Molecular mapping of a novel wheat powdery mildew resistance gene Ml92145E8-9 and its application in wheat breeding by marker-assisted selection

Accepted Manuscript Molecular mapping of a novel wheat powdery mildew resistance gene Ml92145E8–9 and its application in wheat breeding by marker-assisted selection

Xiaocheng Yu, Shizhong Ren, Lanfei Zhao, Jun Guo, Yinguang Bao, Yingxue Ma, Hongwei Wang, Herbert W. Ohm, Dazhao Yu, Hongjie Li, Lingrang Kong PII: DOI: Reference:

S2214-5141(18)30064-3 doi:10.1016/j.cj.2018.04.004 CJ 300

To appear in:

The Crop Journal

Received date: Revised date: Accepted date:

31 January 2018 30 March 2018 20 April 2018

Please cite this article as: Xiaocheng Yu, Shizhong Ren, Lanfei Zhao, Jun Guo, Yinguang Bao, Yingxue Ma, Hongwei Wang, Herbert W. Ohm, Dazhao Yu, Hongjie Li, Lingrang Kong , Molecular mapping of a novel wheat powdery mildew resistance gene Ml92145E8–9 and its application in wheat breeding by marker-assisted selection. Cj (2018), doi:10.1016/j.cj.2018.04.004

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Molecular mapping of a novel wheat powdery mildew resistance gene Ml92145E8-9 and its application in wheat breeding by marker-assisted selection Xiaocheng Yua, Shizhong Rena, Lanfei Zhaoa, Jun Guoa, Yinguang Baoa, Yingxue Maa, Hongwei Wanga, Herbert W. Ohmb, Dazhao Yuc, Hongjie Lid, Lingrang Konga,* State Key Laboratory of Crop Biology, College of Agronomy, Shandong Agricultural University, Tai’an 271018, Shandong, China

b

Department of Agronomy, Purdue University, West Lafayette, IN 47907-1150, USA

c

Hubei Academy of Agricultural Sciences, Wuhan 430000, Hubei, China

d

Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 10000, China

PT

a

Abstract: Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is one of the most devastating

RI

diseases of common wheat (Triticum aestivum L.). The wheat line 92145E8-9 is immune to Bgt isolate E09. Genetic analysis reveals that the powdery mildew resistance in 92145E8-9 is controlled by a single dominant gene,

SC

temporarily designated Ml92145E8-9. Bulked-segregant analysis (BSA) with simple sequence repeat (SSR) markers indicate that Ml92145E8-9 is located on chromosome 2AL. According to the reactions of 92145E8-9,

NU

VPM1 (Pm4b carrier), and Lankao 906 (PmLK906 carrier) to 14 Bgt isolates, the resistance spectrum of 92145E8-9 differs from those of Pm4b and PmLK906, both of which were previously localized to 2AL. To test the allelism among Ml92145E8-9, Pm4b and PmLK906, two F2 populations of 92145E8-9×VPM1 (Pm4b) and

MA

92145E8-9×Lankao 906 (PmLK906) were developed in this study. Screening of 784 F2 progeny of 92145E8-9×VPM1 and 973 F2 progeny of 92145E8-9×Lankao 906 for Bgt isolate E09 identified 37 and 19 susceptible plants, respectively. These findings indicated that Ml92145E8-9 is non-allelic to either Pm4b or

D

PmLK906. Thus, Ml92145E8-9 is likely to be a new powdery mildew resistance gene on 2AL. New polymorphic markers were developed based on the collinearity of genomic regions of Ml92145E8-9 with the reference

PT E

sequences of the International Wheat Genome Sequencing Consortium (IWGSC). Ml92145E8-9 was mapped to a 3.6 cM interval flanked by molecular markers Xsdauk13 and Xsdauk682. This study also developed five powdery mildew-resistant wheat lines (SDAU3561, SDAU3562, SDAU4173, SDAU4174, and SDAU4175) using flanking

CE

marker-aided selection. The markers closely linked to Ml92145E8-9 would be useful in marker-assisted selection for wheat powdery mildew resistance breeding.

AC

Keywords: Marker-assisted selection; Ml92145E8-9; Powdery mildew; Triticum aestivum L.

1 Introduction

Powdery mildew, caused by Blumeria graminis (DC.) E.O. Speer f. sp. tritici (Bgt), is an important disease of common wheat (Triticum aestivum L.), particularly in highly productive areas with a maritime or semi-continental climate, that results in severe grain yield and quality losses [1, 2]. In addition to fungicides and other biological agents, disease-resistant cultivars are considered the most economically effective and environmentally safe method of controlling powdery mildew [3]. There are two types of inherited powdery mildew resistance: qualitative and quantitative. Qualitative resistance to powdery mildew, which is controlled by major genes, has

*

Corresponding author: Lingrang Kong, E-mail address: [email protected], Tel.: +86-538-8249278.

Received: 2018-01-31; Revised: 2018-03-30; Accepted: 2018-04-20.

1

ACCEPTED MANUSCRIPT been extensively employed in wheat breeding programs. However, these race-specific resistance genes are effective against only certain Bgt isolates. The durability of qualitative resistance genes is generally limited by the continuous evolution of pathogen populations [4]. Consequently, it is necessary to identify novel genes for powdery mildew resistance to newly emerging virulent Bgt isolates. To date, more than 77 genes or alleles for resistance to wheat powdery mildew, including Pm1–Pm54 (Pm8 is allelic to Pm17, Pm18 = Pm1c, Pm22 = Pm1e, Pm23 = Pm4c, and Pm31 = Pm21) and more than 30 temporarily designated Pm genes, have been identified at 56 loci distributed across all wheat chromosomes [5–7]. Of these genes, multiple alleles exist in several chromosome loci, including the Pm2a–2c locus on chromosome arm 5DS [8–11], the Pm3a–3j locus on chromosome arm 1AS

PT

[12], the Pm4a–4d locus on chromosome arm 2AL [13], and the Pm24a–24b locus on chromosome arm 1DS [14]. Although several Pm genes or alleles have been identified, only a handful of these, including Pm2a, Pm4a, Pm4b,

RI

Pm6, Pm8, and Pm21, have been successfully used for breeding cultivars [15–16]. However, because frequent changes in pathogen populations often overcome the effects of available resistance genes, the identification of

SC

diverse resistance genes and clusters of resistance genes is an ongoing process [17–19]. Molecular markers have been successfully used to map powdery mildew resistance genes in wheat [20, 21].

NU

Simple sequence repeats (SSRs) are easy to handle, inexpensive, highly polymorphic, and reliable. To date, several powdery mildew resistance genes have been successfully tagged using SSR markers. For instance, Pm2b has been tagged and successfully transferred to powdery mildew-susceptible cultivars including Shimai 15,

MA

Shixin 828, and Gaocheng 8901 and efficiently selected using closely linked markers for improvement of powdery mildew resistance [22].

92145E8-9 is resistance to powdery mildew during the entire growth period in the field and under controlled

D

conditions. The objectives of the present study were to (1) identify the Bgt resistance gene in line 92145E8-9, (2)

PT E

perform resistance spectrum comparisons and test the allelism of Ml92145E8-9, PmLK906, and Pm4b, and (3) develop markers closely linked to Ml92145E8-9 for marker-assisted selection (MAS).

2.1 Plant materials

CE

2 Materials and methods

Wheat line 92145E8-9 provided by coauthor H. W. Ohm, was employed as the resistant parent in a cross with a

AC

highly susceptible Chinese common wheat cultivar Huixianhong. Sixty F1 hybrids, 251 F2 segregating populations, and 193 F2:3 families were evaluated for powdery mildew resistance to Bgt isolate E09. Huixianhong was used as a susceptible control. Cultivars VPM1 carrying Pm4b and Lankao 906 carrying PmLK906 were used as parents to generate two F2 populations from crosses with 92145E8-9 for testing allelism among Pm4b, PmLK906, and Ml92145E8-9. 2.2 Evaluation of powdery mildew resistance The parental lines 92145E8-9 and Huixianhong and the F1, F2, and F2:3 families were grown in plastic trays, placed in a growth chamber, and inoculated at the one-leaf stage with Bgt isolate E09 by dusting with newly developed conidia from susceptible seedlings of Huixianhong. Isolate E09 was provided by Prof. Zhiyong Liu of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China. For each F2:3 2

ACCEPTED MANUSCRIPT family, 15–20 plants were inoculated with powdery mildew. The plants were scored by infection type (IT) at 15 days after inoculation when Huixianhong was heavily infected and reconfirmed five days later following Liu et al. [23] and Zeng et al. [24], where 0 represents an immune reaction, 0; necrotic flecks without uredia, and 1, 2, 3, and 4 highly resistant, moderately resistant, moderately susceptible, and highly susceptible, respectively. Phenotypes with IT2 or lower were classified as resistant, and those with 3–4 were considered as susceptible [23, 24]. Observed and expected segregation ratios were compared using the chi-squared (χ2) test for goodness of fit. 2.3 Marker analysis

PT

Genomic DNA was extracted from seedling leaves of the parental lines and F2 progeny following the CTAB protocol [25]. For bulked-segregant analysis (BSA) [26], equal amounts of DNA from 10 highly resistant and susceptible F2 plants were mixed separately to form the resistant (BR) and susceptible (BS) bulks. Wheat genomic

RI

SSRs (Xgwm, Xwmc, Xbarc, Xcfa, Xcfd, Xpsp, and Xgpw series, http://wheat.pw.usda.gov/) were used to screen

SC

for polymorphisms between the two parents and the two bulks. The polymorphic markers were further used to genotype the mapping populations. PCR was conducted in a 10 μL reaction volume. The PCR program was as follows: one denaturation cycle at 95 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 50–60 °C (depending

NU

on the specific primers) for 30 s, and 72 °C for 50 s, and an extension step of 72 °C for 10 min. The PCR products were mixed with 3 μL of loading buffer (98% formamide, 10 mmol L−1 EDTA, 0.25% bromophenol blue, and 0.25% xylene cyanol). The PCR amplification mixes were then loaded into 8% non-denatured polyacrylamide

MA

gels (39 acrylamide: 1 bisacrylamide). After electrophoresis, the gels were silver-stained and photographed [27]. 2.4 Comparative genomic analysis and polymorphic SSR marker development

D

Chinese Spring reference sequences assembled by the International Wheat Genome Sequencing Consortium

PT E

(http://www.wheatgenome.org/) and 454 shotgun sequences [28] were both used to identify collinearity of genomic regions of Ml92145E8-9. Using the software SSR Finder (http://fresnostate.edu/csm/faculty-research/ ssrfinder/) to identify SSR motifs in these contigs and scaffold sequences, SSR primer pairs were designed with Primer3 (Version 0.4.0) (http://bioinfo.ut.ee/primer3-0.4.0/) with the following parameters: amplification product 40%–60%.

CE

size of 200 bp to 300 bp, primer length of 18 bp to 22 bp, primer Tm of 55 °C to 60 °C, and primer GC content of

AC

2.5 Genetic map construction

A genetic linkage map of the powdery mildew resistance gene Ml92145E8-9 was constructed using the software JoinMap 4.0 [29]. Map distances were calculated using the Kosambi function [30].

3 Results 3.1 Genetic analysis of the powdery mildew resistance gene in 92145E8-9 Line 92145E8-9 is resistant (IT = 0) to Bgt isolate E09 and Huixianhong is highly susceptible (IT = 4) (Fig. S1). Sixty F1 plants of 92145E8-9×Huixianhong were all resistant to Bgt isolate E09 with the same infection type (IT = 0) as 92145E8-9, indicating that powdery mildew resistance in wheat line 92145E8-9 is controlled by one or more dominant genes. In the F2 population, 179 plants were resistance and 72 plants were susceptible, fitting the 3:1 3

ACCEPTED MANUSCRIPT segregation ratio expected for control by a single gene. The F2:3 families consisted of 54 homozygous resistant:85 segregating:54 homozygous susceptible lines, fitting the expected ratio of 1:2:1 for monogenic resistance (Table 1). These results indicate that the powdery mildew resistance gene in 92145E8-9 is controlled by a single dominant gene, which has been temporarily designated Ml92145E8-9.

χ2

P-value

1.82 2.74

0.196 0.249

SC

RI

PT

Table 1 – Reactions of F2 population, F2:3 families of 92145E8-9×Huixianhong to isolate E09. Number of Number of Number of Expected ratio of Parent/ Total number homozygous segregating homozygous resistant: Population of lines resistant lines lines susceptible lines susceptible lines 92145E8-9 15 Huixianhong 15 F1 60 60 F2 251 179 72 3:1 F2:3 193 54 85 54 1:2:1 χ2(0.05, 1) = 3.84, χ2(0.05, 2) = 5.99.

NU

3.2 Linkage mapping of Ml92145E8-9

For linkage mapping of the resistance gene in 92145E8-9, the resistant and susceptible DNA bulks of the F2

MA

population and the DNA of the parents were initially used to test 486 pairs of SSR primers randomly distributed across 21 wheat chromosomes. Four SSR markers (Xpsp3039, Xwmc658, Xcfa2086, and Xgdm93) were found to be polymorphic between two parents and two bulks and were mapped to chromosome 2AL. Fifty-two STS and SSR markers on chromosome 2AL were subsequently surveyed for polymorphism. Four further markers

D

(Xgwm356, Xgwm526, Xgpw2046, and Xwmc181) revealed polymorphism. Finally, the Ml92145E8-9 gene was

PT E

mapped to an 18.8 cM interval between SSR markers Xwmc181 and Xgpw2046. Thus, the newly identified powdery mildew resistance gene Ml92145E8-9 was localized to the long arm of chromosome 2A. 3.3 Collinearity analysis and polymorphic marker development

CE

The corresponding sequences of the polymorphic SSR markers (Table S1) were used as query sequences for BLAST（Basic Local Alignment Search Tool）search against the Chinese Spring contigs, to search for the

AC

reference sequences and develop new markers. Using the designed eight polymorphic SSR markers (Xsdauk12, Xsdauk13, Xsdauk638, Xsdauk662, Xsdauk682, Xsdauk782, Xsdauk829, and Xsdauk869), the target resistance gene Ml92145E8-9 was mapped to a 3.6 cM interval flanked by markers Xsdauk13 and Xsdauk682 (Fig. 1, Table 2).

4

ACCEPTED MANUSCRIPT Somers et al. (2004)

Centromere

Xgwm95

5.0 1.0 1.0

Xgwm328 Xwmc455 Xgwm372 Xbarc5 Xgwm47

3.0

Xu et al. (2011)

Xbarc15 Xcfa2263 Xbarc220 Xgwm372 Xbarc208

1.5 0.3 0.4 1.5 17.7

Xwmc109 Xgwm312 Xgwm294

9.0

C-2AL1-0.85

Xcfd168 6.0

Xcfd86

12.0 Xwmc181

5.0

PmHNK54

2.6 1.3 2.9 1.8 11.2

Xwmc170 PPO18 Xgpw2206 Xgwm294 Xkse005

0.6 2.1 4.2 2.8 0.8 7.0

Xwmc181 Xsdauk868 Xsdauk12 Xsdauk682 MlE8-9 Xsdauk13 Xsdauk662

Xgwm312

Pm50

d

Xbarc76

9.0

2AL1-0.85-1

Xwmc658 Xgwm311

3.0

c

b

a

e

Hao et al. (2008)

Hao et al. (2008)

Hao et al. (2008)

Xbarc76

4.8

Xgdm93

Pm4a

7.0

Xsts-bcd1231

7.9

XResPm4

Xgwm356 Pm4b Xbarc122

3.7 2.0

7.8

15.9

3.5 1.4 3.5

g

f

Xgwm356

Xbarc76

10.8

Xgwm356

Schmolke et al. (2012) Xgwm311 Xgwm382

7.8

RI

5.0

Xgdm93 Xgwm526 Xsdauk829 Xmag8432 Xcfa2086 Xpsp3039 Xwmc658 XResPm4 Xsdauk782 Xsts-bcd1231 Xbarc122

Xgwm294

3.8

SC

Xgwm356

Xgwm356 Xsdauk638 Xgpw2046

2.0 4.3 4.6 1.0 1.2 7.5 1.6 3.4 1.5 2.7 0.6 0.7 7.9

9.2

9.0

11.7 23.0

Xbarc5

6.2

Xgwm425 Xgwm515 Xgwm95 Xgwm372 Xbarc5

1.2 1.2 0.4 7.7

Xgwm372

5.0

Xgwm312

5.0 3.0 2.0

Volker Mohler et al. (2013)

PT

Sourdille et al. (2004)

Xgwm356 Pm4c Xbarc122 Xgdm93

Xgdm93 3.1

Xgwm526

3.4 1.0 2.5

h

Pm4d/XResPm4 Xbarc122 Xgwm265

i

Fig. 1 – Comparative linkage map of Pm genes on chromosome 2AL. CS 2AL physical bin (a), 2AL consensus linkage map (b),

Pm4b (g), linkage map of Pm4c (h), linkage map of Pm4d (i).

NU

linkage map of Ml92145E8-9 (c), linkage map of PmHNK54 (d), linkage map of Pm50 (e), linkage map of Pm4a (f), linkage map of

Tm (°C)

Xsdauk12

GGCTAAAGTGGACTACTAGAGGC

ACCCCTTGCACTAACTACACTAAT

57

Xsdauk13

GCTAAAGTGGACTACTAGAGGCAG

ATTTAGCTTTGTTCAATAGGTTCAC

57

Xsdauk638 AGCATCCACTTTGCACCATT

TTCGTGCCCTTTTTATTTGG

60

Xsdauk662 TCCATGATGACTTGCCAAAA

CCAACCCAAATACACATTCTCA

60

Xsdauk682 GCGCATTTGAGCTTTTTGTT

CGCCAGAGAATGTTTGTTCA

60

Xsdauk782 TCAGATAAACCGCCAAGTCC

CATCACCAACAAAGCCTCCT

60

Xsdauk829 CAAAACAACGGGTGAAGGATA

GGTTTTGTACCTTGGGTTGGT

59

Xsdauk868 TTTCTCCTCCCAATGTACCG

GGAGGAGGGAGCAAAGCTACT

60

IWGSC_CSS_2AL_scaff_6319787 IWGSC_CSS_2AL_scaff_6387201 IWGSC_CSS_2AL_scaff_6377782

IWGSC_CSS_2AL_scaff_6371675

CE

IWGSC_CSS_2AL_scaff_30246

PT E

IWGSC_CSS_2AL_scaff_6394178

D

Reverse

Marker

IWGSC_CSS_2AL_scaff_6417409

Sequence (5′–3′)

Forward

Chinese Spring contigs

IWGSC_CSS_2AL_scaff_6394935

MA

Table 2 – Description of newly developed SSR markers on chromosome 2AL.

3.4 Comparison of Ml92145E8-9 with reported powdery mildew resistance genes on chromosome 2AL

AC

To date, six resistance genes have been identified on chromosome 2AL: Pm4 [31], PmLK906 [32], PmPS5A [33], Pm50 [34], PmHNK54 [35], and PmX [36]. Physical bin mapping has localized Pm4 to 2AL1-0.85-1.00 [13]. However, genetic mapping indicated that the powdery mildew resistance gene Ml92145E8-9 located in chromosome 2AL bin C-2AL1-0.85 together with resistance genes PmHNK54 and Pm50 [34, 35]. By comparing the SSR markers closely linked to PmHNK54 and Pm50, the marker Xgwm312 closely linked to PmHNK54 [35] was mapped 35.7 cM from Ml92145E8-9 and Pm50 was found to lie 3.8 cM from Xgwm294 [34], which was mapped to 22.7 cM from Ml92145E8-9. Thus, Ml92145E8-9 differs from PmHNK54 and Pm50. 3.5 Testing for allelism among Ml92135E8-9, Pm4b, and PmLK906 To test whether Ml92145E8-9 is an allele of Pm4 or Lankao 906, an allelism test was conducted by crossing 92145E8-9 with VPM1 (Pm4b) and Lankao 906 (PmLK906). Fourteen Bgt isolates were used in a pathogenicity 5

ACCEPTED MANUSCRIPT test of Ml92145E8-9, Pm4b, and PmLK906 at the seedling stage (Table 3). Ml92145E8-9 and PmLK906 were resistant to Bg74-3, Bg68-2, Bg75-2, and Bg44-5. Bg78-3 was avirulent on PmLK906, but virulent on Ml92145E8-9. Pm4b conferred complete resistance to Bg68-2, Bg75-2, and Bg81-2.

MA

NU

SC

RI

PT

Table 3 – Infection types of PmLK906, Ml92145E8-9, and Pm4b in response to Bgt isolate E09 and 14 isolates of Blumeria graminis f. sp. tritici from China Lankao 906 92145E8-9 VPM1 Bgt isolates Source PmLK906 Ml92145E8-9 Pm4b E09 Beijing 1 0 0 E03 Beijing 3 3 3 E16 Beijing 3 3 4 Bg74-3 Zhuozhou, Hebei 0 0 4 Bg69-1 Cixian, Hebei 3 3 3 Bg69-3 Cixian, Hebei 3 3 4 Bg68-2 Beijing 0 0 0 Bg75-2 Xunxian, Henan 0 1 1 Bg81-2 Pingyi, Shandong 3 3 0 Bg89-1 Wenjiang, Sichuan 2 3 3 Bg77-3 Xihua, Henan 4 4 3 Bg78-1 Xinxiang, Henan 3 4 4 Bg78-2 Xinxiang, Henan 3 3 3 Bg78-3 Xinxiang, Henan 2 3 4 Bg44-5 Zhanhua, Shandong 1 1 3 This experiment was repeated three times with the same results.

D

To further clarify the relationships of Ml92135E8-9, Pm4b, and PmLK906, 784 F2 plants from 92145E8-9×VPM1 and 973 F2 plants from 92145E8-9×Lankao 906 were inoculated with Bgt isolate E09. The

PT E

inoculation results identified 37 susceptible plants from the cross 92145E8-9×VPM1 and 19 susceptible plants from the cross 92145E8-9×Lankao 906. The allelism test confirmed that Ml92135E8-9 is a novel powdery mildew resistance gene that is distinct from Pm4b and PmLK906.

CE

3.6 Application of Ml92145E8-9 in wheat breeding by MAS To facilitate the use of Ml92145E8-9 in wheat breeding, MAS combined with phenotypic selection was performed

AC

to select homozygous progeny carrying the target gene. Line 92145E8-9 was crossed separately with Gaokang 1 and Liangxing 99. A total of 1605 F2 plants from the cross Liangxing 99×92145E8-9 were screened with codominant markers linked to Ml92145E8-9 (Xsdauk13 and Xsdauk682) and MlLX99 (Xcfd73 and Xwmc441). A total of 905 plants carried Ml92145E8-9 and MlLX99, including 94 homozygotes; 311 F2 lines of the 905 lines carried only Ml92145E8-9 and 302 of the 905 F2 lines carried MlLX99. Marker-assisted selection combined with powdery mildew resistance evaluation and agronomic trait selection was conducted in different generations of Liangxing 99×92145E8-9 and Gaokang 1×92145E8-9. F5:6 progeny derived from Liangxing 99×92145E8-9 and F5:6 progeny derived from Gaokang 1×92145E8-9 were tested with Bgt isolate E09 under controlled incubator conditions and separately with a natural Bgt population in the greenhouse (Table S2). Three of the progeny of Gaokang 1×92145E8-9, named SDAU4173, SDAU4174, and SDAU4175, were screened with Xsdauk13 and Xsdauk682 to identify homozygous lines carrying the target gene Ml92145E8-9 (Fig. S2-a, c). The three progeny 6

ACCEPTED MANUSCRIPT lines showed complete resistance to Bgt isolate E09, indicating that Ml92145E8-9 had been successfully transferred into SDAU4173, SDAU4174, and SDAU4175. SDAU3561 and SDAU3562, derived from Liangxing 99×92145E8-9, were screened with the markers closely linked to Ml92145E8-9 (Xsdauk13 and Xsdauk682) and MlLX99 (Xcfd73 and Xwmc441). Both Ml92145E8-9 and MlLX99 had been successfully pyramided in lines SDAU3561 and SDAU3562, which showed complete resistance to Bgt isolate E09 (Fig. S2-b, d; Fig. S3-a, b; Table S2). Furthermore, the agronomic traits seed protein, plant architecture, and 1000-grain weight in the homozygous progenies were improved in comparison with 92145E8-9 (Table S2). It is noteworthy that the plant heights of SDAU4173, SDAU4174, SDAU4175, SDAU4174, and SDAU4175 were lower than that of 92145E8-9,

PT

a finding promising for lodging resistance.

4 Discussion

RI

In this study, Ml92145E8-9 was a single dominant gene localized to chromosome 2AL. To date, Pm4 [31],

SC

PmLK906 [32], PmPS5A [33], Pm50 [34], PmHNK54 [35], and PmX [36] have also been mapped to chromosome 2AL. Pm4 was assigned to chromosome 2AL by telocentric mapping [31] and localized to a sub-telomeric region of chromosome 2AL by linkage mapping [37]. Powdery mildew resistance genes mapped to the Pm4 locus

NU

include Pm4a, Pm4b [31], Pm4c [38], Pm4d [13], PmPS5A [33], PmLK906 [32], PmX [36], and a major QTL for powdery mildew resistance that coincided with Pm4b [39].

MA

In contrast to the linkage maps of the resistance genes at the Pm4 locus (Fig. 1), SSR marker Xgwm356 has been linked to all these genes. Among these, Pm4a, Pm4b, and Pm4c show similar genetic distances from marker Xgwm356 and are distal to Pm4d and Ml92145E8-9. The genetic distance between the STS marker BCD1231 that

D

co-segregated with Pm4a [40] and Ml92145E8-9 is 50.3 cM. The STS marker XResPm4 [13] appears to be locus-specific for Pm4d, which has been localized 49.3 cM from Ml92145E8-9. The distance between Xgwm356

PT E

and Pm4b was 3.7 cM and that between Xgwm356 and Pm4c 3.5 cM, whereas that between Xgwm356 and Ml92145E8-9 was 19.8 cM in this study. Variation in genetic distances and orders of markers or genes among different linkage maps is a common phenomenon. These differences may be attributed to various factors such as

CE

population size, mapping parents, chromosome structural variation, and experimental error. Pm4 [37], PmPS5A [33], PmLK906 [32], and PmX [36] were physically assigned to a distal bin (wheat deletion bin 2AL1-0.85-1.00). Ml92145E8-9 was assigned to bin C-2AL1-0.85 based on the physical location of Xwmc181, Xgpw2046, and

AC

Xgwm356, which are closely linked to Ml92145E8-9. The other two resistance genes, PmHNK54 [35] and Pm50 [34], are also located in chromosome bin C-2AL1-0.85. According to the 2AL consensus linkage map [39], PmHNK54 is flanked by markers Xbarc5 and Xgwm312 [35], and Xgwm312 is located 35.7 cM from Ml92145E8-9. Pm50 is located 3.8 cM from marker Xgwm294 [34] and 22.7 cM from Ml92145E8-9. Thus, Ml92145E8-9 is not identical to Pm50 and PmHNK54. These results show that Ml92145E8-9 is likely not located at the same position as other powdery mildew resistance genes previously mapped on chromosome 2AL. In the present study, the resistance spectrum of Ml92145E8-9 differed from those of Pm4b and PmLK906. Allelism testing using F2 plants from the cross of 92145E8-9×VPM 1 and 92145E8-9×Lankao 906 was further conducted to clarify the relationships between Ml92145E8-9, Pm4b, and PmLK906. The susceptible recombinants identified in the F2 generations indicate that Ml92145E8-9 is distinct from Pm4b and PmLK906. Thus, Ml92145E8-9 is likely to be a novel powdery mildew resistance gene in wheat. 7

ACCEPTED MANUSCRIPT Compared to conventional plant breeding, MAS is more efficient and less time-consuming. The flanking markers Xsdauk13 and Xsdauk682 of Ml92145E8-9 were readily used for MAS of Ml92145E8-9 in the present study. The progeny from MAS with homozygous resistance genes showed that these are immune to Bgt isolate E09 in controlled biological incubator conditions and highly resistant to a natural Bgt population in the greenhouse. The agronomic characters of progeny lines were superior to those of 92145E8-9 (Table S2). Thus, the powdery mildew resistance conferred by Ml92145E8-9 has been rapidly and efficiently incorporated into other wheat cultivars and may be useful in wheat breeding.

PT

Acknowledgments We are grateful to Prof. Zhiyong Liu of Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China for providing Bgt isolate E09 and Dr. Robert McIntosh from University of Sydney,

RI

Australia for revising the manuscript. The work was financially supported by Genetically Modified Organisms

SC

Breeding Major Projects (2016ZX08009003-001-006), the National Natural Science Foundation of China (31471488 and 31520203911), and the National Basic Research Program of China (2014CB138100).

NU

Supplementary data

Supplementary data for this article can be found online at https://dx.doi.org/10.1016/j.cj 201x.xx.xxx. Table S1 – Genetic markers of Ml92145E8-9 and their corresponding reference contigs.

MA

Table S2 – Some agronomic characteristics of new lines developed by marker-assisted selection. Fig. S1 – Phenotype of the resistant parent 92145E8-9 and the susceptible parent Huixianhong at 15 days post inoculation with Bgt isolate E09.

D

Fig. S2 – Molecular identification of progeny with powdery mildew resistance gene MI92145E8-9.

PT E

Fig. S3 – Characterization of two new wheat lines (SDAU3561 and SDAU3562) carrying Ml92145E8-9 and MlLX99.

References

CE

[1] V.M. Mwale, X.L. Tang, E. Chilembwe, Molecular detection of disease resistance genes to powdery mildew (Blumeria graminis f. sp. tritici) in wheat (Triticum aestivum) cultivars, Afr. J. Biotechnol. 16 (2017) 22–31. [2] A. Morgounov, H.A. Tufan, R. Sharma, B. Akin, A. Bagci, H.J. Braun, Y. Kaya, M. Keser, T.S. Payne, K.

AC

Sonder, R. McIntosh, Global incidence of wheat rusts and powdery mildew during 1969–2010 and durability of resistance of winter wheat variety Bezostaya 1, Eur. J. Plant Pathol. 132 (2012) 323–340. [3] S.H. Hulbert, C.A. Webb, S.M. Smith, Q. Sun, Resistance gene complexes: evolution and utilization, Annu. Rev. Phytopathol. 39 (2001) 285–312. [4] N. Liu, Z.L. Liu, G.S. Gong, M. Zhang, X. Wang, Y. Zhou, X.B. Qi, H.B. Chen, J.Z. Yang, P.G. Luo, C.P. Yang, Virulence structure of Blumeria graminis f. sp. tritici and its genetic diversity by ISSR and SRAP profiling analyses, PLoS One 10 (2015) e0130881. [5] Y. Hao, R. Parks, C. Cowger, Z. Chen, Y. Wang, D. Bland, J.P. Murphy, M. Guedira, G. Brown-Guedira, J. Johnson, Molecular characterization of a new powdery mildew resistance gene Pm54 in soft red winter wheat, Theor. Appl. Genet. 128 (2014) 465–476. [6] R.A. McIntosh, J. Dubcovsky, W.J. Rogers, C. Morris, R. Appels, X.C. Xia, Catalogue of gene symbols for wheat: 2013–2014, https://shigen.nig.ac.jp/wheat/komugi/genes/macgene/supplement2013.pdf. 8

ACCEPTED MANUSCRIPT [7] L.M. Miranda, J.P. Murphy, D. Marshall, C. Cowger, S. Leath, Chromosomal location of Pm35, a novel Aegilops tauschii derived powdery mildew resistance gene introgressed into common wheat (Triticum aestivum L.), Theor. Appl. Genet. 114 (2007) 1451–1456. [8] P.T. Ma, H.X. Xu, Y.F. Xu, L.H. Li, Y.M. Qie, Q.L. Luo, X.T. Zhang, X.Q. Li, Y.L. Zhou, D. An, Molecular mapping of a new powdery mildew resistance gene Pm2b in Chinese breeding line KM2939. Theor Appl Genet. 128(2015) 613–622. [9] R.A. McIntosh, E. P. Baker, Cytogenetical studies in wheat iv. Chromosome location and linkage studies involving the PM2 locus for powdery mildew resistance, Euphytica 19 (1970) 71–77. [10] J. Sánchez-Martín, B. Steuernagel, S. Ghosh, G. Herren, S. Hurni, N. Adamski, J. Vrána, M. Kubaláková,

PT

S.G. Krattinger, T. Wicker, J. Doležel, B. Keller, B.B.H. Wulff, Rapid gene isolation in barley and wheat by mutant chromosome sequencing, Genome Biol. 17 (2016) 221.

[11] H.X. Xu, Y.J. Yi, P.T. Ma, Y.M. Qie, X.Y.Fu, Y.F. Xu, X.T. Zhang, D. An, Molecular tagging of a new

RI

broad-spectrum powdery mildew resistance allele Pm2c in Chinese wheat landrace Niaomai, Theor. Appl. Genet. 128 (2015) 2077–2084.

SC

[12] F.J. Zeller, S.L.K. Hsam, Progress in breeding for resistance to powdery mildew in common wheat (Triticum aestivum L.), in: A.E. Slinkard, R.A. McIntosh (Eds), Proceedings of the Ninth International Wheat Genetics Symposium, August 2–7, 1998, Saskatoon, Saskatchewan, Canada, 1998, pp. 178–180.

NU

[13] M. Schmolke, V. Mohler, L. Hartl, F.J. Zeller, S.L.K. Hsam, A new powdery mildew resistance allele at the Pm4 wheat locus transferred from einkorn (Triticum monococcum), Mol. Breed. 29 (2012) 449–456.

MA

[14] R.A. McIntosh, J. Dubcovsky, W.J. Rogers, C. Morris and X.C. Xia, Catalogue of gene symbols for wheat: 2017 supplement, http://www.shigen.nig.ac.jp/wheat/komugi/genes/symbolClassList.jsp. [15] P. Ma, H.X. Xu, L.H. Li, H.X. Zhang, G.H. Han,Y.F. Xu, X.Y. Fu, X.T. Zhang, D. An, Characterization of a new Pm2 allele conferring powdery mildew resistance in the wheat germplasm line FG-1, Front Plant Sci. 7

D

(2016) 546.

PT E

[16] H.J. Li, X.M. Wang, F.J. Song, C.P. Wu, X.F. Wu, N. Zhang, Y. Zhou, X.Y. Zhang, Response to powdery mildew and detection of resistance genes in wheat cultivars from China, Acta Agron. Sin. 37 (2011) 943–954 (in Chinese with English abstract).

[17] J.Z. Jia, S.C. Zhao, X.Y. Kong, Y.R. Li, G.Y. Zhao, W.M. He, R.D. Appels, M. Pfeifer, Y. Tao, X.Y. Zhang,

CE

R.L. Jing, C. Zhang, Y.Z. Ma, L.F. Gao, C. Gao, M. Spannagl, K. F. X. Mayer, D. Li, S.K. Pan, F.Y. Zheng, Q. Hu, X.C. Xia, J.W. Li, Q.S. Liang, J. Chen, T. Wicker, C.Y. Gou, H.H. Kuang, G.Y. He, Y.D. Luo, B. Keller, Q.J. Xia, P. Lu, J.Y. Wang, H.F. Zou, R.Z. Zhang, J.Y. Xu, J.L. Gao, C. Middleton, Z.W. Quan, G.M.

AC

Liu, J. Wang, IWGSC, H.M. Yang, X. Liu, Z.H. He, L. Mao, J. Wang, Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation, Nature 496 (2013) 91–95. [18] H.Q. Ling, S. Zhao, D. Liu, J. Wang, H. Sun, C. Zhang, H. Fan, D. Li, L. Dong, Y. Tao, C. Gao, H.L. Wu, Y.W. Li, Y. Cui, X.S. Guo, S.S. Zheng, B. Wang, K. Yu, Q.S. Liang, W.L. Yang, X.Y. Lou, J. Chen, M.J. Feng, J.B. Jian, X.F. Zhang, G.B. Luo, Y. Jiang, J.J. Liu, Z.B. Wang, Y.H. Sha, B.R. Zhang, H.J. Wu, D.Z. Tang, Q.H. Shen, P.Y. Xue, S.H. Zou, X.J. Wang, X. Liu, F.M. Wang, Y.P. Yang, X.L. An, Z.Y. Dong, K.P. Zhang, X.Q. Zhang, M.C. Luo, J. Dvorak, Y.P. Tong, J. Wang, H.M. Yang, Z.S. Li, D.W. Wang, A.M. Zhang, J. Wang, Draft genome of the wheat A-genome progenitor Triticum urartu, Nature 496 (2013) 87–90. [19] N. Yahiaoui, P. Srichumpa, R. Dudler, B. Keller, Genome analysis at different ploidy levels allows cloning of the powdery mildew resistance gene Pm3b from hexaploid wheat, Plant J. 37 (2004) 528–538. [20] R. Michelmore, Molecular approaches to manipulation of disease resistance genes, Annu. Rev. Phytopathol. 33 (1995) 393–427. 9

ACCEPTED MANUSCRIPT [21] S. Landjeva, V. Korzun, A. Börner, Molecular markers: actual and potential contributions to wheat genome characterization and breeding, Euphytica 156 (2007) 271–296. [22] P.T. Ma, H.X. Xu, Y.F. Xu, L.H. Li, Y.M. Qie, Q.L. Luo, X.T. Zhang, X.Q. Li, Y.L. Zhou, D.G. An, Molecular mapping of a new powdery mildew resistance gene Pm2b in Chinese breeding line KM2939, Theor. Appl. Genet. 128 (2015) 613–622. [23] Z. Liu, Q. Sun, Z. Ni, T. Yang, R.A. McIntosh, Development of SCAR markers linked to the Pm21 gene conferring resistance to powdery mildew in common wheat, Plant Breed. 118 (1999) 215–219. [24] F.S. Zeng, L.J. Yang, S.J. Gong, W.Q. Shi, X.J. Zhang, H. Wang, L.B. Xiang, M.F. Xue, D.Z. Yu, Virulence and diversity of Blumeria graminis f. sp. tritici populations in China, J. Integr. Agric. 13 (2014) 2424–2437.

PT

[25] M.A. Saghai-Maroof, K.M. Soliman, R.A. Jorgensen, R.W. Allard, Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics, Proc. Natl. Acad. Sci. U.S.A. 81 (1984) 8014–8018.

RI

[26] R.W. Michelmore, I. Paran, R.V. Kesseli, Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating

SC

populations, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 9828–9832.

[27] J. Guo, X.L. Zhang, Y.L. Hou, J.J. Cai, X.R. Shen, T.T. Zhou, H.H. Xu, H.W. Ohm, H.W. Wang, A.F. Li, F.P. Han, H.G. Wang, L.R. Kong, High-density mapping of the major FHB resistance gene Fhb7 derived

NU

from Thinopyrum ponticum and its pyramiding with Fhb1 by marker-assisted selection, Theor. Appl. Genet. 128 (2015) 2301–2316.

MA

[28] R. Brenchley, M. Spannagl, M. Pfeifer, G.L.A. Barker, R. D’Amore, A.M. Allen, N. McKenzie, M. Kramer, A. Kerhornou, D. Bolser,S. Kay, D. Waite, M. Trick, I. Bancroft, Y. Gu, N.X. Huo, M.C. Luo, S. Sehgal, B. Gill, S. Kianian, O. Anderson, P. Kersey, J. Dvorak, W.R. McCombie, A. Hall, K.F.X. Mayer, K.J. Edwards, M.W. Bevan, N. Hall, Analysis of the bread wheat genome using whole-genome shotgun sequencing, Nature

D

491 (2012) 705–710.

PT E

[29] J.W. Van Ooijen, JoinMap: version 4.0: software for the calculation of genetic linkage maps in experimental population, Kyazma B.V., Wageningen, The Netherlands, 2006. [30] D.D. Kosambi, The estimation of map distances from recombination values, Ann. Eugenics 12 (1943) 172– 175.

CE

[31] R.A. McIntosh, F.G.A. Bennett, Cytogenetical studies in wheat. IX. Monosomic analyses, telocentric mapping and linkage relationships of genes Sr21, Pm4 and Mle, Aust. J. Biol. Sci. 32 (1979) 115–126. [32] J.S. Niu, B.Q. Wang, Y.H. Wang, A.Z. Cao, Z.J. Qi, T.M. Shen, Chromosome location and microsatellite 346–349.

AC

markers linked to a powdery mildew resistance gene in wheat line ‘Lankao 90 (6)’, Plant Breed. 127 (2008) [33] Z.D. Zhu, R.H. Zhou, X.Y. Kong, Y.C. Dong, J.Z. Jia, Microsatellite markers linked to 2 powdery mildew resistance genes introgressed from Triticum carthlicum accession PS5 into common wheat, Genome 48 (2005) 585–590. [34] V. Mohler, C. Bauer, G. Schweizer, H. Kempf, L. Hartl, Pm50: a new powdery mildew resistance gene in common wheat derived from cultivated emmer, J. Appl. Genet. 54 (2013) 259–263. [35] W.G. Xu, C.X. Li, L. Hu, H.W. Wang, H.B. Dong, J.Z. Zhang, X.C. Zan, Identification and molecular mapping of PmHNK54: a novel powdery mildew resistance gene in common wheat, Plant Breed. 130 (2011) 603–607. [36] B.S. Fu, Y. Chen, N. Li, H.Q. Ma, Z.X. Kong, L.X. Zhang, H.Y. Jia, Z.Q. Ma, PmX: a recessive powdery mildew resistance gene at the Pm4 locus identified in wheat landrace Xiaohongpi, Theor. Appl. Genet. 126 (2013) 913–921. 10

ACCEPTED MANUSCRIPT [37] Z.Q. Ma, M.E. Sorrells, S.D. Tanksley, RFLP markers linked to powdery mildew resistance genes Pm1, Pm2, Pm3, and Pm4 in wheat, Genome 37 (1994) 871–875. [38] Y.F. Hao, A.F. Liu, Y.H. Wang, D.S. Feng, J.R. Gao, X.F. Li, S.B. Liu, H.G. Wang, Pm23: a new allele of Pm4 located on chromosome 2AL in wheat, Theor. Appl. Genet. 117 (2008) 1205–1212. [39] H. Muranty, M.T. Pavoine, B. Jaudeau, W. Radek, G. Doussinault, D. Barloy, A quantitative approach detects three QTLs involved in powdery mildew resistance at the seedling stage in the winter wheat line RE714, Crop Pasture Sci. 59 (2008) 714–722. [40] Z.Q. Ma, J.B. Wei, S.H. Cheng, PCR-based markers for the powdery mildew resistance gene Pm4a in wheat,

AC

CE

PT E

D

MA

NU

SC

RI

PT

Theor. Appl. Genet. 109 (2004) 140–145.

11