/ml using by plate counts [30e33]. 2.3. RNA isolation Total RNA was extracted from the haemocytes and other tissues using the Unizol Reagent kit (Biostar, Shanghai, China) according to the manufacturer’s instructions. The concentration of the total RNA was quantified using spectrophotometry at a wavelength of 260 nm. 2.4. The full-length cDNA cloning Based on the ESTs sequence in the haemocyte cDNA library of E. sinensis [34], the special primers were designed for the gene clone (Table 1).
359
The full-length cDNA sequence of the lectin gene was obtained by using the SMARTÔ RACE cDNA amplification kit (Clonetech, USA). For 50 -RACE, the primers of LEC 5-R and the universal primer A mix (UPM) were used in a PCR reaction (1 circle of 94 C for 4 min; 30 circles of 94 C for 30 s, 66 C for 30 s and 72 C for 3 min; 1 circle of 72 C for 7 min). A touchdown PCR was used for 30 -RACE with the primers of LEC3-F and the abridged universal amplification primer (AUAP). The PCR reaction conditions were followed the manufacturer of AdvantageÔ 2 PAC kit (Clonetech, USA). The expected PCR products were eluted from the agarose gel and ligated to the pGEMT easy vector (Promega, USA). The ligation product was transformed to Escherichia coli. Clones were sequenced with universal primers T7 and SP6. After splicing the two fragments, the fulllength cDNA sequence was validated using the primers UPM and LEC AS. All the primers used in this study are shown in Table 1. 2.5. Phylogenetic analysis The lectin amino acid sequences from various species were downloaded from NCBI. A phylogenetic tree was constructed using the neighbour-joining method in the Molecular Evolutionary Genetics Analysis (MEGA 4) package [35]. The conserved domains CRD were searched with SMART program (http://smart.embl-heidelberg.de/). 2.6. Es-Lectin expression The expressions of Es-Lectin mRNA in crab tissues were detected by quantitative real time PCR. Total RNA from haemocytes, hepatopancreas, muscles, gills, intestine, and stomach was separately extracted. Before reverse transcription, the RNA samples were treated with DNAase (Promega, USA). The first strand cDNA was synthesized using a cDNA first strand synthesis kit with superscriptÔ III RNAse H-reverse transcriptase (Invitrogen, USA) using 5 mg total RNA. According to the cDNA full-length sequence, a pair of gene-specific primers (LEC S-RT and LEC AS-RT) was designed to amplify the 279 bp fragment, and the primers b-actin F and b-actin R were used to amplify the 266 bp fragments as the internal standard gene control. The SYBR Green quantitative real time PCR assay was conducted to determine the Es-Lectin mRNA expression in an iQÔ 5 Multicolor Real Time PCR Detection System. The PCR temperature profile and PCR reaction conditions were followed the manufacturer of SYBR Premix Ex Taq (TaKaRa, Dalian, China), and the PCR product was sequenced to verify the specificity of quantitative real time PCR. The expression level of Es-Lectin was calculated by 2DDCT [36], and the expression in haemocytes was used as the calibrator. Comparisons were made in different tissues using the analysis of variance (SPSS 14.0 package, SPSS Inc., New York, USA). 2.7. Infection response In the bacterial challenge group, 100 ml A. hydrophila (7.2 108 CFU/ml) was injected into the arthrodial membrane of the Table 1 Primers used in this study for the analysis of the Es-Lectins in E. sinensis. Primer name
Primer sequence 50 30
UPM AUAP LEC5-R LEC3-F LEC AS LEC S-RT LEC AS-RT b-actin F b-actin R
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT GGCCACGCGTCGACTAGTAC CGACCTTGGGGCTTGGCAGAT GTGGGCGGCGGCTGCTTCTA AGGTGCTATAACAACAACTTCAAGG GGGCGGCGGCTGCTTCTA CCATCATTGTTGGGCTCGTT TAGGTGGTCTCGTGGATGCC GAGACCTTCAACACCCCCGC
360
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
last walking leg of each crab. Each crab in the control group was received an injection of 100 ml sterile 0.85% NaCl. The challenged crabs were returned to the freshwater tanks immediately after injection, and three individuals were randomly sampled at 0, 1.5, 3, 6, 12, 24 and 48 h post-injection from the challenged and control groups. Each crab was bled only once to avoid any interference of the gene expression. The expressions of Es-Lectin mRNA in the challenge and control crabs were also detected by quantitative real time PCR analysis. The values of cycle time (Ct) were compared and converted to differences by fold using the relative quantification method in the Relative Expression Software Tool 384 v.1 (REST), and normalized with b-actin [37]. In this software, pair wise fixed reallocation randomization test was used to compare the differences between the treatment and control groups. Differences were considered significant at P < 0.05.
EsCTLDcp-1, 32% with EsCTLDcp-2, and significant homology with the lectins of other decapods from 36 to 29% (e.g., 33% with C-type lectin of P. monodon, 31% with C-type lectin 1 of Fenneropenaeus chinensis, 35% with C-type lectin protein of F. chinensis, and 29% with C-type lectin-like domain-containing protein PtLP of P. trituberculatus). 3.2. The domain feature and phylogeny of Es-lectin in E. sinensis To evaluate the molecular evolution of Es-Lectin relative to lectins in other decapods, a phylogenetic tree was constructed by the neighbour-joining method (Fig. 2). The phylogenetic tree was constructed using the C-type lectin domain from lectin amino acid sequences of other decapods, and revealed that lectins could be divided into two related groups. The first group of lectins contained six cysteines, and the second group had four cysteines. The EsLectin was closely related to the EsCTLDcp-1.
3. Results 3.1. The full-length cDNA sequence of Es-lectin in E. sinensis The full sequence of Es-Lectin cDNA was 640 bp in length, consisting of an open reading frame (ORF) of 483 bp, a 50 untranslated region (UTR) of 20 bp, and a 30 UTR of 137 bp (including the poly A tail) with the polyadenylation signal ATTAAA. The ORF encoded a preprotein of 160 amino acids with a predicted molecular weight of 17.83 kDa and a pI of 6.98 (Fig. 1). The putative signal peptide was identified using SignalP (http://www.cbs.dtu. dk/services/SignalP) contained 20 amino acid residues. The Ctype lectin domains were predicted by the SMART program (http:// www.smart.embl-heidelberg.de/) and one C-lectin domain was found in the C- terminus. The full-length sequence has been submitted to the NCBI GenBank (GenBank ID: ADB10837). The deduced amino acid sequence comparisons were carried out using BLAST algorithm at the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm.nih.gov/blast.cgi). The alignments indicated that Es-Lectin showed 55% identity with
3.3. Es-Lectin expression in other tissues A predominant Es-Lectin transcript expression was observed in all tissues sampled. But the relative numbers of the transcripts were the highest in haemocytes. The expression level in haemocytes was almost 20 times it in hepatopancreas, and more than 100 times it in gill, muscle, stomach and intestine (Fig. 3). After the analysis of SPSS, the expression was significant in haemocytes (P < 0.05). 3.4. Expression of Es-Lectin after injection with A. hydrophila Quantitative real time PCR was used to determine the effect of bacterial challenge on Es-Lectin mRNA expression level in haemocytes after injecting live A. hydrophila from 1.5 to 48 h. Fig. 4 presents the fold change of Es-Lectin expression to the control as normalized with b-actin. The Es-Lectin expressions significantly increased at 1.5 h after injection (P < 0.05), then decreased at 3, 6, 12, and 24 h. The most significant change was at 48 h post-injection (P < 0.05),
Fig. 1. Multiple alignments of the deduced amino acid sequences of lectins from Eriocheir sinensis (Es-Lectin, GenBank ID:ADB10837; EsCTLDcp-1, GenBank ID:ADK66338; EsCTLDcp-2, GenBank ID:ADH43623), Marsupenaeus japonicus (LectinE, GenBank ID:ADG85658), Fenneropenaeus chinensis (CLectin1, GenBank ID:ABA54612) and Xenopus tropicalis (Lectin, GenBank ID:XP_002933953). The domain structure is indicated with arrows and lines spanning the appropriate length. The conserved amino acids are in black background and the EPN and FND motif were circled. The EsCTLDcp-1 has no signal peptide.
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
361
Fig. 2. Phylogenetic tree of known CRDs of Decapoda lectins. The GenBank accession numbers of genes involved are as below, Penaeus monodon a, b (GenBank ID:ABI97373); Fenneropenaeus merguiensis a, b (GenBank ID:ACR56805); Fenneropenaeus chinensis 5a, 5b(GenBank ID:ACJ06428); Penaeus semisulcatus a, b (GenBank ID:ABI97372); Litopenaeus vannamei a, b (GenBank ID:ABI97374); Eriocheir sinensis 2 (GenBank ID:ADH43623); Marsupenaeus japonicus E (GenBank ID:ADG85658); Litopenaeus vannamei (GenBank ID:ABU62825); Fenneropenaeus chinensis 1 (GenBank ID:ABA54612); Marsupenaeus japonicus A (GenBank ID:ADG85666); Marsupenaeus japonicus B (GenBank ID:ADG85668); Marsupenaeus japonicus C (GenBank ID:ADG85667.1); Marsupenaeus japonicus D (GenBank ID:ADG85659); Portunus trituberculatus (GenBank ID:ACC86854); Fenneropenaeus chinensis 3 (GenBank ID:ACJ06431); Eriocheir sinensis 1 (GenBank ID:ADK66338); Eriocheir sinensis (GenBank ID:ADB10837); Penaeus monodon (GenBank ID:AAZ29608); Fenneropenaeus chinensis a, b (GenBank ID:AAX63905); Portunus pelagicus (GenBank ID:ABM65756); Scylla paramamosain (GenBank ID:ADF27340); Fenneropenaeus chinensis 6 (GenBank ID:ACJ06430); Pacifastacus leniusculus (GenBank ID:AAX55747); Procambarus clarkia (GenBank ID:ACR20475), and Homo sapiens (GenBank ID:AAB17133).
and the expression increased 7.5 fold in bacterial-group as compared to the crab with saline injection. 4. Discussion Lectins are important in the innate immunity system against bacterial infections in aquatic animals, including fish [38,39] and crustaceans [19,40,41]. Two C-type lectin cDNAs have been reported in Eriocheir sinence for their roles in the innate immune response to bacterial infection [24]. In the present study, a new C-type lectin cDNA from E. sinensis haemocytes was characterized. The results confirmed the diversity of C-type lectins in crustaceans and provided critical information towards the understanding of the of lectin classification in invertebrates.
Alignment of amino acid sequences reveals that the C-type lectin domain is a relatively conservative structure, but also has various mutations in some motifs. The phylogenic tree of the C-type lectin domain of different lectin amino acid sequences in decopods was divided into two clusters based on the number of cysteines. The first lectin group, including Es-Lectin, contains six cysteines which are responsible for the formation of three disulfide bonds to form a complete CRD, while proteins in the second group only have four cysteines. Two binding sites consisting of a conserved EPN (Glu-Pro-Asn) and an imperfect WND (Trp-AsnAsp) motif (FND, Phe-Asn-Asp) existed in Es-Lectin. The EPN motif dictates specificity of mannose containing ligands [42]. The WND motif is a typical site for binding carbohydrates [3,43]. However, the WND motif in invertebrates is always mutated to
362
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
Fig. 3. Quantitative real time PCR analysis of Es-Lectin expression in various tissues. The ratio refers to the gene expression in different tissues to that in haemocytes, and b-actin gene was used as internal control.
a homologous motif, such as FRD (Phe-Arg-Asp), FND (Phe-AsnAsp) and VND (Val-Asn-Asp) [26]. In the lectins of P. monodon (GenBank ID:ABI97373), F. merguiensis (GenBank ID:ACR56805), Penaeus semisulcatus (GenBank ID:ABI97372) and L. vannamei (GenBank ID:ABI97374), a dual-CRD structure contains different binding motifs [19,26]. Together with other two lectins reported preciously [24], all three lectins of E. sinensis have one CRD and one EPN motif, suggesting that these three lectins have a mannose binding function. The Es-Lectin is similar to EsCTLDcp-1 because it shares the same FND motif and 55% identity. In contrast, the EsCTLDcp-2 contains the WVD modif (Trp-Val-Asp), and only shows 32% identity with Es-Lectin. Therefore, we suggest that Es-Lectin is possibly the homologues of EsCTLDcp-1. In invertebrates, hepatopancreas and haemocytes are the central locations to participate in pathogen recognition, phagocytosis, melanization and cytotoxicity to control and regulate the
innate immune system to avoid the deleterious effects from pathogen [44,45]. The circulating haemocytes play extremely important roles in the protection for infectious agents killing and the synthesis of antimicrobial molecules [46]. The results of Northern blotting and in situ hybridization suggest that Fclectin transcripts of F. chinensis are mainly expressed in haemocytes [40]. In this study, the Es-Lectin mRNA level in the Chinese mitten crab was expressed most abundantly in the haemocytes, which is similar to the transcripts of Fclectin in F. chinensis [40]. In contrast, Fc-hsL of F. chinensis, LvLT of L. vannamei and PmLT of P. monodon, EsCTLDcp-1 and EsCTLDcp-2 of E. sinensis, and PtLP of P. trituberculatus are all expressed exclusively in the hepatopancreas [9,19,24,40,41]. In this study, the newly found Es-Lectin in the Chinese mitten crab was stimulated at the initial stage after pathogen infection by showing an over 2-fold increase between 1.5 h and 48 h postchallenge. This result is consistent with the gene expressions of different C-type lectins in other crustacean species. In L. vannamei, the expression levels of LvLT decreased in the first 2 h and then increased to a much higher level at 4 h after the challenge with the white spot syndrome virus (WSSV) [19]. Also, the expression of a C-type lectin PmLT in P. monodon was similar to the expression of another C-type lectin LvLT in L. vannamei [26]. In contrast, the Fclectin expression in F. chinensis is up-regulated only after 24 h of the WSSV challenge [40]. In another study, the expression of a C-type lectin EsCTLDcp-1 in E. sinensis was also stimulated by A. hydrophila challenge with a significant increase at 2 h postchallenge, followed by two declines at 4 h and 8 h and two rises at 12 h and 24 h [24]. However, the expression of another C-type lectin EsCTLDcp-2 in E. sinensis showed a general declining trend over time from the starting point of A. hydrophila infection [24]. Therefore, our results and other studies seem to suggest the diverse nature of C-type lectins in responding to pathogen challenge in crustacean species. In conclusion, a new lectin gene was cloned from E. sinensis, and it was expressed highly in haemocytes of healthy E. sinensis. The upregulation expression of the Es-Lectin in haemocytes after A. hydrophila challenge indicates that its positive role in responding to bacterial challenge. However, further study is needed to understand the functions of lectin in immune defense system of E. sinensis. Acknowledgements This research was supported by grants from the Special Fund for Agro-scientific Research in the Public Interest (No. 201003020), Shanghai Committee of Science and Technology, China (08DZ1906401, 10JC1404100), National Natural Science Foundation of China (No. 30771670), The Specialized Research Fund for the Doctoral Program of Higher Education of China (No. 200802690012), the National Basic Research Program (973 Program, No. 2009CB118702), Shanghai Agriculture Science and Technology Key Grant (No.2-1, 2009), Shanghai technology system for Chinese mitten-handed crab industry, and partially by the E-Institute of Shanghai Municipal Education Commission (No. E03009). References
Fig. 4. The fold change of Es-Lectin gene expression in haemocytes after challenge of A. hydrophila to the control group at same time point (0, 1.5, 3, 6, 12, 24 and 48 h) as normalized with b-actin gene. Error bars indicate standard error and asterisks indicate statistical significance (P < 0.05).
[1] Marques MRF, Barracco MA. Lectins, as non-self-recognition factors, in crustaceans. Aquaculture 2000;191:23e44. [2] Hoffmann JA, Reichhart JM. Drosophila innate immunity: an evolutionary perspective. Nat Immunol 2002;3:121e6. [3] Zelensky AN, Gready JE. The C-type lectin-like domain superfamily. FEBS J 2005;272:6179e217. [4] Medzhitov R, Janeway CAJ. Decoding the patterns of self and nonself by the innate immune system. Science 2002;296:298e300. [5] Christophides GK, Vlachou D, Kafatos FC. Comparative and functional genomics of the innate immune system in the malaria vector Anopheles gambiae. Immunol Rev 2004;198:127e48.
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363 [6] Kumagai Y, Akira S. Identification and functions of pattern-recognition receptors. J Allergy Clin Immunol 2010;125:985e92. [7] Schulenburg H, Boehnisch C, Michiels NK. How do invertebrates generate a highly specific innate immune response? Mol Immunol 2007;44:3338e44. [8] Drickamer K. Two distinct classes of carbohydrate-recognition domains in animal lectins. J Biol Chem 1988;263:9557e60. [9] Kong HJ, Park EM, Nam BH, Kim YO, Kim WJ, Park HJ, et al. A C-type lectin likedomain (CTLD)-containing protein (PtLP) from the swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2008;25:311e4. [10] Drickamer K. Evolution of Ca2þ-dependent animal lectins. Prog Nucleic Acid Res Mol Biol 1993;45:207e32. [11] Kilpatrick DC. Animal lectins: a historical introduction and overview. Biochim Biophys Acta 2002;1572:187e97. [12] Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG. The genome sequence of Drosophila melanogaster. Science 2000;287:2185e95. [13] Schulenburg H, Hoeppner MP, Weiner 3rd J, Bornberg-Bauer E. Specificity of the innate immune system and diversity of C-type lectin domain (CTLD) proteins in the nematode Caenorhabditis elegans. Immunobiology 2008;213:237e50. [14] Wang XW, Xu WT, Zhang XW, Zhao XF, Yu XQ, Wang JX. A C-type lectin is involved in the innate immune response of Chinese white shrimp. Fish Shellfish Immunol 2009;27:556e62. [15] Dodd RB, Drickamer K. Lectin-like proteins in model organisms: implications for evolution of carbohydrate-binding activity. Glycobiology 2001;11:71Re9R. [16] Alpuche J, Pereyra A, Agundis C, Rosas C, Pascual C, Slomianny MC, et al. Purification and characterization of a lectin from the white shrimp Litopenaeus setiferus (Crustacea decapoda) hemolymph. Biochim Biophys Acta 2005; 1724:86e93. [17] Cominetti MR, Marques MR, Lorenzini DM, Lofgren SE, Daffre S, Barracco MA. Characterization and partial purification of a lectin from the hemolymph of the white shrimp Litopenaeus schmitti. Dev Comp Immunol 2002;26:715e21. [18] Luo T, Zhang X, Shao Z, Xu X. PmAV, a novel gene involved in virus resistance of shrimp Penaeus monodon. FEBS Lett 2003;551:53e7. [19] Ma TH, Tiu SH, He JG, Chan SM. Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection. Fish Shellfish Immunol 2007;23:430e7. [20] Zhao ZY, Yin ZX, Xu XP, Weng SP, Rao XY, Dai ZX, et al. A novel C-type lectin from the shrimp Litopenaeus vannamei possesses anti-white spot syndrome virus activity. J Virol 2009;83:347e56. [21] Rittidach W, Paijit N, Utarabhand P. Purification and characterization of a lectin from the banana shrimp Fenneropenaeus merguiensis hemolymph. Biochim Biophys Acta 2007;1770:106e14. [22] Sun J, Wang L, Wang B, Guo Z, Liu M, Jiang K, et al. Purification and characterisation of a natural lectin from the serum of the shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2007;23:292e9. [23] Kondo M, Matsuyamam H, Yano T. The opsonic effect of lectin on phagocytosis by hemocytes of Kuruma Prawn, Penaeus japonicus. Fish Pathol 1992;27: 217e22. [24] Guo HZ, Zou PF, Fu JP, Guo Z, Zhu BK, Nie P, et al. Characterization of two Ctype lectin-like domain (CTLD)-containing proteins from the cDNA library of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2010;30: 515e24. [25] Luo T, Yang H, Li F, Zhang X, Xu X. Purification, characterization and cDNA cloning of a novel lipopolissacharide-binding lectin from the shrimp Penaeus monodon. Dev Comp Immunol 2006;30:607e17. [26] Ma TH, Benzie JA, He JG, Chan SM. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J Invertebr Pathol 2008;99:332e41.
363
[27] Wang W, Gu Z. Rickettsia-like organism associated with tremor disease and mortality of the Chinese mitten crab Eriocheir sinensis. Dis Aquat Org 2002;48: 149e53. [28] Wang W, Zhu N, Gu Z, Du K, Xu Z. Study on the transmission of tremor disease (TD) in the Chinese mitten crab, Eriocheir sinensis (Crustacea: decapoda). J Invertebr Pathol 2002;81:202e4. [29] Xu HS, Shu MA, Zhan XA, Wang SX. Identification of Vibrio parahaemolyticus isolated from cultured Eriocheir sinensis and pathogenicity of its extracellular products. J Fish China 2002;26:357e62. [30] Zhao D, Chen L, Qin C, Zhang H, Wu P, Li E, et al. Molecular cloning and characterization of the lipopolysaccharide and beta-1, 3-glucan binding protein in Chinese mitten crab (Eriocheir sinensis). Comp Biochem Physiol B 2009;154:17e24. [31] Qin C, Chen L, Qin JG, Zhao D, Zhang H, Wu P, et al. Characterization of a serine proteinase homologous (SPH) in Chinese mitten crab Eriocheir sinensis. Dev Comp Immunol 2010;34:14e8. [32] Qin C, Chen L, Qin JG, Zhao D, Zhang H, Wu P, et al. Molecular cloning and characterization of alpha 2-macroglobulin (a2-M) from the haemocytes of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2010;29: 195e203. [33] Zhao D, Chen L, Qin C, Zhang H, Wu P, Zhang F. A delta-class glutathione transferase from the Chinese mitten crab Eriocheir sinensis: cDNA cloning, characterization and mRNA expression. Fish Shellfish Immunol 2010;29: 698e703. [34] Zhao D, Song S, Wang Q, Zhang X, Hu S, Chen L. Discovery of immune-related genes in Chinese mitten crab (Eriocheir sinensis) by expressed sequence tag analysis of haemocytes. Aquaculture 2009;287:297e303. [35] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [36] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [37] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30:e36. [38] Russell S, Lumsden JS. Function and heterogeneity of fish lectins. Vet Immunol Immunopathol 2005;108:111e20. [39] Zhang M, Hu Y, Sun L. Identification and molecular analysis of a novel C-type lectin from Scophthalmus maximus. Fish Shellfish Immunol 2010;29:82e8. [40] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44: 598e607. [41] Sun YD, Fu LD, Jia YP, Du XJ, Wang Q, Wang YH, et al. A hepatopancreasspecific C-type lectin from the Chinese shrimp Fenneropenaeus chinensis exhibits antimicrobial activity. Mol Immunol 2008;45:348e61. [42] Fujita T, Matsushita M, Endo Y. The lectin-complement pathway e its role in innate immunity and evolution. Immunol Rev 2004;198:185e202. [43] Iwanaga S, Lee BL. Recent advances in the innate immunity of invertebrate animals. J Biochem Mol Biol 2005;38:128e50. [44] Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev Comp Immunol 2001;25:565e77. [45] Kawabata S, Iwanaga S. Role of lectins in the innate immunity of horseshoe crab. Dev Comp Immunol 1999;23:391e400. [46] Smith VJ, Chisholm JRS. Non-cellular-immunity in crustaceans. Fish Shellfish Immunol 1992;2:1e31.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Molecular cloning, characterization and expression of a C-type lectin cDNA in Chinese mitten crab, Eriocheir sinensis Hao Zhang a, Liqiao Chen a, *, Jianguang Qin b, Daxian Zhao a, Ping Wu a, Chuanjie Qin a, Na Yu a, Erchao Li a a b
School of Life Science, East China Normal University, Shanghai 200062, China School of Biological Sciences, Flinders University, Adelaide, SA 5001, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 February 2011 Received in revised form 1 June 2011 Accepted 1 June 2011 Available online 12 June 2011
C-type lectins are pattern-recognition proteins which are functionally important for pathogen recognition and immune regulation in vertebrates and invertebrates. In this study, a lectin cDNA named as EsLectin was cloned and characterized from the Chinese mitten crab, Eriocheir sinensis. The full-length sequence of this Es-Lectin cDNA was 651 bp, including an open reading frame of 483 bp encoding 160 amino acids. The predicted molecular weight of the Es-Lectin was 11.8 kDa. A typical signal peptide of 21 amino acids was deduced at the N-terminus of the predicted protein. This Es-Lectin belongs to a C-type lectin and contains six cysteines, a conserved EPN motif (Glu-Pro-Asn) and an imperfect WND (Trp-AsnAsp) motif (FND, Phe-Asn-Asp). This Es-Lectin had 55% and 32% identity with other two C-type lectins in E. sinensis, and 29e36% homology with decapods. Although the Es-Lectin was also expressed in gill, hepatopancreas, intestine, muscle and stomach, its expression in haemocytes was the greatest. The expression of Es-Lectins in haemocytes increased at 1.5 h after the Aeromonas hydrophila challenge. After a slight decrease, the Es-Lectin expression in haemocytes significantly increased at 48 h post-challenge. The diverse distribution of Es-Lectin and its enhancement by bacterial challenge indicate that C-type lectins are important in the innate immune response to bacterial infection, and can be activated for innate immune response in crab at the initial stage after pathogen infection. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Chinese mitten crab Eriocheir sinensis C-type lectin Gene expression Aeromonas hydrophila
1. Introduction Most invertebrates lack acquired immunity since these animals have no immunoglobulins, or memory following the first challenge of a pathogen [1]. Therefore, the innate immune system plays a major role in defending antipathogens [2]. The mechanism to defend the invading microorganisms is to recognize the characteristic of carbohydrate structures of a pathogen and to effectively discriminate pathogens [3]. During this recognition process, the innate recognition is mediated by a special protein known as pattern-recognition receptors (PRRs) [4]. Proteins containing a Ctype lectin-like domain are among the groups of PRRs in vertebrates to regulate the entire immune system [5e7]. The C-type lectins are a large group of extracellular metazoan proteins and have a function to recognize oligosaccharides in cell surfaces [1]. These lectins contain a Ca2þ-dependent carbohydrate recognition domain (CRD) with two or three pairs of disulfide bonds to bind the carbohydrate residues of foreign pathogens
* Corresponding author. Fax: þ86 021 62233637. E-mail address: [email protected] (L. Chen). 1050-4648/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2011.06.001
[3,8,9]. The classification of the C-type lectin family is based on the architecture of the C-type lectin domain-containing proteins [10]. For example, the bovine conglutinin which was the first lectin discovered from animals is a member of the C-type lectin family [11]. In vertebrates, the C-type lectin is currently classified into 17 groups [3]. However, in invertebrates, little information is available for the classification of the C-type lectin family at gene and protein levels, though several reports on C-type lectins in invertebrates have been published [12e14]. Current literature suggests that the member of the C-type lectin domain in invertebrates is more abundant and diverse than that in vertebrates [3,15]. In crustaceans, many C-type lectins have been identified [9,16,17], and most of these lectins display anti-virus and anti-bacteria activities [18e20]. In Fenneropenaeus merguiensis, a Ca2þ-dependent lectin in hemolymph contributes to the defense response to potential pathogenic bacteria [21]. A natural lectin from the serum of the shrimp Litopenaeus vannamei plays a significant role in host immune response against bacterial infections [22]. In Penaeus japonicus, an N-acetylglucosamine (GlcNAc) specific lectin isolated from serum has an opsonic activity against bacterial infection [23]. Based on cDNA sequence, more structural information is available in decapods. Two C-type lectin-like domain (CTLD)-containing proteins
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
were identified in Eriocheir sinensis and showed different roles in innate immune response to bacterial infection [24]. In Portunus trituberculatus, a CTLD-containing protein with one CRD was isolated and designated as PtLP [9]. A C-type lectin known as PmLec with one CRD was purified from the serum of Penaeus monodon. The PmLec is specific for bacterial lipopolysaccharide and serves a patternrecognition protein and opsonin [25]. In L. vannamei, two putative CRDs were found in a C-type lectin (named LvLT) against virus infection [19]. The dual-CRD structure also exists in the C-type lectin in P. monodon (named PmLT), and its expression in haemocytes suggests a possible function as a pattern-recognition protein to defend viral and bacterial pathogens [26]. Chinese mitten crab, E. sinensis, is an important freshwater crustacean for aquaculture and has brought significant revenue to rural economy. In the past few years, attempts have been made to understand the immunological mechanism in the Chinese mitten crab because various diseases caused by bacteria, viruses and Rickettsia-like organisms have threatened the sustainability for Chinese mitten crab farming [24,27e29]. In this study, we aimed to identify the C-type lectin cDNA from E. sinensis and characterize its expression patterns in various tissues following an Aeromonas hydrophila challenge on this crab. The characterization and molecular expression of the C-type lectins from E. sinensis will provide an insight into the understanding of pathogen recognition responses in crustacean and will be useful to develop techniques to control disease outbreak in aquaculture. 2. Materials and methods 2.1. Animals Adult Chinese mitten crabs E. sinensis were obtained from a fishing ground in Shanghai and acclimatized in the laboratory for 2 weeks before carrying out the experiment. The crabs weighing 150e200 g were used for the bacterial challenge test. Haemocytes were collected in an equal volume of anticoagulant solution (NaCl 510 mM; Glucose 115 mM; Na-citrate 30 mM; EDTANa2 mM; pH 7.55) and immediately centrifuged at 800 rpm for 10 min at 4 C. After haemocytes had been sampled, other crab tissues (gill, hepatopancreas, intestine, muscle and stomach) were also collected and immediately preserved in liquid nitrogen for RNA extraction. 2.2. Preparation of bacteria The Gram-negative bacterium A. hydrophila obtained from Guangzhou Microbiology Research Institute was chosen to challenge the crab because it was the pathogenic bacterium causing aeromonosis or haemorrhagic septicemia in crab and other aquatic animals [30]. The experimental bacteria were grown in the LuriaeBertani nutrient agar, and then diluted with sterile 0.85% NaCl to reach the density of 7.2 108 CFU/ml using by plate counts [30e33]. 2.3. RNA isolation Total RNA was extracted from the haemocytes and other tissues using the Unizol Reagent kit (Biostar, Shanghai, China) according to the manufacturer’s instructions. The concentration of the total RNA was quantified using spectrophotometry at a wavelength of 260 nm. 2.4. The full-length cDNA cloning Based on the ESTs sequence in the haemocyte cDNA library of E. sinensis [34], the special primers were designed for the gene clone (Table 1).
359
The full-length cDNA sequence of the lectin gene was obtained by using the SMARTÔ RACE cDNA amplification kit (Clonetech, USA). For 50 -RACE, the primers of LEC 5-R and the universal primer A mix (UPM) were used in a PCR reaction (1 circle of 94 C for 4 min; 30 circles of 94 C for 30 s, 66 C for 30 s and 72 C for 3 min; 1 circle of 72 C for 7 min). A touchdown PCR was used for 30 -RACE with the primers of LEC3-F and the abridged universal amplification primer (AUAP). The PCR reaction conditions were followed the manufacturer of AdvantageÔ 2 PAC kit (Clonetech, USA). The expected PCR products were eluted from the agarose gel and ligated to the pGEMT easy vector (Promega, USA). The ligation product was transformed to Escherichia coli. Clones were sequenced with universal primers T7 and SP6. After splicing the two fragments, the fulllength cDNA sequence was validated using the primers UPM and LEC AS. All the primers used in this study are shown in Table 1. 2.5. Phylogenetic analysis The lectin amino acid sequences from various species were downloaded from NCBI. A phylogenetic tree was constructed using the neighbour-joining method in the Molecular Evolutionary Genetics Analysis (MEGA 4) package [35]. The conserved domains CRD were searched with SMART program (http://smart.embl-heidelberg.de/). 2.6. Es-Lectin expression The expressions of Es-Lectin mRNA in crab tissues were detected by quantitative real time PCR. Total RNA from haemocytes, hepatopancreas, muscles, gills, intestine, and stomach was separately extracted. Before reverse transcription, the RNA samples were treated with DNAase (Promega, USA). The first strand cDNA was synthesized using a cDNA first strand synthesis kit with superscriptÔ III RNAse H-reverse transcriptase (Invitrogen, USA) using 5 mg total RNA. According to the cDNA full-length sequence, a pair of gene-specific primers (LEC S-RT and LEC AS-RT) was designed to amplify the 279 bp fragment, and the primers b-actin F and b-actin R were used to amplify the 266 bp fragments as the internal standard gene control. The SYBR Green quantitative real time PCR assay was conducted to determine the Es-Lectin mRNA expression in an iQÔ 5 Multicolor Real Time PCR Detection System. The PCR temperature profile and PCR reaction conditions were followed the manufacturer of SYBR Premix Ex Taq (TaKaRa, Dalian, China), and the PCR product was sequenced to verify the specificity of quantitative real time PCR. The expression level of Es-Lectin was calculated by 2DDCT [36], and the expression in haemocytes was used as the calibrator. Comparisons were made in different tissues using the analysis of variance (SPSS 14.0 package, SPSS Inc., New York, USA). 2.7. Infection response In the bacterial challenge group, 100 ml A. hydrophila (7.2 108 CFU/ml) was injected into the arthrodial membrane of the Table 1 Primers used in this study for the analysis of the Es-Lectins in E. sinensis. Primer name
Primer sequence 50 30
UPM AUAP LEC5-R LEC3-F LEC AS LEC S-RT LEC AS-RT b-actin F b-actin R
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT GGCCACGCGTCGACTAGTAC CGACCTTGGGGCTTGGCAGAT GTGGGCGGCGGCTGCTTCTA AGGTGCTATAACAACAACTTCAAGG GGGCGGCGGCTGCTTCTA CCATCATTGTTGGGCTCGTT TAGGTGGTCTCGTGGATGCC GAGACCTTCAACACCCCCGC
360
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
last walking leg of each crab. Each crab in the control group was received an injection of 100 ml sterile 0.85% NaCl. The challenged crabs were returned to the freshwater tanks immediately after injection, and three individuals were randomly sampled at 0, 1.5, 3, 6, 12, 24 and 48 h post-injection from the challenged and control groups. Each crab was bled only once to avoid any interference of the gene expression. The expressions of Es-Lectin mRNA in the challenge and control crabs were also detected by quantitative real time PCR analysis. The values of cycle time (Ct) were compared and converted to differences by fold using the relative quantification method in the Relative Expression Software Tool 384 v.1 (REST), and normalized with b-actin [37]. In this software, pair wise fixed reallocation randomization test was used to compare the differences between the treatment and control groups. Differences were considered significant at P < 0.05.
EsCTLDcp-1, 32% with EsCTLDcp-2, and significant homology with the lectins of other decapods from 36 to 29% (e.g., 33% with C-type lectin of P. monodon, 31% with C-type lectin 1 of Fenneropenaeus chinensis, 35% with C-type lectin protein of F. chinensis, and 29% with C-type lectin-like domain-containing protein PtLP of P. trituberculatus). 3.2. The domain feature and phylogeny of Es-lectin in E. sinensis To evaluate the molecular evolution of Es-Lectin relative to lectins in other decapods, a phylogenetic tree was constructed by the neighbour-joining method (Fig. 2). The phylogenetic tree was constructed using the C-type lectin domain from lectin amino acid sequences of other decapods, and revealed that lectins could be divided into two related groups. The first group of lectins contained six cysteines, and the second group had four cysteines. The EsLectin was closely related to the EsCTLDcp-1.
3. Results 3.1. The full-length cDNA sequence of Es-lectin in E. sinensis The full sequence of Es-Lectin cDNA was 640 bp in length, consisting of an open reading frame (ORF) of 483 bp, a 50 untranslated region (UTR) of 20 bp, and a 30 UTR of 137 bp (including the poly A tail) with the polyadenylation signal ATTAAA. The ORF encoded a preprotein of 160 amino acids with a predicted molecular weight of 17.83 kDa and a pI of 6.98 (Fig. 1). The putative signal peptide was identified using SignalP (http://www.cbs.dtu. dk/services/SignalP) contained 20 amino acid residues. The Ctype lectin domains were predicted by the SMART program (http:// www.smart.embl-heidelberg.de/) and one C-lectin domain was found in the C- terminus. The full-length sequence has been submitted to the NCBI GenBank (GenBank ID: ADB10837). The deduced amino acid sequence comparisons were carried out using BLAST algorithm at the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm.nih.gov/blast.cgi). The alignments indicated that Es-Lectin showed 55% identity with
3.3. Es-Lectin expression in other tissues A predominant Es-Lectin transcript expression was observed in all tissues sampled. But the relative numbers of the transcripts were the highest in haemocytes. The expression level in haemocytes was almost 20 times it in hepatopancreas, and more than 100 times it in gill, muscle, stomach and intestine (Fig. 3). After the analysis of SPSS, the expression was significant in haemocytes (P < 0.05). 3.4. Expression of Es-Lectin after injection with A. hydrophila Quantitative real time PCR was used to determine the effect of bacterial challenge on Es-Lectin mRNA expression level in haemocytes after injecting live A. hydrophila from 1.5 to 48 h. Fig. 4 presents the fold change of Es-Lectin expression to the control as normalized with b-actin. The Es-Lectin expressions significantly increased at 1.5 h after injection (P < 0.05), then decreased at 3, 6, 12, and 24 h. The most significant change was at 48 h post-injection (P < 0.05),
Fig. 1. Multiple alignments of the deduced amino acid sequences of lectins from Eriocheir sinensis (Es-Lectin, GenBank ID:ADB10837; EsCTLDcp-1, GenBank ID:ADK66338; EsCTLDcp-2, GenBank ID:ADH43623), Marsupenaeus japonicus (LectinE, GenBank ID:ADG85658), Fenneropenaeus chinensis (CLectin1, GenBank ID:ABA54612) and Xenopus tropicalis (Lectin, GenBank ID:XP_002933953). The domain structure is indicated with arrows and lines spanning the appropriate length. The conserved amino acids are in black background and the EPN and FND motif were circled. The EsCTLDcp-1 has no signal peptide.
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
361
Fig. 2. Phylogenetic tree of known CRDs of Decapoda lectins. The GenBank accession numbers of genes involved are as below, Penaeus monodon a, b (GenBank ID:ABI97373); Fenneropenaeus merguiensis a, b (GenBank ID:ACR56805); Fenneropenaeus chinensis 5a, 5b(GenBank ID:ACJ06428); Penaeus semisulcatus a, b (GenBank ID:ABI97372); Litopenaeus vannamei a, b (GenBank ID:ABI97374); Eriocheir sinensis 2 (GenBank ID:ADH43623); Marsupenaeus japonicus E (GenBank ID:ADG85658); Litopenaeus vannamei (GenBank ID:ABU62825); Fenneropenaeus chinensis 1 (GenBank ID:ABA54612); Marsupenaeus japonicus A (GenBank ID:ADG85666); Marsupenaeus japonicus B (GenBank ID:ADG85668); Marsupenaeus japonicus C (GenBank ID:ADG85667.1); Marsupenaeus japonicus D (GenBank ID:ADG85659); Portunus trituberculatus (GenBank ID:ACC86854); Fenneropenaeus chinensis 3 (GenBank ID:ACJ06431); Eriocheir sinensis 1 (GenBank ID:ADK66338); Eriocheir sinensis (GenBank ID:ADB10837); Penaeus monodon (GenBank ID:AAZ29608); Fenneropenaeus chinensis a, b (GenBank ID:AAX63905); Portunus pelagicus (GenBank ID:ABM65756); Scylla paramamosain (GenBank ID:ADF27340); Fenneropenaeus chinensis 6 (GenBank ID:ACJ06430); Pacifastacus leniusculus (GenBank ID:AAX55747); Procambarus clarkia (GenBank ID:ACR20475), and Homo sapiens (GenBank ID:AAB17133).
and the expression increased 7.5 fold in bacterial-group as compared to the crab with saline injection. 4. Discussion Lectins are important in the innate immunity system against bacterial infections in aquatic animals, including fish [38,39] and crustaceans [19,40,41]. Two C-type lectin cDNAs have been reported in Eriocheir sinence for their roles in the innate immune response to bacterial infection [24]. In the present study, a new C-type lectin cDNA from E. sinensis haemocytes was characterized. The results confirmed the diversity of C-type lectins in crustaceans and provided critical information towards the understanding of the of lectin classification in invertebrates.
Alignment of amino acid sequences reveals that the C-type lectin domain is a relatively conservative structure, but also has various mutations in some motifs. The phylogenic tree of the C-type lectin domain of different lectin amino acid sequences in decopods was divided into two clusters based on the number of cysteines. The first lectin group, including Es-Lectin, contains six cysteines which are responsible for the formation of three disulfide bonds to form a complete CRD, while proteins in the second group only have four cysteines. Two binding sites consisting of a conserved EPN (Glu-Pro-Asn) and an imperfect WND (Trp-AsnAsp) motif (FND, Phe-Asn-Asp) existed in Es-Lectin. The EPN motif dictates specificity of mannose containing ligands [42]. The WND motif is a typical site for binding carbohydrates [3,43]. However, the WND motif in invertebrates is always mutated to
362
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363
Fig. 3. Quantitative real time PCR analysis of Es-Lectin expression in various tissues. The ratio refers to the gene expression in different tissues to that in haemocytes, and b-actin gene was used as internal control.
a homologous motif, such as FRD (Phe-Arg-Asp), FND (Phe-AsnAsp) and VND (Val-Asn-Asp) [26]. In the lectins of P. monodon (GenBank ID:ABI97373), F. merguiensis (GenBank ID:ACR56805), Penaeus semisulcatus (GenBank ID:ABI97372) and L. vannamei (GenBank ID:ABI97374), a dual-CRD structure contains different binding motifs [19,26]. Together with other two lectins reported preciously [24], all three lectins of E. sinensis have one CRD and one EPN motif, suggesting that these three lectins have a mannose binding function. The Es-Lectin is similar to EsCTLDcp-1 because it shares the same FND motif and 55% identity. In contrast, the EsCTLDcp-2 contains the WVD modif (Trp-Val-Asp), and only shows 32% identity with Es-Lectin. Therefore, we suggest that Es-Lectin is possibly the homologues of EsCTLDcp-1. In invertebrates, hepatopancreas and haemocytes are the central locations to participate in pathogen recognition, phagocytosis, melanization and cytotoxicity to control and regulate the
innate immune system to avoid the deleterious effects from pathogen [44,45]. The circulating haemocytes play extremely important roles in the protection for infectious agents killing and the synthesis of antimicrobial molecules [46]. The results of Northern blotting and in situ hybridization suggest that Fclectin transcripts of F. chinensis are mainly expressed in haemocytes [40]. In this study, the Es-Lectin mRNA level in the Chinese mitten crab was expressed most abundantly in the haemocytes, which is similar to the transcripts of Fclectin in F. chinensis [40]. In contrast, Fc-hsL of F. chinensis, LvLT of L. vannamei and PmLT of P. monodon, EsCTLDcp-1 and EsCTLDcp-2 of E. sinensis, and PtLP of P. trituberculatus are all expressed exclusively in the hepatopancreas [9,19,24,40,41]. In this study, the newly found Es-Lectin in the Chinese mitten crab was stimulated at the initial stage after pathogen infection by showing an over 2-fold increase between 1.5 h and 48 h postchallenge. This result is consistent with the gene expressions of different C-type lectins in other crustacean species. In L. vannamei, the expression levels of LvLT decreased in the first 2 h and then increased to a much higher level at 4 h after the challenge with the white spot syndrome virus (WSSV) [19]. Also, the expression of a C-type lectin PmLT in P. monodon was similar to the expression of another C-type lectin LvLT in L. vannamei [26]. In contrast, the Fclectin expression in F. chinensis is up-regulated only after 24 h of the WSSV challenge [40]. In another study, the expression of a C-type lectin EsCTLDcp-1 in E. sinensis was also stimulated by A. hydrophila challenge with a significant increase at 2 h postchallenge, followed by two declines at 4 h and 8 h and two rises at 12 h and 24 h [24]. However, the expression of another C-type lectin EsCTLDcp-2 in E. sinensis showed a general declining trend over time from the starting point of A. hydrophila infection [24]. Therefore, our results and other studies seem to suggest the diverse nature of C-type lectins in responding to pathogen challenge in crustacean species. In conclusion, a new lectin gene was cloned from E. sinensis, and it was expressed highly in haemocytes of healthy E. sinensis. The upregulation expression of the Es-Lectin in haemocytes after A. hydrophila challenge indicates that its positive role in responding to bacterial challenge. However, further study is needed to understand the functions of lectin in immune defense system of E. sinensis. Acknowledgements This research was supported by grants from the Special Fund for Agro-scientific Research in the Public Interest (No. 201003020), Shanghai Committee of Science and Technology, China (08DZ1906401, 10JC1404100), National Natural Science Foundation of China (No. 30771670), The Specialized Research Fund for the Doctoral Program of Higher Education of China (No. 200802690012), the National Basic Research Program (973 Program, No. 2009CB118702), Shanghai Agriculture Science and Technology Key Grant (No.2-1, 2009), Shanghai technology system for Chinese mitten-handed crab industry, and partially by the E-Institute of Shanghai Municipal Education Commission (No. E03009). References
Fig. 4. The fold change of Es-Lectin gene expression in haemocytes after challenge of A. hydrophila to the control group at same time point (0, 1.5, 3, 6, 12, 24 and 48 h) as normalized with b-actin gene. Error bars indicate standard error and asterisks indicate statistical significance (P < 0.05).
[1] Marques MRF, Barracco MA. Lectins, as non-self-recognition factors, in crustaceans. Aquaculture 2000;191:23e44. [2] Hoffmann JA, Reichhart JM. Drosophila innate immunity: an evolutionary perspective. Nat Immunol 2002;3:121e6. [3] Zelensky AN, Gready JE. The C-type lectin-like domain superfamily. FEBS J 2005;272:6179e217. [4] Medzhitov R, Janeway CAJ. Decoding the patterns of self and nonself by the innate immune system. Science 2002;296:298e300. [5] Christophides GK, Vlachou D, Kafatos FC. Comparative and functional genomics of the innate immune system in the malaria vector Anopheles gambiae. Immunol Rev 2004;198:127e48.
H. Zhang et al. / Fish & Shellfish Immunology 31 (2011) 358e363 [6] Kumagai Y, Akira S. Identification and functions of pattern-recognition receptors. J Allergy Clin Immunol 2010;125:985e92. [7] Schulenburg H, Boehnisch C, Michiels NK. How do invertebrates generate a highly specific innate immune response? Mol Immunol 2007;44:3338e44. [8] Drickamer K. Two distinct classes of carbohydrate-recognition domains in animal lectins. J Biol Chem 1988;263:9557e60. [9] Kong HJ, Park EM, Nam BH, Kim YO, Kim WJ, Park HJ, et al. A C-type lectin likedomain (CTLD)-containing protein (PtLP) from the swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2008;25:311e4. [10] Drickamer K. Evolution of Ca2þ-dependent animal lectins. Prog Nucleic Acid Res Mol Biol 1993;45:207e32. [11] Kilpatrick DC. Animal lectins: a historical introduction and overview. Biochim Biophys Acta 2002;1572:187e97. [12] Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG. The genome sequence of Drosophila melanogaster. Science 2000;287:2185e95. [13] Schulenburg H, Hoeppner MP, Weiner 3rd J, Bornberg-Bauer E. Specificity of the innate immune system and diversity of C-type lectin domain (CTLD) proteins in the nematode Caenorhabditis elegans. Immunobiology 2008;213:237e50. [14] Wang XW, Xu WT, Zhang XW, Zhao XF, Yu XQ, Wang JX. A C-type lectin is involved in the innate immune response of Chinese white shrimp. Fish Shellfish Immunol 2009;27:556e62. [15] Dodd RB, Drickamer K. Lectin-like proteins in model organisms: implications for evolution of carbohydrate-binding activity. Glycobiology 2001;11:71Re9R. [16] Alpuche J, Pereyra A, Agundis C, Rosas C, Pascual C, Slomianny MC, et al. Purification and characterization of a lectin from the white shrimp Litopenaeus setiferus (Crustacea decapoda) hemolymph. Biochim Biophys Acta 2005; 1724:86e93. [17] Cominetti MR, Marques MR, Lorenzini DM, Lofgren SE, Daffre S, Barracco MA. Characterization and partial purification of a lectin from the hemolymph of the white shrimp Litopenaeus schmitti. Dev Comp Immunol 2002;26:715e21. [18] Luo T, Zhang X, Shao Z, Xu X. PmAV, a novel gene involved in virus resistance of shrimp Penaeus monodon. FEBS Lett 2003;551:53e7. [19] Ma TH, Tiu SH, He JG, Chan SM. Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection. Fish Shellfish Immunol 2007;23:430e7. [20] Zhao ZY, Yin ZX, Xu XP, Weng SP, Rao XY, Dai ZX, et al. A novel C-type lectin from the shrimp Litopenaeus vannamei possesses anti-white spot syndrome virus activity. J Virol 2009;83:347e56. [21] Rittidach W, Paijit N, Utarabhand P. Purification and characterization of a lectin from the banana shrimp Fenneropenaeus merguiensis hemolymph. Biochim Biophys Acta 2007;1770:106e14. [22] Sun J, Wang L, Wang B, Guo Z, Liu M, Jiang K, et al. Purification and characterisation of a natural lectin from the serum of the shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2007;23:292e9. [23] Kondo M, Matsuyamam H, Yano T. The opsonic effect of lectin on phagocytosis by hemocytes of Kuruma Prawn, Penaeus japonicus. Fish Pathol 1992;27: 217e22. [24] Guo HZ, Zou PF, Fu JP, Guo Z, Zhu BK, Nie P, et al. Characterization of two Ctype lectin-like domain (CTLD)-containing proteins from the cDNA library of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2010;30: 515e24. [25] Luo T, Yang H, Li F, Zhang X, Xu X. Purification, characterization and cDNA cloning of a novel lipopolissacharide-binding lectin from the shrimp Penaeus monodon. Dev Comp Immunol 2006;30:607e17. [26] Ma TH, Benzie JA, He JG, Chan SM. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J Invertebr Pathol 2008;99:332e41.
363
[27] Wang W, Gu Z. Rickettsia-like organism associated with tremor disease and mortality of the Chinese mitten crab Eriocheir sinensis. Dis Aquat Org 2002;48: 149e53. [28] Wang W, Zhu N, Gu Z, Du K, Xu Z. Study on the transmission of tremor disease (TD) in the Chinese mitten crab, Eriocheir sinensis (Crustacea: decapoda). J Invertebr Pathol 2002;81:202e4. [29] Xu HS, Shu MA, Zhan XA, Wang SX. Identification of Vibrio parahaemolyticus isolated from cultured Eriocheir sinensis and pathogenicity of its extracellular products. J Fish China 2002;26:357e62. [30] Zhao D, Chen L, Qin C, Zhang H, Wu P, Li E, et al. Molecular cloning and characterization of the lipopolysaccharide and beta-1, 3-glucan binding protein in Chinese mitten crab (Eriocheir sinensis). Comp Biochem Physiol B 2009;154:17e24. [31] Qin C, Chen L, Qin JG, Zhao D, Zhang H, Wu P, et al. Characterization of a serine proteinase homologous (SPH) in Chinese mitten crab Eriocheir sinensis. Dev Comp Immunol 2010;34:14e8. [32] Qin C, Chen L, Qin JG, Zhao D, Zhang H, Wu P, et al. Molecular cloning and characterization of alpha 2-macroglobulin (a2-M) from the haemocytes of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2010;29: 195e203. [33] Zhao D, Chen L, Qin C, Zhang H, Wu P, Zhang F. A delta-class glutathione transferase from the Chinese mitten crab Eriocheir sinensis: cDNA cloning, characterization and mRNA expression. Fish Shellfish Immunol 2010;29: 698e703. [34] Zhao D, Song S, Wang Q, Zhang X, Hu S, Chen L. Discovery of immune-related genes in Chinese mitten crab (Eriocheir sinensis) by expressed sequence tag analysis of haemocytes. Aquaculture 2009;287:297e303. [35] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [36] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [37] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30:e36. [38] Russell S, Lumsden JS. Function and heterogeneity of fish lectins. Vet Immunol Immunopathol 2005;108:111e20. [39] Zhang M, Hu Y, Sun L. Identification and molecular analysis of a novel C-type lectin from Scophthalmus maximus. Fish Shellfish Immunol 2010;29:82e8. [40] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44: 598e607. [41] Sun YD, Fu LD, Jia YP, Du XJ, Wang Q, Wang YH, et al. A hepatopancreasspecific C-type lectin from the Chinese shrimp Fenneropenaeus chinensis exhibits antimicrobial activity. Mol Immunol 2008;45:348e61. [42] Fujita T, Matsushita M, Endo Y. The lectin-complement pathway e its role in innate immunity and evolution. Immunol Rev 2004;198:185e202. [43] Iwanaga S, Lee BL. Recent advances in the innate immunity of invertebrate animals. J Biochem Mol Biol 2005;38:128e50. [44] Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev Comp Immunol 2001;25:565e77. [45] Kawabata S, Iwanaga S. Role of lectins in the innate immunity of horseshoe crab. Dev Comp Immunol 1999;23:391e400. [46] Smith VJ, Chisholm JRS. Non-cellular-immunity in crustaceans. Fish Shellfish Immunol 1992;2:1e31.