- Email: [email protected]
Molecular epidemiology of porcine reproductive and respiratory syndrome virus (PRRSV) in Québec
Virus Research 96 (2003) 3 /14 www.elsevier.com/locate/virusres
Molecular epidemiology of porcine reproductive and respiratory syndrome virus (PRRSV) in Que´bec Rene´e Larochelle a,*, Sylvie D’Allaire b, Ronald Magar a a
Laboratoire d’hygie`ne ve´te´rinaire et alimentaire, Agence canadienne d’inspection des aliments, 3400 Casavant ouest, St-Hyacinthe, Que´bec, Canada J2S 8E3 b Faculte´ de me´decine ve´te´rinaire, Universite´ de Montre´al, C.P. 5000, St-Hyacinthe, Que´bec, Canada J2S 7C6 Received 24 March 2003; received in revised form 30 May 2003; accepted 30 May 2003
Abstract Porcine reproductive and respiratory syndrome virus (PRRSV) strains identified in samples from 226 field cases originating from Que´bec herds and submitted over a 4-year period (March 1998 /July 2002) were studied. Sequencing of PRRSV strains was performed on the ORF5 gene amplified product and restriction fragment length polymorphism (RFLP) patterns for enzymes MluI, HincII and SacII were determined on these sequences. Twenty-four other PRRSV isolates including three vaccine strains were also included for comparison purposes and the total of 250 PRRSV strains were used in a phylogenetic analysis. Clinical and epidemiological data were collected through a questionnaire for each of the submitted field cases. About 75% of the cases were submitted during autumn and winter. Over 60% of the cases were submitted for reproductive problems, 33% for respiratory problems and 6% for increased PRRSV serological titers in the herd in absence of clinical signs. In 69% of the cases there was a PRRS vaccination program for the herd. However, only 26% of the animals from which samples were obtained had been vaccinated themselves. The genomic analysis of this large number of strains revealed a great variability of PRRSV ORF5 with 59% of amino acid positions being polymorphic. A total of 29 RFLP patterns were obtained. The main RFLP patterns obtained were 1-8-4 (28%), 1-4-4 (16%), 1-2-4 (9%) and 1-11-4 (9%). The global findings derived from the molecular analysis of 226 PRRSV strains suggest that PRRSV circulating in Que´bec represent a different sub-population of strains. Vaccine-like strains were identified in 10% of the cases. A phylogenetic tree enabled the identification of 44 groupings comprising two to 23 strains each. Of the 250 sequences analyzed, 183 (73%) could be included in one of these groupings. The data collected from the questionnaires were used to establish epidemiological links between strains within groupings. The main relationships between strains within a grouping were the introduction of infected animals (19%) and area spread (33%). In 40% of the cases from which an area spread was suspected, herds were located within 3 km from another. Aerosol transmission was suspected in several cases, more than half of which belonged to different owners. In 41 herds, more than one strain (2 /8) were identified over a period varying from 3 months to 4 years. Data indicated that a PRRSV strain can persist in a herd up to 3.5 years displaying as little as 2% variation in ORF5 during this time. In 78% of the herds with multiple submissions genetically different strains were identified; often within 1 year of the original identification. These genetically distinct strains were often associated with a recrudescence of moderate to severe clinical signs. Coexistence on the same farm of different PRRSV strains was also observed. # 2003 Elsevier B.V. All rights reserved. Keywords: Porcine reproductive and respiratory syndrome virus; Epidemiology; ORF5 sequences; Phylogenetic analysis
1. Introduction Porcine reproductive and respiratory syndrome (PRRS) is a worldwide recognized disease with impor-
* Corresponding author. Tel.: /1-450-773-7730; fax: /1-450-7738152. E-mail address: [email protected] (R. Larochelle). 0168-1702/03/$ - see front matter # 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0168-1702(03)00168-0
tant economic impact on swine industry. The disease is characterized by reproductive problems such as abortions, farrowing of dead or weak piglets, high preweaning mortality and mortality in sows. In weaned and grower pigs, pneumonia, failure to thrive and an increase in concurrent bacterial infection are observed (reviewed in Benfield et al., 1999). The PRRS virus (PRRSV) is an enveloped positive strand RNA virus
4
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
classified in the Arteriviridae family (Brinton et al., 2000). The first two open reading frames (ORF1a and 1b) of the 15 kb genome encode the viral polymerase. The ORF2, ORF3, ORF4 encode envelope proteins, the functions of which are not fully understood. The ORFs 5, 6 and 7 encode major structural envelope (E), membrane (M) and nucleocapsid (N) proteins, respectively (Meulenberg et al., 1995). Several studies have demonstrated that PRRSV strains from US are genetically highly variable particularly at the level of the E glycoprotein (Meng et al., 1995; Kapur et al., 1996; Andreyev et al., 1997; Murtaugh et al., 1998; Goldberg et al., 2000a). In a genomic comparison of ORFs 2/5 from five US PRRSV strains of different virulence, Meng et al. (1995) could not find any correlation between sequence variation and PRRSV virulence. In a recent study, data derived from ORF5 gene sequences of US isolates suggested that the manifestation of high mortality in sows in some outbreaks of PRRSV was under genetic influence (Goldberg et al., 2000b). In contrast, the genetic comparison of the ORF5 of eight PRRSV strains identified from herds experiencing severe acute PRRSV showed that these isolates actually differed from each other (Key et al., 2001). It has been suggested that genomic variation of PRRSV could occur not only by the accumulation of random mutations but also by intragenic recombinations (Kapur et al., 1996; Yuan et al., 1999; Meng, 2000; Murtaugh et al., 1998, 2001; Yoon et al., 2001) and quasispecies evolution (Rowland et al., 1999). The genetic diversity of PRRSV has implications for the control of the disease, and the use of genomic characterization in combination with epidemiological data may help to improve understanding regarding the routes of transmission of this virus between herds and the temporal variation of strains. In a study of 55 field isolates from Illinois and Iowa, Goldberg et al. (2000a) examined the ORF5 genomic variations between strains in regards with the geographical distance between farms. They found no correlation between the geographical proximity of PRRSV isolates and their genomic similarity, suggesting that PRRSV typically moves between farms via long-distance processes such as transport of animals or semen rather than via distance-limited processes such as wind or wild-life vectors. In contrast, area spread of PRRSV among a few farms unassociated with direct transmission by pigs or indirect transmission by humans or fomites was recently reported (Lager et al., 2002). Although experimentally airborne transmission (Torremorell et al., 1997; Brockmeier and Lager, 2002), biological (Zimmerman et al., 1997; Otake et al., 2002c) or mechanical vectors and fomites (Dee et al., 2002; Otake et al., 2002a,b) have been proposed as mechanisms of PRRSV spread, field studies addressing
these mechanisms of transmission have been few (Le Potier et al., 1997; Mortensen et al., 2002). The present study was conducted to gather knowledge on the genomic variability of PRRSV strains circulating in Que´bec herds and to identify possible relationships between PRRSV strains using epidemiological data and a phylogenetic analysis, with the hope of better understanding some of the factors involved in virus spread between herds and the temporal variation of strains.
2. Materials and methods 2.1. Case submissions and data collection PRRSV strains identified in samples from 226 field cases originating from Que´bec herds and submitted over a 4-year period (March 1998/July 2002) were studied. Most cases were from herds experiencing reproductive and respiratory disease compatible with PRRS. In breeding herds, the reproductive problems were characterized by anorexia in sows, abortions, stillborn and weak piglets, an increased mortality in nursing piglets and sows, and a lower farrowing rate. The clinical signs most frequently observed in suckling piglets included emaciation, anorexia, hyperpnea, dyspnea and chemosis. In nursery and grower pigs, the most common clinical signs were anorexia, lethargy, hyperpnea and dyspnea. Some cases originated from herds without any clinical signs in which a serological evaluation revealed increased titers to PRRSV. Blood and/or lung and lymph nodes tissue samples were collected from nursery-grower pigs with clinical signs, and in breeding herds from suckling piglets with respiratory problems or from weak-born piglets aged less than 48 h. A questionnaire, one for reproductive disease in the sow herd or one for respiratory disease in nurserygrower pigs, was filled out by the attending veterinarian for each submitted case. The questionnaires allowed to gather information on the clinical signs observed in the herd and in the animals from which tissues were submitted, the onset and duration of clinical signs, whether the PRRS problem was endemic or epidemic, and if so, whether it was a new or a recrudescent problem in the herd, location of farm, type of production, herd size, animal flow, source of animals, PRRSV vaccination status, suspected cause of contamination for new outbreaks and distance from neighbouring farms. Distance between farms were further investigated in some cases. When distance was suspected to be shorter than 10 km, a global positioning system (GPS) receiver (Magellan GPS 315, San Dimas, CA, USA) was used to obtain a more precise estimate of distance between farms. For some herds, more than one case was submitted. To consider a multiple submission to originate from the
R. Larochelle et al. / Virus Research 96 (2003) 3 /14 Table 1 Restriction sites and number designating the cut pattern for HincII in PRRSV ORF5 Number
Restriction sites
Study
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
Not cut 87 218 87, 218 359 87, 359 87, 218, 359 87, 218, 380 380 218, 380 87, 380 87, 218, 359, 218, 359 87, 218, 290, 87, 172, 218, 87, 218, 380, 87, 218, 507 99
Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Present study Present study Present study Present study Present study Present study Present study Present study Present study Present study
380 380 380 501
1998 1998 1998 1998 1998 1998 1998 1998
same herd, a herd was defined as a single site with any type of production which was run on a continuous flow basis at the barn level. This excluded nurseries and finishing barns that either were run on an all-in all-out fashion or were off-site from the breeding herd. It also excluded sites on which there were more than one breeding herd. Other PRRSV isolates were also included for comparison purposes in the genomic and phylogenetic analysis: 16 from Que´bec field cases of previous years (1992 /1997), four from field cases from other Canadian provinces (1990 /1994), three vaccine strains (Ingelvac RespPRRS/ReproTM and Ingelvac PRRS ATP from Boehringer Ingelheim, St. Joseph, MO, USA; Prime Pac† PRRS, Schering Plough Animal Health, Omaha, NE, USA) and one US strain (ATCC-VR2332). These isolates were referred to as the reference strains. 2.2. Polymerase chain reaction (PCR) Fresh tissues and blood or serum samples were obtained. Serum was separated from blood samples by centrifugation and stored at /70 8C. Lung and lymph nodes homogenates were prepared (20% in minimum essential medium), clarified by centrifugation and frozen at /70 8C. Total RNA was extracted from 250 ml of serum or tissue homogenates using TRIZOL LS reagent (Canadian Life Technologies, Burlington, Ontario, Canada). Reverse transcription was carried out using the Superscript II (Canadian Life Technologies) and random primers (Roche Diagnostics, Laval, Que´bec, Canada). Polymerase chain reaction (PCR) was per-
5
formed to amplify the ORF 5 using the following pairs of primers: 5FN: 5? ATGTTGGGGAAATGCTTGACC 3? with 5DN: 5? GTTCCGCTGAAACTCTGGTTA 3? and primers published by Andreyev et al. (1997). For the PCR reaction using primers 5FN / 5DN, 2 ml of cDNA was added to a PCR mixture with final concentrations of 1.50 mM MgCl2, 1 /PCR buffer, 0.2 mM each dNTP, 1 mM each primer and 2.5 U of Taq DNA polymerase (Canadian Life Technologies) per 50 ml. Amplification was achieved by 35 cycles of denaturing at 95 8C for 1 min, annealing at 60 8C for 1 min and extension at 72 8C for 1 min. The PCR reaction using the other pair of primers was the same with the exception of the annealing which was performed at 55 8C. The PCR was ended with a final extension step of 10 min at 72 8C.
2.3. Sequencing and phylogenetic analyses The ORF5 region of a total of 247 PRRSV strains including the PRRS ATP vaccine strain was sequenced. Before sequencing, PCR products were purified using a commercial kit according to the manufacturer’s instructions (QIAquick PCR purification kit, Qiagen Inc., Mississauga, Ontario, Canada). Purified PCR products were sequenced in both directions using standard automated sequencing methods (University Core DNA Sequencing Laboratory, University of Calgary, Calgary, Alberta and Universite´ Laval, Que´bec, Canada). In addition to the above, sequences from two vaccine strains, RespPRRS and PrimePac, and from the US strain ATCC-VR2332 (GenBank accession numbers AF066183, AF066384 and U87392, respectively) were added in the phylogenetic analysis. The nucleotide sequences were aligned using the CLUSTALW 1.8 multiple sequence alignment program (Thompson et al., 1997). The alignment was visualized using GENEDOC 2.5 package (Nicholas and Nicholas, 1997). The phylogenetic analysis was performed on the aligned data set and an unrooted tree was constructed using the distancebased neighbor-joining method with and without correction for multiple substitutions. All programs were part of the CLUSTAL X package. Clusters or groupings of similar sequences were examined in regards to the clinical and epidemiological data. The restriction fragment length polymorphism (RFLP) patterns for enzymes MluI, HincII and SacII (Wesley et al., 1998) were determined on the sequences using the WEBCUTTER 2.0 program. For the enzyme HincII, other restriction sites in addition to the ones described by Wesley et al. (1998) were observed and were designated by increasing numbers in the course of their occurrence (Table 1).
6
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
3. Results 3.1. General characteristics of the cases The 226 field cases originated from 174 herds. In 41 herds, several samples were submitted over time. About 75% of the cases were submitted during autumn and winter, from November through April. Nearly 2/3 of the cases (61.5%) were submitted for reproductive problems, 32.7% for respiratory problems and 5.7% because increased PRRSV serological titers, in absence of clinical signs, had been detected in the herd (Table 2). Most of the problems in the herds were presented as an outbreak or a recrudescence of clinical signs associated with PRRS. In submissions from nursery-grow-finishing stage, endemic cases were mostly observed in farrow-tofinish operations, whereas the epidemic forms were mainly reported from nursery or finishing operations which were more often run in an all-in all-out fashion at the room or barn level. The size of the breeding herds varied from 100 to 2400 sows with an average of 610 sows. The average inventory of the nursery and growing-finishing barns was 1680 and 2010 animals, with a range of 250/3600 and 500 /8000, respectively. All the herds were kept in total confinement. In 69% of the cases there was a PRRS vaccination program for the herd. This proportion varied according to the type of operation, with 84% in breeding herds compared with 42% in nursery-grow-finish units. Also, 26% of the submitted animals were vaccinated for PRRSV, with a proportion of 21% in animals from breeding herds and 36% in pigs from nursery-grow-finish herds. 3.2. Genomic analysis Sequence analysis of the ORF5 of the 250 PRRSV strains revealed that they all had the same size of 603 nucleotides with the exception of three strains which had 600 nucleotides, having a deletion of three nucleotides at positions 97 /99. Thus the E protein amino acid sequence for each strain consisted of 200 residues, except for three strains that had a deletion of one amino acid at residue 33. Pairwise comparison of all strains showed that the homology between strains ranged from 84 to 100% for the nucleic acids and 78.5 /100% at the
amino acid level. Thus ORF5 displayed considerable genetic variation, 310/603 (51%) of the nucleic acid positions and 117/200 (59%) of the amino acid positions being polymorphic (Fig. 1). In addition to the variability observed in the N-terminal region (residue 1/31, putative signal peptide sequence), two hypervariable regions were identified in the ectodomain (aa 32/35 and 57 /61) with positions 32/35 corresponding to potential glycosylation sites. The N-glycosylation sites at position 44 and 51 were relatively well conserved with a few strains only showing amino acids substitutions (aspartic acid, tyrosine, histidine). Moderately conserved regions were located at positions 40 /56, 62 /89, 107 /120 and 129 /150. At position 151, two vaccine-like strains conserved the glycine residue typical of the RespPRRS vaccine while the others contained an arginine at this position. Nearly 80% of the field strains had a lysine residue at position 151, followed in decreasing frequency by arginine, asparagine and glutamic acid. The Cterminal region was also found to contain various amino acid substitutions. All PRRSV strains identified belonged to the North American genotype.
3.3. RFLP patterns A total of 29 RFLP patterns were obtained. The main RFLP patterns obtained were the followings: 1-8-4 (28%), 1-4-4 (16%). 1-2-4 (9%), 1-11-4 (9%), 1-10-4 (4%), 1-12-4 (4%), 1-8-3 (4%) and 1-8-2 (3%). Vaccinelike strains were identified in 10% of the cases. Twentyone strains were grouped with the US-VR2332 and the RespPRRS vaccine strain. When compared with this vaccine, these strains demonstrated a homology greater than 98.5%. Of these 21 strains, 20 demonstrated the characteristic 2-5-2 RFLP vaccine pattern and one strain showed a 1-5-2 intermediate pattern. One strain having the 1-4-2 pattern was closely related to the PRRS ATP vaccine strain (99.8% homology). In addition to the above described RFLP patterns, 18 other patterns were determined for the 14% remaining strains: 1-1-3, 11-4, 1-2-2, 1-3-3, 1-3-4, 1-4-3, 1-6-2, 1-9-3, 1-10-1, 1-112, 1-14-4, 1-15-1, 1-15-2, 1-15-4, 1-16-3, 1-16-4, 1-17-4 and 1-18-4.
Table 2 Types of herds and clinical signs involved in the 226 field cases of the study Types of herd
Breeding herd Nursery-grow-finish-herd Total
Clinical signs
Total
Outbreak
Recrudescent
Endemic
None
50 (22.1%) 42 (18.6%) 92 (40.7%)
76 (33.6%) 15 (6.6%) 91 (40.2%)
13 (5.8%) 17 (7.5%) 30 (13.3%)
1 (0.4%) 12 (5.3%) 13 (5.7%)
140 (62%) 86 (38%) 226 (100%)
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
7
Fig. 1. Amino acid sequence of the major envelope (E) protein of the Que´bec reference PRRSV isolate LHVA-93-3. Amino acid substitutions and respective number of PRRSV strains showing these substitutions are indicated below each amino acid position.
3.4. Phylogenetic and epidemiological analyses The phylogenetic tree resulting from the analysis of 250 nucleotide sequences of the PRRSV ORF5 gene is shown in Fig. 2. In the phylogenetic tree, 44 groupings
comprising two to 23 strains each were identified. To consider a relationship between strains, the homology had to be equal to or greater than 98%. The cut-off point of 98% homology to consider that two strains were closely related was chosen at posteriori. It was selected
8
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
Fig. 1 (Continued)
because when a confirmed epidemiological link was observed, such as the introduction of PRRSV positive animals into a previously negative herd, the homology was equal to or greater than 98%. On the other hand, a homology of less than 92% was often observed when no relationship could be found. We did not consider groupings with a homology between 92 and 98%, which might have lead to an overestimate of associations. From the 250 sequences, 183 strains (73%) could be included in one of these 44 groupings. The data collected from the questionnaires were used to establish epide-
miological links between strains within groupings. However, no similar data were available for the reference strains. The relationship between strains within a grouping could be attributed to a variety of reasons (Table 3). For some groupings, a single relationship was identified, whereas for others, a combination of relationships was found. These suspected relationships were (a) the introduction of piglets (e.g. groupings 6, 19, 28, 34, 37), (b) the introduction of replacement gilts (e.g. groupings 27, 30), (c) the same herd of origin (e.g. eight
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
9
Fig. 2. A phylogenetic tree based on 250 nucleotide sequences of the ORF5 gene of PRRSV. An unrooted neighbor-joining tree was constructed from the aligned nucleic acid sequences. Reference strains (21) and sequences from GenBank (three) are indicated by asterisks. Groupings of similar strains (homology equal to or greater than 98%) are indicated by a brace and are numbered in increasing order.
10
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
Fig. 2 (Continued)
strains from grouping 39), (d) the same site of production with different employees working in the different buildings (e.g. strains from grouping 26), and (e) fomites such as a contaminated truck infecting PRRSV negative
piglets (two strains in grouping 29), possibly boots of employees working on different sites (two strains in grouping 3) and of an employee loading piglets in a vehicle (two strains in grouping 36). For 60 strains, the
R. Larochelle et al. / Virus Research 96 (2003) 3 /14 Table 3 Suspected relationships between strains within groupings Relationship
Number of strainsa
Introduction of piglets Introduction of replacement gilts Same herd of origin Same site of production Fomites
24 11 25 7 6
Area spread Distance between farms B/3 km: different ownership Distance between farms B/3 km: same ownership Distance between farms /3 and B/10 km: different ownership Distance between farms /3 and B/10 km: same ownership Distance /10 and B/30 km Same organization Vaccine-like Unknown
15 9 14 8 14 29 25 16
a Numbers do not add up to 183 because some strains were involved in more than one relationship.
link between strains was the geographic area, that is the location of the herds from which originated the strain. The distribution of these strains according to the distance between farms and ownership is indicated in Table 3. For 29 strains, the only association between strains within a grouping was that they originated from different herds belonging to the same organization without being able to specify any further a precise relationship. For 16 strains no relationship could be identified, some grouped together and others scattered in different groupings. The vaccine-like strains were in two groupings, one with 23 strains including RespPRRS/Repro vaccine and the parental strain ATCC-VR2332 (grouping 42), and the other one composed of only two strains including PRRS ATP vaccine (grouping 41). In nine cases, the animals submitted had been vaccinated 3/122 days earlier with an average of 24 days (aged 49 /154 days) and in three of these cases, a field strain was identified shortly after in the herd. In another two cases, the animals although not vaccinated themselves, came from vaccinated herds. For the additional 11 cases, there was no vaccination program for PRRS in the herd. In this latter group, the strains were from pigs aged an average of 93 days and originating from nine finishing and two nursery barns in which only mild (three cases) or no clinical signs (eight cases) were observed. In five of these cases, vaccination of sows had been stopped 1/1.5 year earlier. In 41 herds, more than one strain (2 /8) was identified either from the same submission or from different samples submitted over a period of time varying from
11
3 months to 4 years. The homology between different strains was generally less than 95% except in four cases for which it was between 96 and 97.2%. Strains were considered similar with a homology equal to or greater than 98% and otherwise, different. For the majority of the 41 herds (83%), the strains identified were different. In most of these cases the attending veterinarians had reported a recrudescence of reproductive problems or a second outbreak of PRRS. In 28 herds, the different strains were identified from cases submitted at an average interval of 18.5 months (3 /48). However, in half of these herds, the interval between submissions was 1 year or less and could be as less as 3 months. In two herds, two different strains were recovered simultaneously from samples of two different animals examined. In another two herds, which had submitted three samples over time, one of the three strains was different from the other two and in another two herds three different strains were identified. Similar strains were identified from different submissions over time in seven herds, including eight strains originating from a single farm over a period of 3.5 years. In addition, 15 strains originated from 15 barns located on five different sites. These barns were considered as different herds even though they were located on the same site. More than half of the strains were different within a site.
4. Discussion The present study was undertaken to evaluate the molecular diversity of PRRSV field strains in Que´bec and combine sequencing, phylogenetic and epidemiological data in an attempt to better understand the mechanisms of virus transmission between herds and temporal variation of strains. Our results from the genomic analysis of 250 PRRSV strains suggest that the variability of PRRSV ORF5 is greater than previously reported, with 59% of amino acids positions being polymorphic compared with 38% in a study of 55 US PRRSV strains (Goldberg et al., 2000a). The present study has also shown that the two potential glycosylation sites N44 and N51 were not absolutely conserved, in contrast with what was previously reported (Andreyev et al., 1997). Finally, in the 242 Que´bec strains analyzed, the predominant amino acid residue found at position 151 was lysine. This contrasts with previous studies involving US isolates in which arginine was reported to be the predominant amino acid at this position (Andreyev et al., 1997; Yang et al., 1998; Wesley et al., 1999; Key et al., 2001). The high degree of polymorphism found in Que´bec strains suggests that PRRSV is continuously evolving over time.
12
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
RFLP patterns can be used to distinguish the RespPRRS vaccine from other vaccine or field strains (Wesley et al., 1998). However, care should be taken in their interpretation since similar strains can have different RFLP patterns and conversely, strains with the same RFLP pattern, for example the 1-8-4 pattern in our study, can be quite different (e.g. 88% homology) and found in different groupings throughout the phylogenetic tree. In a recent study of 254 PRRSV strains from Ontario, a neighbor province of Que´bec, the most common RFLP pattern was the 2-5-2 vaccine pattern which was identified in 33% of the cases (Cai et al., 2002). In contrast, in the present study, this pattern was only detected in 9% of the cases. RFLP patterns intermediate to 2-5-2 have been frequently found in US (Wesley et al., 1999) and Ontario (Cai et al., 2002) whereas only one Que´bec strain had an intermediate 15-2 pattern. In our study the 1-8-4 and 1-4-4 patterns were predominant and represented 28 and 16% of strains, respectively. Surprisingly the 1-8-4 pattern was not detected in Ontario and the 1-4-4 pattern was identified in only 1.6% of the 254 typeable cases analyzed. Numerous additional RFLP patterns based on the HincII restriction site were identified in the present study and not in Ontario. Our global above findings derived from the molecular analysis of 226 PRRSV strains suggest that PRRSV circulating in Que´bec represent a different sub-population of strains. In the present study most of the PRRS cases submitted by veterinarians were in autumn and winter particularly between the months of November and April. This seasonal distribution of PRRS submissions could reflect an increased risk of infection during the autumn and winter. It has been shown that certain modes of transmission are favored according to the season: transmission by fomites is easier during cold winter, whereas transmission by avian species and mosquitoes would be more likely facilitated during warmer months (Zimmerman et al., 1997; Dee et al., 2002; Otake et al., 2002c). Because of the geographical situation of Que´bec and the associated climatic conditions, transmission via mosquitoes would not represent a major route of PRRSV transmission in this province. Birds cannot be considered either as an important factor in the transmission of PRRSV since all the herds were in total confinement and most buildings that were naturally ventilated, were bird-proof. In our study, the predominant relationships between strains within the different groupings identified from the phylogenetic tree were the introduction of infected animals and area spread. In our study, 11 and 9 outbreaks were attributed to the introduction of infected piglets (24 strains) and replacement gilts (11 strains), respectively. In these latter cases, clinical signs were generally observed 2/3 weeks after the introduction of animals, however, this period varied according to the
type of animal flow and the duration and type of the quarantine. There were also some outbreaks for which the suspected source of contamination was attributed to fomites. In one instance, two herds located 2.9 km apart had the same employees. In another case, contamination of piglets during transport was involved. Naı¨ve piglets were transported in a vehicle in which PRRSV positive piglets had been transported earlier in the day without being washed and disinfected. In a third situation, a driver, who had just taken PRRSV positive piglets into his truck, had access to the pig loading area of a previously naı¨ve herd. In this case, aerosol from the truck containing infected piglets cannot be excluded. The above results support that transport vehicles and their drivers, as well as employees represent a risk in the transmission of PRRSV (Dee et al., 2002). The link between strains obtained from herds located within the same site of production was to be expected. Although aerosol transmission between buildings cannot be ruled out, there is an increased risk of infection via fomites and movement of employees and personal within an organization. However, in more than half of the cases, different strains were identified indicating that it is essential to maintain biosecurity measures between buildings to avoid mechanical transmission and introduction of a different strain. Area spread, which is herd-to-herd transmission without any apparent pig or human contact, can be attributed to aerosol of infectious PRRSV traveling downwind (airborne transmission), to mammalian, avian or insect vectors (mechanical or biological), or to contaminated fomites. Area transmission was strongly suspected for several strains which originated from herds belonging to different ownerships. In 40% of our cases from which an area spread was suspected, herds were located within 3 km from one another and in 37% of the cases herds were between 3 and 10 km apart. Le Potier et al. (1997) found that 45% of herds suspected to have become infected through area spread were located within 500 m of the source herd and 2% within 1 km. More recently, however, Lager et al. (2002) reported the occurrence of PRRS in seven herds located fairly closely (1 /13 km) except for one farm (33 km). They suggested an area spread without precisely knowing the method of virus transmission. Similarly, Mortensen et al. (2002) reported that having a herd located within 3 km of an infected herd increases the risk of infection by PRRSV. It was not possible from our data to determine a specific distance at which the risk of transmission is greatly increased since most of the herds were located in a high density area with often additional surrounding farms for which the health status was unknown. Although the precise modes of transmission for area spread are unknown, aerosol transmission can be
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
suspected in several of our cases. Nearly half of the cases for which an area spread was suspected belonged to different owners with different feed providers, technical support teams and sources of animals, thereby decreasing the likelihood of transmission by vehicles and other fomites. Moreover, in some groupings, even the artificial insemination centers providing semen were different. The artificial insemination centers used for the farms were PRRSV negative. For herds belonging to the same organization, aerosol transmission is more difficult to prove since the virus can be introduced into a herd through a common source of animals or mechanical vectors from feed trucking, technical services or other fomites. The literature on the possibility of airborne transmission is controversial. Torremorell et al. (1997) were able to demonstrate aerosol transmission over a short distance of 1 m in only one of two experimental infections. They suggested that this type of transmission appeared to be strain dependent. Brockmeier and Lager (2002) also demonstrated airborne transmission of PRRSV over short distances in most but not in all trials performed in their experimental study. However, Mortensen et al. (2002) concluded from their nested casecontrol study that PRRSV spread by aerosol is a frequent mode of transmission. Our data indicate that a PRRSV strain can persist in a herd up to 3.5 years displaying as little as 2% variation in ORF5 during this time span. In this farrow-to-finish herd, problems were endemic. On the other hand, in 78% of the herds with several submissions over time, genetically different strains were identified, often within a 1-year interval, causing a recrudescence of clinical signs, which often appeared to be moderate to severe. These results would corroborate those of Mengeling et al. (2003) who suggested that a pig’s immune response to PRRSV has some degree of strain specificity. The introduction of a different strain in a herd seemed to be a more frequent event than persistence of one strain undergoing mutations over time. Finally, we found that different strains may coexist on one farm, which may represent an increased risk of recombination and generation of new strains. In our study, a vaccine strain was identified in only 10% of the cases even though in 26% of the cases the animals submitted had been vaccinated and 69% of the cases came from vaccinated herds, confirming that field strains replicate more actively in pigs than an attenuated vaccine strain. Nearly 40% of the animals from which a vaccine strain was recovered had been vaccinated from 3 to 122 days before submission. Following an experimental study it has been reported that vaccine can persist as long as virulent field strains in adult swine (Mengeling et al., 1996). Moreover, vaccine virus can be transmitted from vaccinated to naive pigs (Botner et al., 1997; Mengeling et al., 1998; Mortensen et al., 2002). This could also explain the circulation of a vaccine
13
strain within herds, up to 1.5 years after the cessation of PRRS vaccination. Finally, results from this study have also provided valuable information to the attending veterinarians. Biosecurity rules were reassessed on many farms as well as movement of pigs and transport of animals. Being able to more concretely identify the source of infection was a powerful tool for continuing education for employees, owners and swine specialists as it has heightened awareness of the importance of biosecurity measures.
Acknowledgements We are grateful to B. Delisle and D. Longtin for their excellent technical work and to all participating veterinarians for their time and efforts in selecting and submitting samples. We also thank all industrial partners for their financial participation over the years. The project was made possible through the Matching Investment Initiative program of the Canadian Food Inspection Agency.
References Andreyev, V.G., Wesley, R.D., Mengeling, W.L., Vorwald, A.C., Lager, K.M., 1997. Genetic variation and phylogenetic relationships of 22 porcine reproductive and respiratory syndrome virus (PRRSV) field strains based on sequence analysis of open reading frame 5. Arch. Virol. 142, 993 /1001. Benfield, D.A., Collins, J.E., Dee, S.A., Halbur, P.G., Joo, H.S., Lager, K.M., Mengeling, W.L., Murtaugh, M.P., Rossow, K.D., Stevenson, G.W., Zimmerman, J.J., 1999. Porcine reproductive and respiratory syndrome. In: Straw, B.E., D’Allaire, S., Mengeling, W.L., Taylor, D.J. (Eds.), Diseases of Swine, eighth ed. Iowa State University Press, Ames, pp. 201 /232. Botner, A., Strandbygaard, B., Sorensen, K.J., Have, P., Madsen, K.G., Madsen, E.S., Alexandersen, S., 1997. Appearance of acute PRRS-like symptoms in sow herds after vaccination with a modified-live PRRS vaccine. Vet. Rec. 141, 497 /499. Brinton, M.A., Godeny, E.K., Horzinek, M.C., Meulenberg, J.J.M., Murtaugh, M.P., Plagemann, P.G.M., Snijder, E.J., 2000. Arteriviridae. In: van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy, Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, pp. 851 / 857. Brockmeier, S.L., Lager, K.M., 2002. Experimental airborne transmission of porcine reproductive and respiratory syndrome virus and Bordetella bronchiseptica . Vet. Microbiol. 89, 267 /275. Cai, H.Y., Alexander, H., Carman, S., Lloyd, D., Josephson, G., Maxie, M.G., 2002. Restriction fragment length polymorphism of porcine reproductive and respiratory syndrome viruses recovered from Ontario farms, 1998 /2000. J. Vet. Diagn. Invest. 14, 343 / 347. Dee, S., Deen, J., Rossow, K., Wiese, C., Otake, S., Joo, H.S., Pijoan, C., 2002. Mechanical transmission of porcine reproductive and
14
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
respiratory syndrome virus through a coordinated sequence of events during cold weather. Can. J. Vet. Res. 66, 232 /239. Goldberg, T.L., Hahn, E.C., Weigel, R.M., Scherba, G., 2000a. Genetic, geographical and temporal variation of porcine reproductive and respiratory syndrome virus in Illinois. J. Gen. Virol. 81, 171 /179. Goldberg, T.L., Weigel, R.M., Hahn, E.C., Scherba, G., 2000b. Associations between genetics, farm characteristics and clinical disease in field outbreaks of porcine reproductive and respiratory syndrome virus. Prev. Vet. Med. 43, 293 /302. Kapur, V., Elam, M.R., Pawlovich, T.M., Murtaugh, M.P., 1996. Genetic variation in porcine reproductive and respiratory syndrome virus isolates in the midwestern United States. J. Gen. Virol. 77, 1271 /1276. Key, K.F., Haqshenas, G., Guenette, D.K., Swenson, S.L., Toth, T.E., Meng, X.-J., 2001. Genetic variation and phylogenetic analyses of the ORF5 gene of acute porcine reproductive and respiratory syndrome virus isolates. Vet. Microbiol. 83, 249 /263. Lager, K.M., Mengeling, W.L., Wesley, R.D., 2002. Evidence for local spread of porcine reproductive and respiratory syndrome virus. J. Swine Health Prod. 10, 167 /170. Le Potier, M.-F., Blanquefort, P., Morvan, E., Albina, E., 1997. Results of a control program for the porcine reproductive and respiratory syndrome in the French ‘‘Pays de la Loire’’ region. Vet. Microbiol. 55, 355 /360. Meng, X.J., 2000. Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet. Microbiol. 74, 309 /329. Meng, X.-J., Paul, P.P., Halbur, P.G., Morozov, I., 1995. Sequence comparison of open reading frames 2 to 5 of low and high virulence United States isolates of porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 76, 3181 /3188. Mengeling, W.L., Vorwald, A.C., Lager, K.M., Brockmeier, S.L., 1996. Comparison among strains of porcine reproductive and respiratory syndrome virus for their ability to cause reproductive failure. Am. J. Vet. Res. 57, 834 /839. Mengeling, W.L., Lager, K.M., Vorwald, A.C., 1998. Clinical effects of porcine reproductive and respiratory syndrome virus on pigs during the early postnatal interval. Am. J. Vet. Res. 59, 52 /55. Mengeling, W.L., Lager, K.M., Vorwald, A.C., Koehler, K.J., 2003. Strain specificity of the immune response of pigs following vaccination with various strains of porcine reproductive and respiratory syndrome virus. Vet. Microbiol. 93, 13 /24. Meulenberg, J.J.M., Petersen-den Besten, A., De Kluyver, E.P., Moorman, R.J.M., Schaaper, W.M.M., Wensvoort, G., 1995. Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206, 155 /163. Mortensen, S., Stryhn, H., Sogaard, R., Boklund, A., Stark, K.D.C., Christensen, J., Willeberg, P., 2002. Risk factors for infection of sow herds with porcine reproductive and respiratory syndrome (PRRS) virus. Prev. Vet. Med. 53, 83 /101. Murtaugh, M.P., Faaberg, K.S., Laber, J., Elam, M., Kapur, V., 1998. Genetic variation in the PRRS virus. Adv. Exp. Med. Biol. 440, 787 /794.
Murtaugh, M.P., Yuan, S., Faaberg, K.S., 2001. Appearance of novel PRRSV isolates by recombination in the natural environment. Adv. Exp. Med. Biol. 494, 31 /36. Nicholas, K.B., Nicholas, H.B. Jr., 1997. GENEDOC: a tool for editing and annotating multiple sequence alignments. Distributed by the authors. Otake, S., Dee, S.A., Rossow, K.D., Deen, J., Joo, H.S., Molitor, T.W., Pijoan, C., 2002a. Transmission of porcine reproductive and respiratory syndrome virus by fomites (boots and coveralls). J. Swine Health Prod. 10, 59 /65. Otake, S., Dee, S.A., Rossow, K.D., Joo, H.S., Deen, J., Molitor, T.W., Pijoan, C., 2002b. Transmission of porcine reproductive and respiratory syndrome virus by needles. Vet. Rec. 150, 114 /115. Otake, S., Dee, S.A., Rossow, K.D., Moon, R.D., Pijoan, C., 2002c. Mechanical transmission of porcine reproductive and respiratory syndrome virus by mosquitoes, Aedes vexans (Meigen). Can. J. Vet. Res. 66, 191 /195. Rowland, R.R.R., Steffen, M., Ackerman, T., Benfield, D.A., 1999. The evolution of porcine reproductive and respiratory syndrome virus: quasispecies and emergence of a virus subpopulation during infection of pigs with VR-2332. Virology 259, 262 /266. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876 /4882. Torremorell, M., Pijoan, C., Janni, K., Walker, R., Joo, H.S., 1997. Airborne transmission of Actinobacillus pleuropneumoniae and porcine reproductive and respiratory syndrome virus in nursery pigs. Am. J. Vet. Res. 58, 828 /832. Wesley, R.D., Mengeling, W.L., Lager, K.M., Clouser, D.F., Landgraf, J.G., Frey, M.L., 1998. Differentiation of a porcine reproductive and respiratory syndrome virus vaccine strain from North American field strains by restriction fragment length polymorphism analysis of ORF5. J. Vet. Diagn. Invest. 10, 140 /144. Wesley, R.D., Mengeling, W.L., Lager, K.M., Vorwald, A.C., Roog, M.B., 1999. Evidence for divergence of restriction fragment length polymorphism patterns following in vivo replication of porcine reproductive and respiratory syndrome virus. Am. J. Vet. Res. 60, 463 /467. Yang, S.X., Kwang, J., Laegreid, W., 1998. Comparative sequence analysis of open reading frames 2 to 7 of the modified live vaccine virus and other North American isolates of the porcine reproductive and respiratory syndrome virus. Arch. Virol. 143, 601 /612. Yoon, K.-J., Chang, C.-C., Zimmerman, J., Harmon, K., 2001. Genetic and antigenic stability of PRRS virus in pigs. Adv. Exp. Med. Biol. 494, 25 /30. Yuan, S., Nelsen, C.J., Murtaugh, M.P., Schmitt, B.J., Faaberg, K.S., 1999. Recombination between North American strains of porcine reproductive and respiratory syndrome virus. Virus Res. 61, 87 /97. Zimmerman, J.J., Yoon, K.-J., Pirtle, E.C., Wills, R.W., Sanderson, T.J., McGinley, M.J., 1997. Studies of porcine reproductive and respiratory syndrome (PRRS) virus infection in avian species. Vet. Microbiol. 55, 329 /336.
Molecular epidemiology of porcine reproductive and respiratory syndrome virus (PRRSV) in Que´bec Rene´e Larochelle a,*, Sylvie D’Allaire b, Ronald Magar a a
Laboratoire d’hygie`ne ve´te´rinaire et alimentaire, Agence canadienne d’inspection des aliments, 3400 Casavant ouest, St-Hyacinthe, Que´bec, Canada J2S 8E3 b Faculte´ de me´decine ve´te´rinaire, Universite´ de Montre´al, C.P. 5000, St-Hyacinthe, Que´bec, Canada J2S 7C6 Received 24 March 2003; received in revised form 30 May 2003; accepted 30 May 2003
Abstract Porcine reproductive and respiratory syndrome virus (PRRSV) strains identified in samples from 226 field cases originating from Que´bec herds and submitted over a 4-year period (March 1998 /July 2002) were studied. Sequencing of PRRSV strains was performed on the ORF5 gene amplified product and restriction fragment length polymorphism (RFLP) patterns for enzymes MluI, HincII and SacII were determined on these sequences. Twenty-four other PRRSV isolates including three vaccine strains were also included for comparison purposes and the total of 250 PRRSV strains were used in a phylogenetic analysis. Clinical and epidemiological data were collected through a questionnaire for each of the submitted field cases. About 75% of the cases were submitted during autumn and winter. Over 60% of the cases were submitted for reproductive problems, 33% for respiratory problems and 6% for increased PRRSV serological titers in the herd in absence of clinical signs. In 69% of the cases there was a PRRS vaccination program for the herd. However, only 26% of the animals from which samples were obtained had been vaccinated themselves. The genomic analysis of this large number of strains revealed a great variability of PRRSV ORF5 with 59% of amino acid positions being polymorphic. A total of 29 RFLP patterns were obtained. The main RFLP patterns obtained were 1-8-4 (28%), 1-4-4 (16%), 1-2-4 (9%) and 1-11-4 (9%). The global findings derived from the molecular analysis of 226 PRRSV strains suggest that PRRSV circulating in Que´bec represent a different sub-population of strains. Vaccine-like strains were identified in 10% of the cases. A phylogenetic tree enabled the identification of 44 groupings comprising two to 23 strains each. Of the 250 sequences analyzed, 183 (73%) could be included in one of these groupings. The data collected from the questionnaires were used to establish epidemiological links between strains within groupings. The main relationships between strains within a grouping were the introduction of infected animals (19%) and area spread (33%). In 40% of the cases from which an area spread was suspected, herds were located within 3 km from another. Aerosol transmission was suspected in several cases, more than half of which belonged to different owners. In 41 herds, more than one strain (2 /8) were identified over a period varying from 3 months to 4 years. Data indicated that a PRRSV strain can persist in a herd up to 3.5 years displaying as little as 2% variation in ORF5 during this time. In 78% of the herds with multiple submissions genetically different strains were identified; often within 1 year of the original identification. These genetically distinct strains were often associated with a recrudescence of moderate to severe clinical signs. Coexistence on the same farm of different PRRSV strains was also observed. # 2003 Elsevier B.V. All rights reserved. Keywords: Porcine reproductive and respiratory syndrome virus; Epidemiology; ORF5 sequences; Phylogenetic analysis
1. Introduction Porcine reproductive and respiratory syndrome (PRRS) is a worldwide recognized disease with impor-
* Corresponding author. Tel.: /1-450-773-7730; fax: /1-450-7738152. E-mail address: [email protected] (R. Larochelle). 0168-1702/03/$ - see front matter # 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0168-1702(03)00168-0
tant economic impact on swine industry. The disease is characterized by reproductive problems such as abortions, farrowing of dead or weak piglets, high preweaning mortality and mortality in sows. In weaned and grower pigs, pneumonia, failure to thrive and an increase in concurrent bacterial infection are observed (reviewed in Benfield et al., 1999). The PRRS virus (PRRSV) is an enveloped positive strand RNA virus
4
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
classified in the Arteriviridae family (Brinton et al., 2000). The first two open reading frames (ORF1a and 1b) of the 15 kb genome encode the viral polymerase. The ORF2, ORF3, ORF4 encode envelope proteins, the functions of which are not fully understood. The ORFs 5, 6 and 7 encode major structural envelope (E), membrane (M) and nucleocapsid (N) proteins, respectively (Meulenberg et al., 1995). Several studies have demonstrated that PRRSV strains from US are genetically highly variable particularly at the level of the E glycoprotein (Meng et al., 1995; Kapur et al., 1996; Andreyev et al., 1997; Murtaugh et al., 1998; Goldberg et al., 2000a). In a genomic comparison of ORFs 2/5 from five US PRRSV strains of different virulence, Meng et al. (1995) could not find any correlation between sequence variation and PRRSV virulence. In a recent study, data derived from ORF5 gene sequences of US isolates suggested that the manifestation of high mortality in sows in some outbreaks of PRRSV was under genetic influence (Goldberg et al., 2000b). In contrast, the genetic comparison of the ORF5 of eight PRRSV strains identified from herds experiencing severe acute PRRSV showed that these isolates actually differed from each other (Key et al., 2001). It has been suggested that genomic variation of PRRSV could occur not only by the accumulation of random mutations but also by intragenic recombinations (Kapur et al., 1996; Yuan et al., 1999; Meng, 2000; Murtaugh et al., 1998, 2001; Yoon et al., 2001) and quasispecies evolution (Rowland et al., 1999). The genetic diversity of PRRSV has implications for the control of the disease, and the use of genomic characterization in combination with epidemiological data may help to improve understanding regarding the routes of transmission of this virus between herds and the temporal variation of strains. In a study of 55 field isolates from Illinois and Iowa, Goldberg et al. (2000a) examined the ORF5 genomic variations between strains in regards with the geographical distance between farms. They found no correlation between the geographical proximity of PRRSV isolates and their genomic similarity, suggesting that PRRSV typically moves between farms via long-distance processes such as transport of animals or semen rather than via distance-limited processes such as wind or wild-life vectors. In contrast, area spread of PRRSV among a few farms unassociated with direct transmission by pigs or indirect transmission by humans or fomites was recently reported (Lager et al., 2002). Although experimentally airborne transmission (Torremorell et al., 1997; Brockmeier and Lager, 2002), biological (Zimmerman et al., 1997; Otake et al., 2002c) or mechanical vectors and fomites (Dee et al., 2002; Otake et al., 2002a,b) have been proposed as mechanisms of PRRSV spread, field studies addressing
these mechanisms of transmission have been few (Le Potier et al., 1997; Mortensen et al., 2002). The present study was conducted to gather knowledge on the genomic variability of PRRSV strains circulating in Que´bec herds and to identify possible relationships between PRRSV strains using epidemiological data and a phylogenetic analysis, with the hope of better understanding some of the factors involved in virus spread between herds and the temporal variation of strains.
2. Materials and methods 2.1. Case submissions and data collection PRRSV strains identified in samples from 226 field cases originating from Que´bec herds and submitted over a 4-year period (March 1998/July 2002) were studied. Most cases were from herds experiencing reproductive and respiratory disease compatible with PRRS. In breeding herds, the reproductive problems were characterized by anorexia in sows, abortions, stillborn and weak piglets, an increased mortality in nursing piglets and sows, and a lower farrowing rate. The clinical signs most frequently observed in suckling piglets included emaciation, anorexia, hyperpnea, dyspnea and chemosis. In nursery and grower pigs, the most common clinical signs were anorexia, lethargy, hyperpnea and dyspnea. Some cases originated from herds without any clinical signs in which a serological evaluation revealed increased titers to PRRSV. Blood and/or lung and lymph nodes tissue samples were collected from nursery-grower pigs with clinical signs, and in breeding herds from suckling piglets with respiratory problems or from weak-born piglets aged less than 48 h. A questionnaire, one for reproductive disease in the sow herd or one for respiratory disease in nurserygrower pigs, was filled out by the attending veterinarian for each submitted case. The questionnaires allowed to gather information on the clinical signs observed in the herd and in the animals from which tissues were submitted, the onset and duration of clinical signs, whether the PRRS problem was endemic or epidemic, and if so, whether it was a new or a recrudescent problem in the herd, location of farm, type of production, herd size, animal flow, source of animals, PRRSV vaccination status, suspected cause of contamination for new outbreaks and distance from neighbouring farms. Distance between farms were further investigated in some cases. When distance was suspected to be shorter than 10 km, a global positioning system (GPS) receiver (Magellan GPS 315, San Dimas, CA, USA) was used to obtain a more precise estimate of distance between farms. For some herds, more than one case was submitted. To consider a multiple submission to originate from the
R. Larochelle et al. / Virus Research 96 (2003) 3 /14 Table 1 Restriction sites and number designating the cut pattern for HincII in PRRSV ORF5 Number
Restriction sites
Study
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
Not cut 87 218 87, 218 359 87, 359 87, 218, 359 87, 218, 380 380 218, 380 87, 380 87, 218, 359, 218, 359 87, 218, 290, 87, 172, 218, 87, 218, 380, 87, 218, 507 99
Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Wesley et al., Present study Present study Present study Present study Present study Present study Present study Present study Present study Present study
380 380 380 501
1998 1998 1998 1998 1998 1998 1998 1998
same herd, a herd was defined as a single site with any type of production which was run on a continuous flow basis at the barn level. This excluded nurseries and finishing barns that either were run on an all-in all-out fashion or were off-site from the breeding herd. It also excluded sites on which there were more than one breeding herd. Other PRRSV isolates were also included for comparison purposes in the genomic and phylogenetic analysis: 16 from Que´bec field cases of previous years (1992 /1997), four from field cases from other Canadian provinces (1990 /1994), three vaccine strains (Ingelvac RespPRRS/ReproTM and Ingelvac PRRS ATP from Boehringer Ingelheim, St. Joseph, MO, USA; Prime Pac† PRRS, Schering Plough Animal Health, Omaha, NE, USA) and one US strain (ATCC-VR2332). These isolates were referred to as the reference strains. 2.2. Polymerase chain reaction (PCR) Fresh tissues and blood or serum samples were obtained. Serum was separated from blood samples by centrifugation and stored at /70 8C. Lung and lymph nodes homogenates were prepared (20% in minimum essential medium), clarified by centrifugation and frozen at /70 8C. Total RNA was extracted from 250 ml of serum or tissue homogenates using TRIZOL LS reagent (Canadian Life Technologies, Burlington, Ontario, Canada). Reverse transcription was carried out using the Superscript II (Canadian Life Technologies) and random primers (Roche Diagnostics, Laval, Que´bec, Canada). Polymerase chain reaction (PCR) was per-
5
formed to amplify the ORF 5 using the following pairs of primers: 5FN: 5? ATGTTGGGGAAATGCTTGACC 3? with 5DN: 5? GTTCCGCTGAAACTCTGGTTA 3? and primers published by Andreyev et al. (1997). For the PCR reaction using primers 5FN / 5DN, 2 ml of cDNA was added to a PCR mixture with final concentrations of 1.50 mM MgCl2, 1 /PCR buffer, 0.2 mM each dNTP, 1 mM each primer and 2.5 U of Taq DNA polymerase (Canadian Life Technologies) per 50 ml. Amplification was achieved by 35 cycles of denaturing at 95 8C for 1 min, annealing at 60 8C for 1 min and extension at 72 8C for 1 min. The PCR reaction using the other pair of primers was the same with the exception of the annealing which was performed at 55 8C. The PCR was ended with a final extension step of 10 min at 72 8C.
2.3. Sequencing and phylogenetic analyses The ORF5 region of a total of 247 PRRSV strains including the PRRS ATP vaccine strain was sequenced. Before sequencing, PCR products were purified using a commercial kit according to the manufacturer’s instructions (QIAquick PCR purification kit, Qiagen Inc., Mississauga, Ontario, Canada). Purified PCR products were sequenced in both directions using standard automated sequencing methods (University Core DNA Sequencing Laboratory, University of Calgary, Calgary, Alberta and Universite´ Laval, Que´bec, Canada). In addition to the above, sequences from two vaccine strains, RespPRRS and PrimePac, and from the US strain ATCC-VR2332 (GenBank accession numbers AF066183, AF066384 and U87392, respectively) were added in the phylogenetic analysis. The nucleotide sequences were aligned using the CLUSTALW 1.8 multiple sequence alignment program (Thompson et al., 1997). The alignment was visualized using GENEDOC 2.5 package (Nicholas and Nicholas, 1997). The phylogenetic analysis was performed on the aligned data set and an unrooted tree was constructed using the distancebased neighbor-joining method with and without correction for multiple substitutions. All programs were part of the CLUSTAL X package. Clusters or groupings of similar sequences were examined in regards to the clinical and epidemiological data. The restriction fragment length polymorphism (RFLP) patterns for enzymes MluI, HincII and SacII (Wesley et al., 1998) were determined on the sequences using the WEBCUTTER 2.0 program. For the enzyme HincII, other restriction sites in addition to the ones described by Wesley et al. (1998) were observed and were designated by increasing numbers in the course of their occurrence (Table 1).
6
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
3. Results 3.1. General characteristics of the cases The 226 field cases originated from 174 herds. In 41 herds, several samples were submitted over time. About 75% of the cases were submitted during autumn and winter, from November through April. Nearly 2/3 of the cases (61.5%) were submitted for reproductive problems, 32.7% for respiratory problems and 5.7% because increased PRRSV serological titers, in absence of clinical signs, had been detected in the herd (Table 2). Most of the problems in the herds were presented as an outbreak or a recrudescence of clinical signs associated with PRRS. In submissions from nursery-grow-finishing stage, endemic cases were mostly observed in farrow-tofinish operations, whereas the epidemic forms were mainly reported from nursery or finishing operations which were more often run in an all-in all-out fashion at the room or barn level. The size of the breeding herds varied from 100 to 2400 sows with an average of 610 sows. The average inventory of the nursery and growing-finishing barns was 1680 and 2010 animals, with a range of 250/3600 and 500 /8000, respectively. All the herds were kept in total confinement. In 69% of the cases there was a PRRS vaccination program for the herd. This proportion varied according to the type of operation, with 84% in breeding herds compared with 42% in nursery-grow-finish units. Also, 26% of the submitted animals were vaccinated for PRRSV, with a proportion of 21% in animals from breeding herds and 36% in pigs from nursery-grow-finish herds. 3.2. Genomic analysis Sequence analysis of the ORF5 of the 250 PRRSV strains revealed that they all had the same size of 603 nucleotides with the exception of three strains which had 600 nucleotides, having a deletion of three nucleotides at positions 97 /99. Thus the E protein amino acid sequence for each strain consisted of 200 residues, except for three strains that had a deletion of one amino acid at residue 33. Pairwise comparison of all strains showed that the homology between strains ranged from 84 to 100% for the nucleic acids and 78.5 /100% at the
amino acid level. Thus ORF5 displayed considerable genetic variation, 310/603 (51%) of the nucleic acid positions and 117/200 (59%) of the amino acid positions being polymorphic (Fig. 1). In addition to the variability observed in the N-terminal region (residue 1/31, putative signal peptide sequence), two hypervariable regions were identified in the ectodomain (aa 32/35 and 57 /61) with positions 32/35 corresponding to potential glycosylation sites. The N-glycosylation sites at position 44 and 51 were relatively well conserved with a few strains only showing amino acids substitutions (aspartic acid, tyrosine, histidine). Moderately conserved regions were located at positions 40 /56, 62 /89, 107 /120 and 129 /150. At position 151, two vaccine-like strains conserved the glycine residue typical of the RespPRRS vaccine while the others contained an arginine at this position. Nearly 80% of the field strains had a lysine residue at position 151, followed in decreasing frequency by arginine, asparagine and glutamic acid. The Cterminal region was also found to contain various amino acid substitutions. All PRRSV strains identified belonged to the North American genotype.
3.3. RFLP patterns A total of 29 RFLP patterns were obtained. The main RFLP patterns obtained were the followings: 1-8-4 (28%), 1-4-4 (16%). 1-2-4 (9%), 1-11-4 (9%), 1-10-4 (4%), 1-12-4 (4%), 1-8-3 (4%) and 1-8-2 (3%). Vaccinelike strains were identified in 10% of the cases. Twentyone strains were grouped with the US-VR2332 and the RespPRRS vaccine strain. When compared with this vaccine, these strains demonstrated a homology greater than 98.5%. Of these 21 strains, 20 demonstrated the characteristic 2-5-2 RFLP vaccine pattern and one strain showed a 1-5-2 intermediate pattern. One strain having the 1-4-2 pattern was closely related to the PRRS ATP vaccine strain (99.8% homology). In addition to the above described RFLP patterns, 18 other patterns were determined for the 14% remaining strains: 1-1-3, 11-4, 1-2-2, 1-3-3, 1-3-4, 1-4-3, 1-6-2, 1-9-3, 1-10-1, 1-112, 1-14-4, 1-15-1, 1-15-2, 1-15-4, 1-16-3, 1-16-4, 1-17-4 and 1-18-4.
Table 2 Types of herds and clinical signs involved in the 226 field cases of the study Types of herd
Breeding herd Nursery-grow-finish-herd Total
Clinical signs
Total
Outbreak
Recrudescent
Endemic
None
50 (22.1%) 42 (18.6%) 92 (40.7%)
76 (33.6%) 15 (6.6%) 91 (40.2%)
13 (5.8%) 17 (7.5%) 30 (13.3%)
1 (0.4%) 12 (5.3%) 13 (5.7%)
140 (62%) 86 (38%) 226 (100%)
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
7
Fig. 1. Amino acid sequence of the major envelope (E) protein of the Que´bec reference PRRSV isolate LHVA-93-3. Amino acid substitutions and respective number of PRRSV strains showing these substitutions are indicated below each amino acid position.
3.4. Phylogenetic and epidemiological analyses The phylogenetic tree resulting from the analysis of 250 nucleotide sequences of the PRRSV ORF5 gene is shown in Fig. 2. In the phylogenetic tree, 44 groupings
comprising two to 23 strains each were identified. To consider a relationship between strains, the homology had to be equal to or greater than 98%. The cut-off point of 98% homology to consider that two strains were closely related was chosen at posteriori. It was selected
8
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
Fig. 1 (Continued)
because when a confirmed epidemiological link was observed, such as the introduction of PRRSV positive animals into a previously negative herd, the homology was equal to or greater than 98%. On the other hand, a homology of less than 92% was often observed when no relationship could be found. We did not consider groupings with a homology between 92 and 98%, which might have lead to an overestimate of associations. From the 250 sequences, 183 strains (73%) could be included in one of these 44 groupings. The data collected from the questionnaires were used to establish epide-
miological links between strains within groupings. However, no similar data were available for the reference strains. The relationship between strains within a grouping could be attributed to a variety of reasons (Table 3). For some groupings, a single relationship was identified, whereas for others, a combination of relationships was found. These suspected relationships were (a) the introduction of piglets (e.g. groupings 6, 19, 28, 34, 37), (b) the introduction of replacement gilts (e.g. groupings 27, 30), (c) the same herd of origin (e.g. eight
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
9
Fig. 2. A phylogenetic tree based on 250 nucleotide sequences of the ORF5 gene of PRRSV. An unrooted neighbor-joining tree was constructed from the aligned nucleic acid sequences. Reference strains (21) and sequences from GenBank (three) are indicated by asterisks. Groupings of similar strains (homology equal to or greater than 98%) are indicated by a brace and are numbered in increasing order.
10
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
Fig. 2 (Continued)
strains from grouping 39), (d) the same site of production with different employees working in the different buildings (e.g. strains from grouping 26), and (e) fomites such as a contaminated truck infecting PRRSV negative
piglets (two strains in grouping 29), possibly boots of employees working on different sites (two strains in grouping 3) and of an employee loading piglets in a vehicle (two strains in grouping 36). For 60 strains, the
R. Larochelle et al. / Virus Research 96 (2003) 3 /14 Table 3 Suspected relationships between strains within groupings Relationship
Number of strainsa
Introduction of piglets Introduction of replacement gilts Same herd of origin Same site of production Fomites
24 11 25 7 6
Area spread Distance between farms B/3 km: different ownership Distance between farms B/3 km: same ownership Distance between farms /3 and B/10 km: different ownership Distance between farms /3 and B/10 km: same ownership Distance /10 and B/30 km Same organization Vaccine-like Unknown
15 9 14 8 14 29 25 16
a Numbers do not add up to 183 because some strains were involved in more than one relationship.
link between strains was the geographic area, that is the location of the herds from which originated the strain. The distribution of these strains according to the distance between farms and ownership is indicated in Table 3. For 29 strains, the only association between strains within a grouping was that they originated from different herds belonging to the same organization without being able to specify any further a precise relationship. For 16 strains no relationship could be identified, some grouped together and others scattered in different groupings. The vaccine-like strains were in two groupings, one with 23 strains including RespPRRS/Repro vaccine and the parental strain ATCC-VR2332 (grouping 42), and the other one composed of only two strains including PRRS ATP vaccine (grouping 41). In nine cases, the animals submitted had been vaccinated 3/122 days earlier with an average of 24 days (aged 49 /154 days) and in three of these cases, a field strain was identified shortly after in the herd. In another two cases, the animals although not vaccinated themselves, came from vaccinated herds. For the additional 11 cases, there was no vaccination program for PRRS in the herd. In this latter group, the strains were from pigs aged an average of 93 days and originating from nine finishing and two nursery barns in which only mild (three cases) or no clinical signs (eight cases) were observed. In five of these cases, vaccination of sows had been stopped 1/1.5 year earlier. In 41 herds, more than one strain (2 /8) was identified either from the same submission or from different samples submitted over a period of time varying from
11
3 months to 4 years. The homology between different strains was generally less than 95% except in four cases for which it was between 96 and 97.2%. Strains were considered similar with a homology equal to or greater than 98% and otherwise, different. For the majority of the 41 herds (83%), the strains identified were different. In most of these cases the attending veterinarians had reported a recrudescence of reproductive problems or a second outbreak of PRRS. In 28 herds, the different strains were identified from cases submitted at an average interval of 18.5 months (3 /48). However, in half of these herds, the interval between submissions was 1 year or less and could be as less as 3 months. In two herds, two different strains were recovered simultaneously from samples of two different animals examined. In another two herds, which had submitted three samples over time, one of the three strains was different from the other two and in another two herds three different strains were identified. Similar strains were identified from different submissions over time in seven herds, including eight strains originating from a single farm over a period of 3.5 years. In addition, 15 strains originated from 15 barns located on five different sites. These barns were considered as different herds even though they were located on the same site. More than half of the strains were different within a site.
4. Discussion The present study was undertaken to evaluate the molecular diversity of PRRSV field strains in Que´bec and combine sequencing, phylogenetic and epidemiological data in an attempt to better understand the mechanisms of virus transmission between herds and temporal variation of strains. Our results from the genomic analysis of 250 PRRSV strains suggest that the variability of PRRSV ORF5 is greater than previously reported, with 59% of amino acids positions being polymorphic compared with 38% in a study of 55 US PRRSV strains (Goldberg et al., 2000a). The present study has also shown that the two potential glycosylation sites N44 and N51 were not absolutely conserved, in contrast with what was previously reported (Andreyev et al., 1997). Finally, in the 242 Que´bec strains analyzed, the predominant amino acid residue found at position 151 was lysine. This contrasts with previous studies involving US isolates in which arginine was reported to be the predominant amino acid at this position (Andreyev et al., 1997; Yang et al., 1998; Wesley et al., 1999; Key et al., 2001). The high degree of polymorphism found in Que´bec strains suggests that PRRSV is continuously evolving over time.
12
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
RFLP patterns can be used to distinguish the RespPRRS vaccine from other vaccine or field strains (Wesley et al., 1998). However, care should be taken in their interpretation since similar strains can have different RFLP patterns and conversely, strains with the same RFLP pattern, for example the 1-8-4 pattern in our study, can be quite different (e.g. 88% homology) and found in different groupings throughout the phylogenetic tree. In a recent study of 254 PRRSV strains from Ontario, a neighbor province of Que´bec, the most common RFLP pattern was the 2-5-2 vaccine pattern which was identified in 33% of the cases (Cai et al., 2002). In contrast, in the present study, this pattern was only detected in 9% of the cases. RFLP patterns intermediate to 2-5-2 have been frequently found in US (Wesley et al., 1999) and Ontario (Cai et al., 2002) whereas only one Que´bec strain had an intermediate 15-2 pattern. In our study the 1-8-4 and 1-4-4 patterns were predominant and represented 28 and 16% of strains, respectively. Surprisingly the 1-8-4 pattern was not detected in Ontario and the 1-4-4 pattern was identified in only 1.6% of the 254 typeable cases analyzed. Numerous additional RFLP patterns based on the HincII restriction site were identified in the present study and not in Ontario. Our global above findings derived from the molecular analysis of 226 PRRSV strains suggest that PRRSV circulating in Que´bec represent a different sub-population of strains. In the present study most of the PRRS cases submitted by veterinarians were in autumn and winter particularly between the months of November and April. This seasonal distribution of PRRS submissions could reflect an increased risk of infection during the autumn and winter. It has been shown that certain modes of transmission are favored according to the season: transmission by fomites is easier during cold winter, whereas transmission by avian species and mosquitoes would be more likely facilitated during warmer months (Zimmerman et al., 1997; Dee et al., 2002; Otake et al., 2002c). Because of the geographical situation of Que´bec and the associated climatic conditions, transmission via mosquitoes would not represent a major route of PRRSV transmission in this province. Birds cannot be considered either as an important factor in the transmission of PRRSV since all the herds were in total confinement and most buildings that were naturally ventilated, were bird-proof. In our study, the predominant relationships between strains within the different groupings identified from the phylogenetic tree were the introduction of infected animals and area spread. In our study, 11 and 9 outbreaks were attributed to the introduction of infected piglets (24 strains) and replacement gilts (11 strains), respectively. In these latter cases, clinical signs were generally observed 2/3 weeks after the introduction of animals, however, this period varied according to the
type of animal flow and the duration and type of the quarantine. There were also some outbreaks for which the suspected source of contamination was attributed to fomites. In one instance, two herds located 2.9 km apart had the same employees. In another case, contamination of piglets during transport was involved. Naı¨ve piglets were transported in a vehicle in which PRRSV positive piglets had been transported earlier in the day without being washed and disinfected. In a third situation, a driver, who had just taken PRRSV positive piglets into his truck, had access to the pig loading area of a previously naı¨ve herd. In this case, aerosol from the truck containing infected piglets cannot be excluded. The above results support that transport vehicles and their drivers, as well as employees represent a risk in the transmission of PRRSV (Dee et al., 2002). The link between strains obtained from herds located within the same site of production was to be expected. Although aerosol transmission between buildings cannot be ruled out, there is an increased risk of infection via fomites and movement of employees and personal within an organization. However, in more than half of the cases, different strains were identified indicating that it is essential to maintain biosecurity measures between buildings to avoid mechanical transmission and introduction of a different strain. Area spread, which is herd-to-herd transmission without any apparent pig or human contact, can be attributed to aerosol of infectious PRRSV traveling downwind (airborne transmission), to mammalian, avian or insect vectors (mechanical or biological), or to contaminated fomites. Area transmission was strongly suspected for several strains which originated from herds belonging to different ownerships. In 40% of our cases from which an area spread was suspected, herds were located within 3 km from one another and in 37% of the cases herds were between 3 and 10 km apart. Le Potier et al. (1997) found that 45% of herds suspected to have become infected through area spread were located within 500 m of the source herd and 2% within 1 km. More recently, however, Lager et al. (2002) reported the occurrence of PRRS in seven herds located fairly closely (1 /13 km) except for one farm (33 km). They suggested an area spread without precisely knowing the method of virus transmission. Similarly, Mortensen et al. (2002) reported that having a herd located within 3 km of an infected herd increases the risk of infection by PRRSV. It was not possible from our data to determine a specific distance at which the risk of transmission is greatly increased since most of the herds were located in a high density area with often additional surrounding farms for which the health status was unknown. Although the precise modes of transmission for area spread are unknown, aerosol transmission can be
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
suspected in several of our cases. Nearly half of the cases for which an area spread was suspected belonged to different owners with different feed providers, technical support teams and sources of animals, thereby decreasing the likelihood of transmission by vehicles and other fomites. Moreover, in some groupings, even the artificial insemination centers providing semen were different. The artificial insemination centers used for the farms were PRRSV negative. For herds belonging to the same organization, aerosol transmission is more difficult to prove since the virus can be introduced into a herd through a common source of animals or mechanical vectors from feed trucking, technical services or other fomites. The literature on the possibility of airborne transmission is controversial. Torremorell et al. (1997) were able to demonstrate aerosol transmission over a short distance of 1 m in only one of two experimental infections. They suggested that this type of transmission appeared to be strain dependent. Brockmeier and Lager (2002) also demonstrated airborne transmission of PRRSV over short distances in most but not in all trials performed in their experimental study. However, Mortensen et al. (2002) concluded from their nested casecontrol study that PRRSV spread by aerosol is a frequent mode of transmission. Our data indicate that a PRRSV strain can persist in a herd up to 3.5 years displaying as little as 2% variation in ORF5 during this time span. In this farrow-to-finish herd, problems were endemic. On the other hand, in 78% of the herds with several submissions over time, genetically different strains were identified, often within a 1-year interval, causing a recrudescence of clinical signs, which often appeared to be moderate to severe. These results would corroborate those of Mengeling et al. (2003) who suggested that a pig’s immune response to PRRSV has some degree of strain specificity. The introduction of a different strain in a herd seemed to be a more frequent event than persistence of one strain undergoing mutations over time. Finally, we found that different strains may coexist on one farm, which may represent an increased risk of recombination and generation of new strains. In our study, a vaccine strain was identified in only 10% of the cases even though in 26% of the cases the animals submitted had been vaccinated and 69% of the cases came from vaccinated herds, confirming that field strains replicate more actively in pigs than an attenuated vaccine strain. Nearly 40% of the animals from which a vaccine strain was recovered had been vaccinated from 3 to 122 days before submission. Following an experimental study it has been reported that vaccine can persist as long as virulent field strains in adult swine (Mengeling et al., 1996). Moreover, vaccine virus can be transmitted from vaccinated to naive pigs (Botner et al., 1997; Mengeling et al., 1998; Mortensen et al., 2002). This could also explain the circulation of a vaccine
13
strain within herds, up to 1.5 years after the cessation of PRRS vaccination. Finally, results from this study have also provided valuable information to the attending veterinarians. Biosecurity rules were reassessed on many farms as well as movement of pigs and transport of animals. Being able to more concretely identify the source of infection was a powerful tool for continuing education for employees, owners and swine specialists as it has heightened awareness of the importance of biosecurity measures.
Acknowledgements We are grateful to B. Delisle and D. Longtin for their excellent technical work and to all participating veterinarians for their time and efforts in selecting and submitting samples. We also thank all industrial partners for their financial participation over the years. The project was made possible through the Matching Investment Initiative program of the Canadian Food Inspection Agency.
References Andreyev, V.G., Wesley, R.D., Mengeling, W.L., Vorwald, A.C., Lager, K.M., 1997. Genetic variation and phylogenetic relationships of 22 porcine reproductive and respiratory syndrome virus (PRRSV) field strains based on sequence analysis of open reading frame 5. Arch. Virol. 142, 993 /1001. Benfield, D.A., Collins, J.E., Dee, S.A., Halbur, P.G., Joo, H.S., Lager, K.M., Mengeling, W.L., Murtaugh, M.P., Rossow, K.D., Stevenson, G.W., Zimmerman, J.J., 1999. Porcine reproductive and respiratory syndrome. In: Straw, B.E., D’Allaire, S., Mengeling, W.L., Taylor, D.J. (Eds.), Diseases of Swine, eighth ed. Iowa State University Press, Ames, pp. 201 /232. Botner, A., Strandbygaard, B., Sorensen, K.J., Have, P., Madsen, K.G., Madsen, E.S., Alexandersen, S., 1997. Appearance of acute PRRS-like symptoms in sow herds after vaccination with a modified-live PRRS vaccine. Vet. Rec. 141, 497 /499. Brinton, M.A., Godeny, E.K., Horzinek, M.C., Meulenberg, J.J.M., Murtaugh, M.P., Plagemann, P.G.M., Snijder, E.J., 2000. Arteriviridae. In: van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy, Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, pp. 851 / 857. Brockmeier, S.L., Lager, K.M., 2002. Experimental airborne transmission of porcine reproductive and respiratory syndrome virus and Bordetella bronchiseptica . Vet. Microbiol. 89, 267 /275. Cai, H.Y., Alexander, H., Carman, S., Lloyd, D., Josephson, G., Maxie, M.G., 2002. Restriction fragment length polymorphism of porcine reproductive and respiratory syndrome viruses recovered from Ontario farms, 1998 /2000. J. Vet. Diagn. Invest. 14, 343 / 347. Dee, S., Deen, J., Rossow, K., Wiese, C., Otake, S., Joo, H.S., Pijoan, C., 2002. Mechanical transmission of porcine reproductive and
14
R. Larochelle et al. / Virus Research 96 (2003) 3 /14
respiratory syndrome virus through a coordinated sequence of events during cold weather. Can. J. Vet. Res. 66, 232 /239. Goldberg, T.L., Hahn, E.C., Weigel, R.M., Scherba, G., 2000a. Genetic, geographical and temporal variation of porcine reproductive and respiratory syndrome virus in Illinois. J. Gen. Virol. 81, 171 /179. Goldberg, T.L., Weigel, R.M., Hahn, E.C., Scherba, G., 2000b. Associations between genetics, farm characteristics and clinical disease in field outbreaks of porcine reproductive and respiratory syndrome virus. Prev. Vet. Med. 43, 293 /302. Kapur, V., Elam, M.R., Pawlovich, T.M., Murtaugh, M.P., 1996. Genetic variation in porcine reproductive and respiratory syndrome virus isolates in the midwestern United States. J. Gen. Virol. 77, 1271 /1276. Key, K.F., Haqshenas, G., Guenette, D.K., Swenson, S.L., Toth, T.E., Meng, X.-J., 2001. Genetic variation and phylogenetic analyses of the ORF5 gene of acute porcine reproductive and respiratory syndrome virus isolates. Vet. Microbiol. 83, 249 /263. Lager, K.M., Mengeling, W.L., Wesley, R.D., 2002. Evidence for local spread of porcine reproductive and respiratory syndrome virus. J. Swine Health Prod. 10, 167 /170. Le Potier, M.-F., Blanquefort, P., Morvan, E., Albina, E., 1997. Results of a control program for the porcine reproductive and respiratory syndrome in the French ‘‘Pays de la Loire’’ region. Vet. Microbiol. 55, 355 /360. Meng, X.J., 2000. Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet. Microbiol. 74, 309 /329. Meng, X.-J., Paul, P.P., Halbur, P.G., Morozov, I., 1995. Sequence comparison of open reading frames 2 to 5 of low and high virulence United States isolates of porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 76, 3181 /3188. Mengeling, W.L., Vorwald, A.C., Lager, K.M., Brockmeier, S.L., 1996. Comparison among strains of porcine reproductive and respiratory syndrome virus for their ability to cause reproductive failure. Am. J. Vet. Res. 57, 834 /839. Mengeling, W.L., Lager, K.M., Vorwald, A.C., 1998. Clinical effects of porcine reproductive and respiratory syndrome virus on pigs during the early postnatal interval. Am. J. Vet. Res. 59, 52 /55. Mengeling, W.L., Lager, K.M., Vorwald, A.C., Koehler, K.J., 2003. Strain specificity of the immune response of pigs following vaccination with various strains of porcine reproductive and respiratory syndrome virus. Vet. Microbiol. 93, 13 /24. Meulenberg, J.J.M., Petersen-den Besten, A., De Kluyver, E.P., Moorman, R.J.M., Schaaper, W.M.M., Wensvoort, G., 1995. Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206, 155 /163. Mortensen, S., Stryhn, H., Sogaard, R., Boklund, A., Stark, K.D.C., Christensen, J., Willeberg, P., 2002. Risk factors for infection of sow herds with porcine reproductive and respiratory syndrome (PRRS) virus. Prev. Vet. Med. 53, 83 /101. Murtaugh, M.P., Faaberg, K.S., Laber, J., Elam, M., Kapur, V., 1998. Genetic variation in the PRRS virus. Adv. Exp. Med. Biol. 440, 787 /794.
Murtaugh, M.P., Yuan, S., Faaberg, K.S., 2001. Appearance of novel PRRSV isolates by recombination in the natural environment. Adv. Exp. Med. Biol. 494, 31 /36. Nicholas, K.B., Nicholas, H.B. Jr., 1997. GENEDOC: a tool for editing and annotating multiple sequence alignments. Distributed by the authors. Otake, S., Dee, S.A., Rossow, K.D., Deen, J., Joo, H.S., Molitor, T.W., Pijoan, C., 2002a. Transmission of porcine reproductive and respiratory syndrome virus by fomites (boots and coveralls). J. Swine Health Prod. 10, 59 /65. Otake, S., Dee, S.A., Rossow, K.D., Joo, H.S., Deen, J., Molitor, T.W., Pijoan, C., 2002b. Transmission of porcine reproductive and respiratory syndrome virus by needles. Vet. Rec. 150, 114 /115. Otake, S., Dee, S.A., Rossow, K.D., Moon, R.D., Pijoan, C., 2002c. Mechanical transmission of porcine reproductive and respiratory syndrome virus by mosquitoes, Aedes vexans (Meigen). Can. J. Vet. Res. 66, 191 /195. Rowland, R.R.R., Steffen, M., Ackerman, T., Benfield, D.A., 1999. The evolution of porcine reproductive and respiratory syndrome virus: quasispecies and emergence of a virus subpopulation during infection of pigs with VR-2332. Virology 259, 262 /266. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876 /4882. Torremorell, M., Pijoan, C., Janni, K., Walker, R., Joo, H.S., 1997. Airborne transmission of Actinobacillus pleuropneumoniae and porcine reproductive and respiratory syndrome virus in nursery pigs. Am. J. Vet. Res. 58, 828 /832. Wesley, R.D., Mengeling, W.L., Lager, K.M., Clouser, D.F., Landgraf, J.G., Frey, M.L., 1998. Differentiation of a porcine reproductive and respiratory syndrome virus vaccine strain from North American field strains by restriction fragment length polymorphism analysis of ORF5. J. Vet. Diagn. Invest. 10, 140 /144. Wesley, R.D., Mengeling, W.L., Lager, K.M., Vorwald, A.C., Roog, M.B., 1999. Evidence for divergence of restriction fragment length polymorphism patterns following in vivo replication of porcine reproductive and respiratory syndrome virus. Am. J. Vet. Res. 60, 463 /467. Yang, S.X., Kwang, J., Laegreid, W., 1998. Comparative sequence analysis of open reading frames 2 to 7 of the modified live vaccine virus and other North American isolates of the porcine reproductive and respiratory syndrome virus. Arch. Virol. 143, 601 /612. Yoon, K.-J., Chang, C.-C., Zimmerman, J., Harmon, K., 2001. Genetic and antigenic stability of PRRS virus in pigs. Adv. Exp. Med. Biol. 494, 25 /30. Yuan, S., Nelsen, C.J., Murtaugh, M.P., Schmitt, B.J., Faaberg, K.S., 1999. Recombination between North American strains of porcine reproductive and respiratory syndrome virus. Virus Res. 61, 87 /97. Zimmerman, J.J., Yoon, K.-J., Pirtle, E.C., Wills, R.W., Sanderson, T.J., McGinley, M.J., 1997. Studies of porcine reproductive and respiratory syndrome (PRRS) virus infection in avian species. Vet. Microbiol. 55, 329 /336.