- Email: [email protected]
Molecular profiling of single cells in response to mechanical force: Comparison of chondrocytes, chondrons and encapsulated chondrocytes
Biomaterials 31 (2010) 1619–1625
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Molecular profiling of single cells in response to mechanical force: Comparison of chondrocytes, chondrons and encapsulated chondrocytes Qi Guang Wang a,1, Bac Nguyen b, 2, Colin R. Thomas b, 3, Zhibing Zhang b, 2, Alicia J. El Haj a, *, Nicola J. Kuiper a,1 a b
Institute for Science & Technology in Medicine, University of Keele, Staffordshire ST5 5BG, UK School of Chemical Engineering, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 September 2009 Accepted 13 November 2009 Available online 1 December 2009
A chondrocyte and its surrounding pericellular matrix (PCM) are defined as a chondron. The PCM plays a critical role in enhancing matrix production, protecting the chondrocyte during loading and transducing mechanical signals. Tissue engineering involves the design of artificial matrices which aim to mimic PCM function for mechanical strength and signalling motifs. We compare the mechanical performance and mechanoresponsiveness of chondrocytes with and without PCM, and encapsulated by alternate adsorption of two oppositely charged polyelectrolytes; chitosan and hyaluronan. Zeta potential measurements confirmed the success of the encapsulation. Encapsulation did not influence chondrocyte viability or metabolic activity. Cells were compressed by micromanipulation with final deformations to 30%, 50% and 70%. Force–displacement data showed that the larger the deformation at the end of compression, the greater the force on the cell. Mechanoresponsiveness of cells was studied by combining single cell PCR with dynamic compression at 20% and 40%. Aggrecan and Type II collagen gene expression were significantly increased in encapsulated chondrocytes and chondrons compared to chondrocytes whereas dynamic compression had no effect on SOX9 or lubricin gene expression. Our results demonstrate that although encapsulation can mimic responses of chondrocytes to biomechanical compression the molecular profile did not reach the enhanced levels observed with chondrons. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Single cell encapsulation Chondrocytes Chondron Pericellular matrix Chitosan Hyaluronan
1. Introduction Treatment options for damaged adult articular cartilage are still limited. Many strategies have been proposed to enhance the chondrogenic ability of adult chondrocytes in order to tailor more successful approaches to cell therapy [1] and cartilage tissue engineering [2,3]. Within articular cartilage, chondrocytes are encapsulated by their immediate pericellular matrix (PCM) to form chondrons [4]. The presence of the PCM affects every interaction around the cell. Soluble and insoluble components such as signalling molecules, proteolytic enzymes, metabolites, nutrients all need
* Corresponding author. Guy Hilton Research Centre, Institute for Science & Technology in Medicine, Thornburrow Drive, Hartshill, Stoke-on-Trent, University of Keele, ST4 7QB, UK. Tel.: þ44 1782 554 253; fax: þ44 1782 747 319. E-mail addresses: [email protected] (Q.G. Wang), bac.v.nguyen@googlemail. com (B. Nguyen), [email protected] (C.R. Thomas), [email protected] (Z. Zhang), [email protected] (A.J. El Haj), [email protected] (N.J. Kuiper). 1 Tel.: þ44 01782733683. 2 Tel.: þ44 1214145334. 3 Tel.: þ44 1214145355. 0142-9612/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2009.11.021
to penetrate this matrix to reach the cell membrane. The surrounding PCM is thought to play a critical role in enhancing matrix production [5], protecting the chondrocyte during loading [6], and transducing mechanical signals [7]. Currently, chondrocytes isolated without a PCM are the preferred choice for cartilage tissue engineering studies. A small number of studies have shown that the removal of the PCM during chondrocyte isolation can have a negative effect on subsequent matrix production in vitro [5,8]. Therefore the PCM may be an important factor to consider in the design of tissue engineering strategies which aim to mimic PCM function for mechanical strength and signalling motifs. The composition of the PCM has been well characterised in tissue sections [9] and around individual cells [10]. It is a narrow region of matrix immediately surrounding nearly all chondrocytes in adult articular cartilage. It is rich in sulphated and non-sulphated glycosaminoglycans (GAGs), large and small proteoglycans, and collagens. Chondrocytes can be isolated with or without their in vivo PCM [10]. Retention of the in vivo PCM has been reported to influence chondrocyte gene expression positively [11] and to stabilise the chondrocyte phenotype [5]. These findings are supported by experimental data that show that chondrons cultured in
1620
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
alginate bead [12,13] or in high density pellet cultures [8] produce significantly more extracellular matrix (ECM) than chondrocytes in similar conditions. Enzymatically isolated chondrocytes produce a new PCM in a matter of hours [14]. However, the newly formed PCM is different to the PCM surrounding freshly isolated chondrons and it can interfere with the formation of further ECM [14]. These findings indicate that controlling the cell-microenvironment may be important. Although much is known about cartilage as a whole, there is a paucity of information about the biomechanical properties of the chondron and the precise function of its PCM. It is widely accepted that the PCM plays an important role in defining the mechanical environment of the chondrocyte [7]. For example, previous work has shown that different types of mechanical compression can influence matrix deposition [15–18]. Static compression of cartilage explants stimulates matrix deposition in the PCM [18]. Conversely, dynamic compression of cartilage explants stimulates matrix deposition in the ECM. These findings suggest that the PCM acts as a transducer of mechanical signals. The precise mechanism is unclear but the PCM may influence the local deformation around chondrocytes and the transport of matrix components [6,17]. Our recent work has shown that the PCM provides a protective role during loading by reducing the local deformation on the chondrocyte [19]. In these studies well-defined forces were applied to single chondrocytes and chondrons and subsequent changes in the gene expression were determined by single cell PCR. Our results demonstrated a clear role for the PCM in interfacing the mechanical signalling in chondrocytes in response to dynamic compression. Understanding how the PCM influences the cells response to biomechanical compression will ultimately improve our knowledge of how the cell responds at the tissue level. An alternative approach to investigate the role of the PCM on chondrocyte behaviour would be to encapsulate individual chondrocytes with ECM components. Single living cells can be encapsulated by alternate deposition of oppositely charged polyions onto charged substrates allowing the assembly of polyelectrolyte multilayers [20,21]. This encapsulation approach is mild and does not involve covalent interaction. Previous work has shown that single cell encapsulation resulted in an increased stiffness of the cell compared to the non-encapsulated cell [20]. In this study, to define key elements required for tissue engineering we encapsulate single chondrocytes by the alternate adsorption of the oppositely charged biocompatible polyelectrolytes; chitosan (CHI) and the non-sulphated GAG, hyaluronan (HA). CHI shares many structural characteristics with HA but it carries an opposite charge [22]. After encapsulation, the viability and metabolic activity were assessed. Single chondrocytes, chondrons or encapsulated cells were compressed to various deformations and the force versus displacement data were obtained. In addition, we investigated the response of single encapsulated chondrocytes to dynamic loading by combining a single cell PCR approach with different levels of dynamic compression. 2. Materials and methods 2.1. Chondrocyte and chondron isolation Full depth articular cartilage was dissected from the articulating surface of the trochleal humerus of 18-month-old cows. Four separate isolations were performed, each using one humerus. Enzymatic chondrocyte and chondron isolations were performed using our previously published methodology [10]. For chondrocytes, diced cartilage was sequentially digested with 700 U/ml Pronase EÔ for 1 h, then 200 U/ml collagenase XI and 0.1 mg/ml DNase 1 for 16 h. For chondrons, diced cartilage was digested with 3.3 U/ml dispase and 560 U/ml collagenase type XI in Dulbecco’s Modified Eagle’s Medium (DMEM) for 5 h. Chondrocytes or chondrons were filtered through a 70 mm cell sieve and washed three times in DMEM
supplemented with 10% (v/v) fetal calf serum (FCS). These conditions achieved optimal cell viability and cell yield [10]. 2.2. Encapsulation of chondrocytes using chitosan (CHI) and hyaluronan (HA) The encapsulation procedure was based upon the work of Diaspro et al. [21]. Essentially, the negatively charged chondrocyte membrane was encased within a cationic CHI polymeric shell and then an anionic HA polymeric shell. A CHI stock solution (20–50 mg/ml; 1.3 105 Da, with 25% acetylation, P&G Company Ltd., UK) was diluted to give a concentration of 1–2.5 mg/ml in Hank’s Balanced Salt Solution (HBSS). This was added to a 1 ml suspension of bovine chondrocytes in HBSS to make a final concentration of 5 106/ml. After 15 min, the cell preparation was washed three times with HBSS to remove any excess unadsorbed polyelectrolyte. An HA stock solution (15 mg/ml; Hyaltech Ltd., Edinburgh, UK) was diluted to give a concentration of (1 mg/ml) in HBSS and added to the cell suspension. After 15 min, excess unadsorbed polyelectrolyte was removed as before. In this preliminary study chondrocytes were only encapsulated with one layer of CHI and one layer of HA. 2.3. Zeta potential measurement to assess layer by layer deposition Zeta potential was used to assess the layer by layer deposition [23]. Samples (5 ml) containing 0.2 106 cells/ml in Phosphate Buffered Saline (PBS, pH 7.3) were measured with the Zeta master (ZEM, Malvern Instruments Ltd., UK). Sample 1 was the negatively charged chondrocytes. Sample 2 was the chondrocytes encapsulated with CHI alone. Sample 3 was the chondrocytes encapsulated with both CHI and HA. Each sample was tested 10 times. Statistical differences in zeta potential voltage between samples were examined using the student’s t-test with two significance levels; *p < 0.05 and **p < 0.01. Comparisons were made between sample 1 and sample 2, sample 2 and sample 3. 2.4. Validation of the chondrocyte encapsulation process First chondrocytes were encapsulated with fluorescein isothiocyanate isomer Ilabelled CHI (FITC-CHI). Briefly, CHI was dissolved in HBSS to give a concentration of 1–2.5 mg/ml. FITC (2 mg/5 ml) was added to this CHI solution and the mixture was stirred for 24 h at room temperature in the dark. The mixture was purified by cellulose acetate film dialysis. Following dialysis, FITC-CHI was mixed with bovine chondrocytes to give a final concentration of 5 106 cells/ml. After 15 min, the cell preparation was washed three times with HBSS to remove any excess unadsorbed FITC-CHI. After encapsulation, chondrocytes were left for 4 h at 4 C and then counterstained with propidium iodide. It was used to help localise cells under the fluorescent microscope. Finally, encapsulated chondrocytes were viewed under a fluorescent microscope (Leica). 2.5. Pellet cultures and their analyses To ensure that the polyelectrolyte coating did not influence chondrocyte metabolism, chondrocytes and encapsulated chondrocytes were pellet cultured for 7 days. Briefly, 1 106 cells (n ¼ 4) were gently spun (1000 rpm) in 0.5 ml of DMEMþ10% FCS in microcentrifuge tubes for 5 min to form a pellet. Pellets were cultured in a humidified incubator at 37 C in 5% CO2. Media were changed daily. Pellets were assessed at days 1, 3, 5, and 7. Cell number was determined by PicogreenÔ DNA quantitation using calf thymus DNA as standard [24]. Cell viability was assessed using Trypan blue exclusion and Live/Dead Cell Double Staining Kit (BioChemika) [25]. The Live/Dead Cell Kit stained viable cells green with calcein-AM and non-viable cells red with propidium iodide. Two hundred cells were counted in three separate regions of each pellet (4 replicates). These data are expressed as a percentage. Total sulphated glycosaminoglycan (GAG) content was determined using dimethylmethylene blue (DMMB) dye [26]. Absorbance at 490 nm was read against a standard curve of chondroitin sulphate. 2.6. Single cell static compression Single cells were compressed to given deformations between two parallel surfaces at a pre-set speed; the flat end of a force probe made of glass fibre and the flat bottom surface of the glass chamber in a micromanipulation compression tester. Details of this technique are described elsewhere [27–29]. Briefly, the glass probe is connected to a force transducer which has a response of 500 mN full scale at a resolution of 0.01 mN. The probe is driven downwards by a vertical stepping motor, compressing the cell in liquid medium in the glass chamber. During their compression, single cells can be observed microscopically and images can be collected using a high-speed camera (500 frames per second images at 510 484 pixels resolution). Cell deformation is defined as the ratio between the applied displacement in the direction of compression and the original cell diameter. The original cell diameter was measured based on its 2D side view image as previously described [27–29]. Twenty two single chondrocytes, chondrons and encapsulated chondrocytes were obtained for compression tests. The specimens were compressed by micromanipulation to final deformations of 30%, 50% and 70% successively. The cells were
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625 compressed to a final deformation of 30%, held for approximate 3 s, and then the load was released. This process was then repeated on the same cells for final deformations of 50% and 70%, successively. The time between each compressionholding-release process was 2–3 min. During each compression test, data of the force imposed on a single cell versus its displacement were obtained [19]. 2.7. Single cell dynamic compression Using micromanipulation, twelve single cells were cyclically loaded with a maximum deformation of 20% and 40% applied at a frequency at 0.3 Hz for 10 min. The two levels of deformation represent medium and high mechanical compression levels as previously described [19]. After dynamic compression, each cell was collected for single cell PCR with a CellTram Oil hydraulic microaspirator (1 mm diameter, 25–40 mm at the tip, Brinkmann, Westbury, NY) as previously reported [19] and either lysed immediately or incubated at 37 C for 18 h in serum-free media and then lysed. 2.8. Single cell PCR The detailed protocol for cell lysis, reverse transcription, cDNA pre-amplification and real-time qPCR used reagents and bovine primer/probe mixtures from Applied Biosystems/Ambion and has been previously reported [11]. In brief, each cell was lysed with cDNA II cell lysis buffer (AM8723). Two negative controls were also processed: a medium blank control comprising 1 ml DMEM þ 9 ml lysis buffer, and a lysis blank control, containing 10 ml lysis buffer. After degradation of genomic DNA, the RNA was reverse-transcribed in situ using the High Capacity cDNA RT Kit (4374966). Four extracellular matrix components were examined; Type II collagen, aggrecan, lubricin and osteopontin. One transcription factor was examined; SOX9 (Table 1). Gene expression was normalised to the housekeeping gene 18s rRNA. To multiply gene copy numbers to detectable levels, cDNA was first pre-amplified using TaqManÒ PreAmp Master Mix (4391128). Gene expression was individually quantified for all genes of interest using the Applied Biosytems 7300 Real-Time PCR system. Each gene was analysed in parallel with serially diluted cDNA standards prepared from bovine chondrocytes (data not shown).
1621
chondrocytes (green) which have been counterstained with propidium iodide (red). CHI-FITC can be seen around some chondrocytes. >95% of chondrocytes were successfully encapsulated. The percentage was determined by dividing the number of cells with a visible FITC-CHI layer by the counted population (sample size 400). Fig. 1B shows FITC-only treated chondrocytes which have been counterstained with propidium iodide. There was no FITC staining observed around the cells. 3.2. Zeta potential measurement Fig. 2 illustrates the zeta potential values of chondrocytes without encapsulation, chondrocytes after CHI deposition (chondrocyte-CHI), and chondrocytes after CHI followed by HA deposition (chondrocyte-CHI/HA). The zeta potential value of cells increased from 26.2 mV to 20.6 mV after CHI layer deposition. It then decreased to 28.6 mV after HA layer deposition. Each change in voltage was statistically significant. The trend of the changes in cell surface zeta potential had good agreement with values in the literature [30,31]. 3.3. Assessment of cell viability and metabolic activity To check the viability of cells and their metabolic activity after encapsulation we performed a 7-day time course experiment (Fig. 3). The cell viability, cell number and sulphated GAG production were assessed on days 1, 3, 5, and 7. All three analyses followed a similar trend for both encapsulated and non-encapsulated chondrocytes.
2.9. Statistical analysis
3.4. Force response data following single cell compression
All results are presented as a mean standard error of the mean (SEM). Statistical differences in gene expression at the same dynamic compression were examined using the student’s t-test with two significance levels; *p < 0.05 and **p < 0.01. Comparisons were made between chondrocytes and chondrons, chondrocytes and encapsulated chondrocytes, and encapsulated chondrocytes and chondrons.
Micromanipulation measurements demonstrated that the average diameter of the encapsulated chondrocytes was 0.3 mm larger than the average diameter of the unencapsulated chondrocytes. Fig. 4 shows representative force–displacement curves for a chondrocyte (Fig. 4A), a chondron (Fig. 4B) and an encapsulated chondrocyte (Fig. 4C) compressed to a final deformation of 30%, 50% and 70% (Fig. 4C) respectively, at a compression speed of 6 mm1. These data illustrate that increasing final deformation leads to greater forces on the cells. On average, the chondrocytes had a mean peak force at the end of compression (F0) of 0.17 0.02, 0.38 0.03 and 1.03 0.12 mN at 30%, 50% and 70% deformations respectively; chondrons had a mean F0 of 0.25 0.02, 0.54 0.04 and 1.25 0.21 mN at 30%, 50% and 70% deformation respectively; encapsulated chondrocytes had a mean F0 of 0.30 0.02, 0.47 0.03 and 1.37 0.16 mN at 30%, 50% and 70% deformations respectively. Paired student’s t-tests showed a significant difference in F0 at 30% and 50% deformation between chondrocytes and chondrons, and between chondrocytes and encapsulated chondrocytes (p < 0.05), but no significant difference between chondrons and encapsulated chondrocytes at such deformations. It also showed there were no significant differences in F0 at 70% deformation between chondrocytes, chondrons and encapsulated chondrocytes. These results are consistent with previous observations [19] which demonstrated that chondrons are stiffer than chondrocytes and show less pronounced viscoelastic behaviour. In our current work we have shown that encapsulation imparts the chondrocyte with resistance to mechanical force that is similar to but not the same as a chondron.
3. Results 3.1. Validation of the chondrocyte encapsulation process The FITC-CHI encapsulated chondrocytes were viewed under a fluorescent microscope. Fig. 1A shows the CHI-FITC encapsulated
Table 1 List of oligonucleotides used for real-time PCR. All oligonucleotides were designed using bovine-specific sequences. Target gene GeneBank number Amplicon size
Forward primer sequence Reverse primer sequence Probe sequence
COL2A1 X02420 73 bp
TTGACATTGCACCCATGGACATA CAAGAAGCAGACAGGCCCTAT CACACCGAATTCCTG
AGC1 U76615 73 bp
GGTCACGCTGCCCAACTA GTCATTGGAGCGCATGTTCTG ACGCCACCCTGGAAAT
SOX9 AF278703 76 bp
CCGGTGCGCGTCAAC GCGCCCACACCATGAAG ACGTGCGGCTTGTTCT
Lubricin AFD56218 88 bp
ACCTCCACCTCGGAGAATTACT AGTTTTTCCTTCACAGTTGCATCTAGT AATGCCCCAAACTTC
Osteopontin AF492837 67 bp
GCTTACGGACTGAAGTCAAGATCTA CTGTGGCATCTGGACTCTGAA TTCCGCCGATCTAACG
3.5. Gene expression Cells were dynamically compressed (20% or 40% deformation) at 0.3 Hz for 10 min. Measurable levels of at least one ECM gene were
1622
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
Fig. 1. Fluorescence micrographs of (A) CHI-FITC encapsulated chondrocytes, and (B) FITC-only treated chondrocytes. The red fluorescence and arrow indicate the locations of cell nuclei. Green fluorescence indicates the presence of CHI. Bar ¼ 10 mm.
detected in 11/12 encapsulated chondrocytes tested. Of these, 91.7% expressed Type II collagen, 87.5% expressed aggrecan, 70.8% expressed lubricin, and 83.3% expressed osteopontin. Fig. 5 shows the ECM gene expression data. Compared to non-encapsulated cells, encapsulation significantly increased Type II collagen at 40% cell deformation (p ¼ 0.015) but the difference was not significant at 20% cell deformation (p ¼ 0.37) (Fig. 5A). In contrast, at both 20% and 40% cell deformation Type II collagen was significantly increased in chondrons (p ¼ 0.047 and p ¼ 0.0131, respectively). At 20% cell deformation, Type II collagen gene expression was significantly higher in chondrons than in encapsulated chondrocytes but at 40% compression there was no significant difference between the two. Compared to non-encapsulated chondrocytes, aggrecan gene expression was generally increased with encapsulation at both 20% and 40% cell deformation levels, but not to the same level as the chondron (p ¼ 0.045 at 20% and p ¼ 0.028 at 40% cell deformation) (Fig. 5B). There was little difference in lubricin gene expression between the non-encapsulated chondrocytes, encapsulated chondrocytes and chondrons at 20% and 40% compression (Fig. 5C). Chondrocytes and encapsulated chondrocytes were significantly less responsive than chondrons with respect to osteopontin expression at 20% cell deformation (p ¼ 0.043 for chondrocytes and p ¼ 0.0014 for encapsulated chondrocytes) (Fig. 5D). Encapsulation improved the mechanoresponsiveness but not to the same degree
Fig. 2. The zeta potential values of unencapsulated chondrocytes, chondrocytes encapsulated with CHI alone, and chondrocytes encapsulated with both CHI and HA. Data are expressed as the mean SEM (n ¼ 4). * Represents p < 0.05.
Fig. 3. A 7-day time course experiment to demonstrate that the polyelectrolyte coating did not influence chondrocyte metabolism. Freshly isolated chondrocytes (unencapsulated) and chondrocytes encapsulated with CHI and HA (encapsulated) were assessed for (A) cell number, (B) cell viability, and (C) total sulphated GAG production after 1, 3, 5 and 7 days in culture. Data are expressed as the mean SEM (n ¼ 4).
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
1623
Fig. 4. Representative force–displacement curves of cells compressed to a final deformation of 30%, 50% and 70% for a single chondrocyte, diameter 8.9 mm (A), a single chondron, diameter 9.3 mm (B), and a single encapsulated chondrocyte, diameter 9.2 mm (C). Each cell was compressed at 6 mm s1.
Fig. 5. Gene expression of (A) aggrecan, (B) type II collagen, (C) lubricin and (D) osteopontin for chondrocytes, encapsulated chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 C for 18 h and then lysed. The data were normalised to 18s rRNA and represent mean SEM. Twelve cells were assessed and n represents the number of cells that were positive for each specific gene tested. * represents p < 0.05 and ** represents p < 0.01.
1624
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
as the native PCM. Finally, mechanical compression of encapsulated chondrocytes had no significant effect on SOX9 gene expression (Fig. 6). 4. Discussion In this study polyelectrolyte multilayer shells where successfully applied to chondrocytes. The layer by layer procedure was validated using two different approaches. In the first validation approach, chondrocytes were encapsulated with FITC-labelled CHI and visualised under a microscope. There was some variation in the intensity of the fluorescence amongst the encapsulated chondrocytes. This variation could be due to the differences in surface electrostatic charges within the enzymatically isolated chondrocyte population. Higher surface electrostatic charges would attract more encapsulation material. In the second validation approach zeta potential measurements were performed on chondrocytes, chondrocytes encapsulated with CHI only, and chondrocytes encapsulated with both CHI and HA. In our study, the magnitude and the trend in the zeta potential were in agreement with previous work [21,30]. Assessing zeta potential of cells is challenging since there is no wide agreement on the testing buffer for cells or the number of cells needed for an experiment. Different cell concentrations have been shown to affect the velocity of a migrating cell during the zeta potential measurement which has led to false values. Different buffers have been shown to negatively affect zeta potential reading [32]. The most important factor affecting zeta potential is the pH [33]. However when testing cells it is important to use a testing buffer with a physiological pH. In our assessment we tried a range of cell concentrations (0.2–2 million/ ml) and three different buffers; DMEM, HBSS and PBS (data not shown). The zeta potential readings for HBSS were highly scattered and negatively charged. We could not complete the measurement for DMEM since it generated too many bubbles in the measurement container. PBS gave the most stable readings and the zeta potential
Fig. 6. Gene expression of SOX9 for chondrocytes, encapsulated chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 C for 18 h and then lysed. The data were normalised to 18s rRNA and represent mean SEM. Twelve cells were assessed and n represents the number of cells that were positive for each specific gene tested.
was almost neutral. At cell concentration below 0.5 million/ml the readings were the most stable. Consequently a cell concentration of 0.2 million/ml was used in further measurements. The biological properties of the encapsulated chondrocytes were preserved. A 7-day pellet culture study demonstrated that encapsulated chondrocytes and non-encapsulated chondrocytes had comparable cell number, cell viability, and sulphated GAG production. GAGs are one of the major macromolecular components constituting the ECM. Most sulphated GAG chains are covalently linked to core proteins to form proteoglycans, which are located at the cell surface and in the ECM. Encapsulated chondrocytes were able to maintain sulphated GAG synthesis at almost identical levels to unencapsulated chondrocytes which suggests that encapsulation did neither interfere with GAG synthesis nor release into the surrounding ECM. Thus we can conclude that the approach used for the assembly of polyelectrolyte multilayers was mild and did not involve covalent interaction. Encapsulation provided mechanical protection to the chondrocytes and even appeared to mimic the mechanical properties of chondrons. First, single encapsulated chondrocytes, chondrons and chondrocytes were compressed by micromanipulation with final deformations of 30%, 50% and 70%. Force–displacement curves showed that the larger the deformation at the end of compression, the greater the force on the cell (and also the larger the subsequent force relaxation, see [19]). There were no significant differences in force–displacement relations between encapsulated chondrocytes and chondrons, but both required higher forces to achieve 30% and 50% deformation than the chondrocytes. There was no significant difference in the force corresponding to 70% deformation among chondrocytes, encapsulated chondrocytes and chondrons, which suggests that the resistance to deformation at such level might be dominated by intracellular component, such as cell nucleus. Overall, encapsulating chondrocytes creates a construct with stiffness similar to a chondron. Second, single encapsulated chondrocytes, chondrons and chondrocytes were dynamically compressed to 20% and 40% load. The two levels of deformation represent medium and high mechanical compression levels [19]. After dynamic compression, each cell was collected for single cell RT-PCR. Generally the results showed how the presence of the PCM enhanced the loading responsiveness to 20% and 40% load. In particular expressions of type II collagen and aggrecan genes in encapsulated chondrocytes were more responsive to dynamic loading than those in chondrocytes, although not to the same extent as in chondrons. There were no noticeable differences in the other genes tested. By contrast the mechanical strength was restored. These results may demonstrate how adhesion to HA alone may not be sufficient to reproduce the mature cell response and that other factors may be required. Our single cell RT-PCR approach has some limitations. The complex and time consuming procedure of dynamically loading single cells is restrictive. As a consequence we were only able to examine a single time point and therefore we were not able to determine changes in gene expression over time. Despite this, the results of this study have clearly demonstrated that polyelectrolyte multilayer shells can be applied to individual chondrocytes. The encapsulation procedure that we present herein serves as a model for defining the precise roles of the PCM. The inclusion of other components within the polyelectrolyte cell coat could provide interesting methods of influencing cellular behaviour. 5. Conclusion This study has shown that polyelectrolyte multilayer shells can be applied to chondrocytes, whilst preserving their biological properties and improving their biomechanical properties. A 7-day
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
pellet culture study demonstrated that encapsulated chondrocytes and non-encapsulated chondrocytes had comparable cell number, cell viability, and sulphated GAG production. Encapsulation provided mechanical protection to the chondrocytes and even appeared to mimic the mechanical properties of chondrons. Moreover, encapsulation bridged the gap in mechanoresponsiveness between chondrocytes and chondrons. These findings may be useful for designing artificial matrices for tissue engineering which aim to mimic PCM function for mechanical strength and signalling motifs. Acknowledgments This work was supported by the EPSRC (EP/C511727/1). We thank our industrial collaborator, Mr Barry White, Hyaltech Ltd., Edinburgh, UK for providing the hyaluronan. Author disclosure statement The authors have no competing financial interests. Appendix Figures with essential colour discrimination. Figs. 1 and 4 in this article may be difficult to interpret in black and white. The full colour images can be found in the on-line version, at doi:10.1016/ j.biomaterials.2009.11.021. References [1] Goldberg AJ, Lee DA, Bader DL, Bentley G. Autologous chondrocyte implantation. Culture in a TGF-beta-containing medium enhances the re-expression of a chondrocytic phenotype in passaged human chondrocytes in pellet culture. J Bone Joint Surg Br 2005;87:128–34. [2] Smith P, Shuler FD, Georgescu HI, Ghivizzani SC, Johnstone B, Niyibizi C, et al. Genetic enhancement of matrix synthesis by articular chondrocytes: comparison of different growth factor genes in the presence and absence of interleukin-1. Arthritis Rheum 2000;43:1156–64. [3] Woodfield TB, Miot S, Martin I, van Blitterswijk CA, Riesle J. The regulation of expanded human nasal chondrocyte re-differentiation capacity by substrate composition and gas plasma surface modification. Biomaterials 2006;27:1043–53. [4] Poole CA. Articular cartilage chondrons: form, function and failure. J Anat 1997;191(Pt 1):1–13. [5] Graff RD, Kelley SS, Lee GM. Role of pericellular matrix in development of a mechanically functional neocartilage. Biotechnol Bioeng 2003;82:457–64. [6] Knight MM, Ross JM, Sherwin AF, Lee DA, Bader DL, Poole CA. Chondrocyte deformation within mechanically and enzymatically extracted chondrons compressed in agarose. Biochim Biophys Acta 2001;1526:141–6. [7] Guilak F, Alexopoulos LG, Upton ML, Youn I, Choi JB, Cao L, et al. The pericellular matrix as a transducer of biomechanical and biochemical signals in articular cartilage. Ann N Y Acad Sci 2006;1068:498–512. [8] Larson CM, Kelley SS, Blackwood AD, Banes AJ, Lee GM. Retention of the native chondrocyte pericellular matrix results in significantly improved matrix production. Matrix Biol 2002;21:349–59.
1625
[9] Poole CA, Honda T, Skinner SJ, Schofield JR, Hyde KF, Shinkai H. Chondrons from articular cartilage (II): analysis of the glycosaminoglycans in the cellular microenvironment of isolated canine chondrons. Connect Tissue Res 1990;24:319–30. [10] Wang QG, El Haj AJ, Kuiper NJ. Glycosaminoglycans in the pericellular matrix of chondrons and chondrocytes. J Anat 2008;213:266–73. [11] Wang QG, Magnay JL, Nguyen B, Thomas CR, Zhang Z, El Haj AJ, et al. Gene expression profiles of dynamically compressed single chondrocytes and chondrons. Biochem Biophys Res Commun 2009;379:738–42. [12] Lee GM, Caterson B. When cultured in alginate beads, chondrons produce a more fibrillar matrix than isolated chondrocytes. Trans Orthop Res Soc 1995;20:394. [13] Kelley SS, Blackwood AD, Caterson B, Lee GM. Retention of the in vivo-formed pericellular matrix affects proteoglycan synthesis in vitro. Trans Orthop Res Soc 1996;21:768. [14] Lee GM, Loeser RF. Interactions of the chondrocyte with its pericellular matrix. Cell Mater 1998;8:135–49. [15] Adams MA. The mechanical environment of chondrocytes in articular cartilage. Biorheology 2006;43:537–45. [16] Buschmann MD, Gluzband YA, Grodzinsky AJ, Hunziker EB. Mechanical compression modulates matrix biosynthesis in chondrocyte/agarose culture. J Cell Sci 1995;108(Pt 4):1497–508. [17] Greco F, Specchia N, Falciglia F, Toesca A, Nori S. Ultrastructural analysis of the adaptation of articular cartilage to mechanical stimulation. Ital J Orthop Traumatol 1992;18:311–21. [18] Quinn TM, Grodzinsky AJ, Buschmann MD, Kim YJ, Hunziker EB. Mechanical compression alters proteoglycan deposition and matrix deformation around individual cells in cartilage explants. J Cell Sci 1998;111(Pt 5):573–83. [19] Nguyen BV, Wang Q, Kuiper NJ, El Haj AJ, Thomas CR, Zhang Z. Straindependent viscoelastic behaviour and rupture force of single chondrocytes and chondrons under compression. Biotechnol Lett 2009;31:803–9. [20] Svaldo-Lanero T, Krol S, Magrassi R, Diaspro A, Rolandi R, Gliozzi A, et al. Morphology, mechanical properties and viability of encapsulated cells. Ultramicroscopy 2007;107:913–21. [21] Diaspro A, Silvano D, Krol S, Cavalleri O, Gliozzi A. Single living cell encapsulation in nano-organized polyelectrolyte shells. Langmuir 2002;18:5047–50. [22] Suh JK, Matthew HW. Application of chitosan-based polysaccharide biomaterials in cartilage tissue engineering: a review. Biomaterials 2000;21:2589–98. [23] Fuerstenau MC. Chemistry of flotation. New York: SME/AIME; 1985. [24] Ahn SJ, Costa J, Emanuel JR. PicoGreen quantitation of DNA: effective evaluation of samples pre- or post-PCR. Nucleic Acids Res 1996;24:2623–5. [25] Yoshida S, Yamada K, Hamaguchi K, Nishimura M, Hatakeyama E, Tsuchida H, et al. Immunohistochemical study of human advanced glycation end-products (AGE) and growth factors in cardiac tissues of patients on maintenance dialysis and with kidney transplantation. Clin Nephrol 1998;49:273–80. [26] Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta 1986;883:173–7. [27] Zhang Z, Ferenczi MA, Lush AC, Thomas CR. A novel micromanipulation technique for measuring the bursting strength of single mammalian cells. Appl Microbiol Biotechnol 1991;36:208–10. [28] Mashmoushy H, Zhang Z, Thomas CR. Micromanipulation measurement of the mechanical properties of Baker’s yeast cells. Biotechnol Tech 1998;12:925–9. [29] Wang CX, Cowen C, Zhang Z, Thomas CR. High-speed compression of single alginate microspheres. Chem Eng Sci 2005;60:6649–57. [30] Veerabadran NG, Goli PL, Stewart-Clark SS, Lvov YM, Mills DK. Nanoencapsulation of stem cells within polyelectrolyte multilayer shells. Macromol Biosci 2007;7:877–82. [31] Zahr AS, Pishko MV. Encapsulation of paclitaxel in macromolecular nanoshells. Biomacromolecules 2007;8:2004–10. [32] Burns DB, Zydney AL. Buffer effects on the zeta potential of ultrafiltration membranes. J Membr Sci 2000;172:39–48. [33] Tippe A. Electrophoretic measurements about the relation between transition voltage and zeta-potential of biological membranes. Biochim Biophys Acta 1981;641:395–400.
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Molecular profiling of single cells in response to mechanical force: Comparison of chondrocytes, chondrons and encapsulated chondrocytes Qi Guang Wang a,1, Bac Nguyen b, 2, Colin R. Thomas b, 3, Zhibing Zhang b, 2, Alicia J. El Haj a, *, Nicola J. Kuiper a,1 a b
Institute for Science & Technology in Medicine, University of Keele, Staffordshire ST5 5BG, UK School of Chemical Engineering, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 September 2009 Accepted 13 November 2009 Available online 1 December 2009
A chondrocyte and its surrounding pericellular matrix (PCM) are defined as a chondron. The PCM plays a critical role in enhancing matrix production, protecting the chondrocyte during loading and transducing mechanical signals. Tissue engineering involves the design of artificial matrices which aim to mimic PCM function for mechanical strength and signalling motifs. We compare the mechanical performance and mechanoresponsiveness of chondrocytes with and without PCM, and encapsulated by alternate adsorption of two oppositely charged polyelectrolytes; chitosan and hyaluronan. Zeta potential measurements confirmed the success of the encapsulation. Encapsulation did not influence chondrocyte viability or metabolic activity. Cells were compressed by micromanipulation with final deformations to 30%, 50% and 70%. Force–displacement data showed that the larger the deformation at the end of compression, the greater the force on the cell. Mechanoresponsiveness of cells was studied by combining single cell PCR with dynamic compression at 20% and 40%. Aggrecan and Type II collagen gene expression were significantly increased in encapsulated chondrocytes and chondrons compared to chondrocytes whereas dynamic compression had no effect on SOX9 or lubricin gene expression. Our results demonstrate that although encapsulation can mimic responses of chondrocytes to biomechanical compression the molecular profile did not reach the enhanced levels observed with chondrons. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Single cell encapsulation Chondrocytes Chondron Pericellular matrix Chitosan Hyaluronan
1. Introduction Treatment options for damaged adult articular cartilage are still limited. Many strategies have been proposed to enhance the chondrogenic ability of adult chondrocytes in order to tailor more successful approaches to cell therapy [1] and cartilage tissue engineering [2,3]. Within articular cartilage, chondrocytes are encapsulated by their immediate pericellular matrix (PCM) to form chondrons [4]. The presence of the PCM affects every interaction around the cell. Soluble and insoluble components such as signalling molecules, proteolytic enzymes, metabolites, nutrients all need
* Corresponding author. Guy Hilton Research Centre, Institute for Science & Technology in Medicine, Thornburrow Drive, Hartshill, Stoke-on-Trent, University of Keele, ST4 7QB, UK. Tel.: þ44 1782 554 253; fax: þ44 1782 747 319. E-mail addresses: [email protected] (Q.G. Wang), bac.v.nguyen@googlemail. com (B. Nguyen), [email protected] (C.R. Thomas), [email protected] (Z. Zhang), [email protected] (A.J. El Haj), [email protected] (N.J. Kuiper). 1 Tel.: þ44 01782733683. 2 Tel.: þ44 1214145334. 3 Tel.: þ44 1214145355. 0142-9612/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2009.11.021
to penetrate this matrix to reach the cell membrane. The surrounding PCM is thought to play a critical role in enhancing matrix production [5], protecting the chondrocyte during loading [6], and transducing mechanical signals [7]. Currently, chondrocytes isolated without a PCM are the preferred choice for cartilage tissue engineering studies. A small number of studies have shown that the removal of the PCM during chondrocyte isolation can have a negative effect on subsequent matrix production in vitro [5,8]. Therefore the PCM may be an important factor to consider in the design of tissue engineering strategies which aim to mimic PCM function for mechanical strength and signalling motifs. The composition of the PCM has been well characterised in tissue sections [9] and around individual cells [10]. It is a narrow region of matrix immediately surrounding nearly all chondrocytes in adult articular cartilage. It is rich in sulphated and non-sulphated glycosaminoglycans (GAGs), large and small proteoglycans, and collagens. Chondrocytes can be isolated with or without their in vivo PCM [10]. Retention of the in vivo PCM has been reported to influence chondrocyte gene expression positively [11] and to stabilise the chondrocyte phenotype [5]. These findings are supported by experimental data that show that chondrons cultured in
1620
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
alginate bead [12,13] or in high density pellet cultures [8] produce significantly more extracellular matrix (ECM) than chondrocytes in similar conditions. Enzymatically isolated chondrocytes produce a new PCM in a matter of hours [14]. However, the newly formed PCM is different to the PCM surrounding freshly isolated chondrons and it can interfere with the formation of further ECM [14]. These findings indicate that controlling the cell-microenvironment may be important. Although much is known about cartilage as a whole, there is a paucity of information about the biomechanical properties of the chondron and the precise function of its PCM. It is widely accepted that the PCM plays an important role in defining the mechanical environment of the chondrocyte [7]. For example, previous work has shown that different types of mechanical compression can influence matrix deposition [15–18]. Static compression of cartilage explants stimulates matrix deposition in the PCM [18]. Conversely, dynamic compression of cartilage explants stimulates matrix deposition in the ECM. These findings suggest that the PCM acts as a transducer of mechanical signals. The precise mechanism is unclear but the PCM may influence the local deformation around chondrocytes and the transport of matrix components [6,17]. Our recent work has shown that the PCM provides a protective role during loading by reducing the local deformation on the chondrocyte [19]. In these studies well-defined forces were applied to single chondrocytes and chondrons and subsequent changes in the gene expression were determined by single cell PCR. Our results demonstrated a clear role for the PCM in interfacing the mechanical signalling in chondrocytes in response to dynamic compression. Understanding how the PCM influences the cells response to biomechanical compression will ultimately improve our knowledge of how the cell responds at the tissue level. An alternative approach to investigate the role of the PCM on chondrocyte behaviour would be to encapsulate individual chondrocytes with ECM components. Single living cells can be encapsulated by alternate deposition of oppositely charged polyions onto charged substrates allowing the assembly of polyelectrolyte multilayers [20,21]. This encapsulation approach is mild and does not involve covalent interaction. Previous work has shown that single cell encapsulation resulted in an increased stiffness of the cell compared to the non-encapsulated cell [20]. In this study, to define key elements required for tissue engineering we encapsulate single chondrocytes by the alternate adsorption of the oppositely charged biocompatible polyelectrolytes; chitosan (CHI) and the non-sulphated GAG, hyaluronan (HA). CHI shares many structural characteristics with HA but it carries an opposite charge [22]. After encapsulation, the viability and metabolic activity were assessed. Single chondrocytes, chondrons or encapsulated cells were compressed to various deformations and the force versus displacement data were obtained. In addition, we investigated the response of single encapsulated chondrocytes to dynamic loading by combining a single cell PCR approach with different levels of dynamic compression. 2. Materials and methods 2.1. Chondrocyte and chondron isolation Full depth articular cartilage was dissected from the articulating surface of the trochleal humerus of 18-month-old cows. Four separate isolations were performed, each using one humerus. Enzymatic chondrocyte and chondron isolations were performed using our previously published methodology [10]. For chondrocytes, diced cartilage was sequentially digested with 700 U/ml Pronase EÔ for 1 h, then 200 U/ml collagenase XI and 0.1 mg/ml DNase 1 for 16 h. For chondrons, diced cartilage was digested with 3.3 U/ml dispase and 560 U/ml collagenase type XI in Dulbecco’s Modified Eagle’s Medium (DMEM) for 5 h. Chondrocytes or chondrons were filtered through a 70 mm cell sieve and washed three times in DMEM
supplemented with 10% (v/v) fetal calf serum (FCS). These conditions achieved optimal cell viability and cell yield [10]. 2.2. Encapsulation of chondrocytes using chitosan (CHI) and hyaluronan (HA) The encapsulation procedure was based upon the work of Diaspro et al. [21]. Essentially, the negatively charged chondrocyte membrane was encased within a cationic CHI polymeric shell and then an anionic HA polymeric shell. A CHI stock solution (20–50 mg/ml; 1.3 105 Da, with 25% acetylation, P&G Company Ltd., UK) was diluted to give a concentration of 1–2.5 mg/ml in Hank’s Balanced Salt Solution (HBSS). This was added to a 1 ml suspension of bovine chondrocytes in HBSS to make a final concentration of 5 106/ml. After 15 min, the cell preparation was washed three times with HBSS to remove any excess unadsorbed polyelectrolyte. An HA stock solution (15 mg/ml; Hyaltech Ltd., Edinburgh, UK) was diluted to give a concentration of (1 mg/ml) in HBSS and added to the cell suspension. After 15 min, excess unadsorbed polyelectrolyte was removed as before. In this preliminary study chondrocytes were only encapsulated with one layer of CHI and one layer of HA. 2.3. Zeta potential measurement to assess layer by layer deposition Zeta potential was used to assess the layer by layer deposition [23]. Samples (5 ml) containing 0.2 106 cells/ml in Phosphate Buffered Saline (PBS, pH 7.3) were measured with the Zeta master (ZEM, Malvern Instruments Ltd., UK). Sample 1 was the negatively charged chondrocytes. Sample 2 was the chondrocytes encapsulated with CHI alone. Sample 3 was the chondrocytes encapsulated with both CHI and HA. Each sample was tested 10 times. Statistical differences in zeta potential voltage between samples were examined using the student’s t-test with two significance levels; *p < 0.05 and **p < 0.01. Comparisons were made between sample 1 and sample 2, sample 2 and sample 3. 2.4. Validation of the chondrocyte encapsulation process First chondrocytes were encapsulated with fluorescein isothiocyanate isomer Ilabelled CHI (FITC-CHI). Briefly, CHI was dissolved in HBSS to give a concentration of 1–2.5 mg/ml. FITC (2 mg/5 ml) was added to this CHI solution and the mixture was stirred for 24 h at room temperature in the dark. The mixture was purified by cellulose acetate film dialysis. Following dialysis, FITC-CHI was mixed with bovine chondrocytes to give a final concentration of 5 106 cells/ml. After 15 min, the cell preparation was washed three times with HBSS to remove any excess unadsorbed FITC-CHI. After encapsulation, chondrocytes were left for 4 h at 4 C and then counterstained with propidium iodide. It was used to help localise cells under the fluorescent microscope. Finally, encapsulated chondrocytes were viewed under a fluorescent microscope (Leica). 2.5. Pellet cultures and their analyses To ensure that the polyelectrolyte coating did not influence chondrocyte metabolism, chondrocytes and encapsulated chondrocytes were pellet cultured for 7 days. Briefly, 1 106 cells (n ¼ 4) were gently spun (1000 rpm) in 0.5 ml of DMEMþ10% FCS in microcentrifuge tubes for 5 min to form a pellet. Pellets were cultured in a humidified incubator at 37 C in 5% CO2. Media were changed daily. Pellets were assessed at days 1, 3, 5, and 7. Cell number was determined by PicogreenÔ DNA quantitation using calf thymus DNA as standard [24]. Cell viability was assessed using Trypan blue exclusion and Live/Dead Cell Double Staining Kit (BioChemika) [25]. The Live/Dead Cell Kit stained viable cells green with calcein-AM and non-viable cells red with propidium iodide. Two hundred cells were counted in three separate regions of each pellet (4 replicates). These data are expressed as a percentage. Total sulphated glycosaminoglycan (GAG) content was determined using dimethylmethylene blue (DMMB) dye [26]. Absorbance at 490 nm was read against a standard curve of chondroitin sulphate. 2.6. Single cell static compression Single cells were compressed to given deformations between two parallel surfaces at a pre-set speed; the flat end of a force probe made of glass fibre and the flat bottom surface of the glass chamber in a micromanipulation compression tester. Details of this technique are described elsewhere [27–29]. Briefly, the glass probe is connected to a force transducer which has a response of 500 mN full scale at a resolution of 0.01 mN. The probe is driven downwards by a vertical stepping motor, compressing the cell in liquid medium in the glass chamber. During their compression, single cells can be observed microscopically and images can be collected using a high-speed camera (500 frames per second images at 510 484 pixels resolution). Cell deformation is defined as the ratio between the applied displacement in the direction of compression and the original cell diameter. The original cell diameter was measured based on its 2D side view image as previously described [27–29]. Twenty two single chondrocytes, chondrons and encapsulated chondrocytes were obtained for compression tests. The specimens were compressed by micromanipulation to final deformations of 30%, 50% and 70% successively. The cells were
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625 compressed to a final deformation of 30%, held for approximate 3 s, and then the load was released. This process was then repeated on the same cells for final deformations of 50% and 70%, successively. The time between each compressionholding-release process was 2–3 min. During each compression test, data of the force imposed on a single cell versus its displacement were obtained [19]. 2.7. Single cell dynamic compression Using micromanipulation, twelve single cells were cyclically loaded with a maximum deformation of 20% and 40% applied at a frequency at 0.3 Hz for 10 min. The two levels of deformation represent medium and high mechanical compression levels as previously described [19]. After dynamic compression, each cell was collected for single cell PCR with a CellTram Oil hydraulic microaspirator (1 mm diameter, 25–40 mm at the tip, Brinkmann, Westbury, NY) as previously reported [19] and either lysed immediately or incubated at 37 C for 18 h in serum-free media and then lysed. 2.8. Single cell PCR The detailed protocol for cell lysis, reverse transcription, cDNA pre-amplification and real-time qPCR used reagents and bovine primer/probe mixtures from Applied Biosystems/Ambion and has been previously reported [11]. In brief, each cell was lysed with cDNA II cell lysis buffer (AM8723). Two negative controls were also processed: a medium blank control comprising 1 ml DMEM þ 9 ml lysis buffer, and a lysis blank control, containing 10 ml lysis buffer. After degradation of genomic DNA, the RNA was reverse-transcribed in situ using the High Capacity cDNA RT Kit (4374966). Four extracellular matrix components were examined; Type II collagen, aggrecan, lubricin and osteopontin. One transcription factor was examined; SOX9 (Table 1). Gene expression was normalised to the housekeeping gene 18s rRNA. To multiply gene copy numbers to detectable levels, cDNA was first pre-amplified using TaqManÒ PreAmp Master Mix (4391128). Gene expression was individually quantified for all genes of interest using the Applied Biosytems 7300 Real-Time PCR system. Each gene was analysed in parallel with serially diluted cDNA standards prepared from bovine chondrocytes (data not shown).
1621
chondrocytes (green) which have been counterstained with propidium iodide (red). CHI-FITC can be seen around some chondrocytes. >95% of chondrocytes were successfully encapsulated. The percentage was determined by dividing the number of cells with a visible FITC-CHI layer by the counted population (sample size 400). Fig. 1B shows FITC-only treated chondrocytes which have been counterstained with propidium iodide. There was no FITC staining observed around the cells. 3.2. Zeta potential measurement Fig. 2 illustrates the zeta potential values of chondrocytes without encapsulation, chondrocytes after CHI deposition (chondrocyte-CHI), and chondrocytes after CHI followed by HA deposition (chondrocyte-CHI/HA). The zeta potential value of cells increased from 26.2 mV to 20.6 mV after CHI layer deposition. It then decreased to 28.6 mV after HA layer deposition. Each change in voltage was statistically significant. The trend of the changes in cell surface zeta potential had good agreement with values in the literature [30,31]. 3.3. Assessment of cell viability and metabolic activity To check the viability of cells and their metabolic activity after encapsulation we performed a 7-day time course experiment (Fig. 3). The cell viability, cell number and sulphated GAG production were assessed on days 1, 3, 5, and 7. All three analyses followed a similar trend for both encapsulated and non-encapsulated chondrocytes.
2.9. Statistical analysis
3.4. Force response data following single cell compression
All results are presented as a mean standard error of the mean (SEM). Statistical differences in gene expression at the same dynamic compression were examined using the student’s t-test with two significance levels; *p < 0.05 and **p < 0.01. Comparisons were made between chondrocytes and chondrons, chondrocytes and encapsulated chondrocytes, and encapsulated chondrocytes and chondrons.
Micromanipulation measurements demonstrated that the average diameter of the encapsulated chondrocytes was 0.3 mm larger than the average diameter of the unencapsulated chondrocytes. Fig. 4 shows representative force–displacement curves for a chondrocyte (Fig. 4A), a chondron (Fig. 4B) and an encapsulated chondrocyte (Fig. 4C) compressed to a final deformation of 30%, 50% and 70% (Fig. 4C) respectively, at a compression speed of 6 mm1. These data illustrate that increasing final deformation leads to greater forces on the cells. On average, the chondrocytes had a mean peak force at the end of compression (F0) of 0.17 0.02, 0.38 0.03 and 1.03 0.12 mN at 30%, 50% and 70% deformations respectively; chondrons had a mean F0 of 0.25 0.02, 0.54 0.04 and 1.25 0.21 mN at 30%, 50% and 70% deformation respectively; encapsulated chondrocytes had a mean F0 of 0.30 0.02, 0.47 0.03 and 1.37 0.16 mN at 30%, 50% and 70% deformations respectively. Paired student’s t-tests showed a significant difference in F0 at 30% and 50% deformation between chondrocytes and chondrons, and between chondrocytes and encapsulated chondrocytes (p < 0.05), but no significant difference between chondrons and encapsulated chondrocytes at such deformations. It also showed there were no significant differences in F0 at 70% deformation between chondrocytes, chondrons and encapsulated chondrocytes. These results are consistent with previous observations [19] which demonstrated that chondrons are stiffer than chondrocytes and show less pronounced viscoelastic behaviour. In our current work we have shown that encapsulation imparts the chondrocyte with resistance to mechanical force that is similar to but not the same as a chondron.
3. Results 3.1. Validation of the chondrocyte encapsulation process The FITC-CHI encapsulated chondrocytes were viewed under a fluorescent microscope. Fig. 1A shows the CHI-FITC encapsulated
Table 1 List of oligonucleotides used for real-time PCR. All oligonucleotides were designed using bovine-specific sequences. Target gene GeneBank number Amplicon size
Forward primer sequence Reverse primer sequence Probe sequence
COL2A1 X02420 73 bp
TTGACATTGCACCCATGGACATA CAAGAAGCAGACAGGCCCTAT CACACCGAATTCCTG
AGC1 U76615 73 bp
GGTCACGCTGCCCAACTA GTCATTGGAGCGCATGTTCTG ACGCCACCCTGGAAAT
SOX9 AF278703 76 bp
CCGGTGCGCGTCAAC GCGCCCACACCATGAAG ACGTGCGGCTTGTTCT
Lubricin AFD56218 88 bp
ACCTCCACCTCGGAGAATTACT AGTTTTTCCTTCACAGTTGCATCTAGT AATGCCCCAAACTTC
Osteopontin AF492837 67 bp
GCTTACGGACTGAAGTCAAGATCTA CTGTGGCATCTGGACTCTGAA TTCCGCCGATCTAACG
3.5. Gene expression Cells were dynamically compressed (20% or 40% deformation) at 0.3 Hz for 10 min. Measurable levels of at least one ECM gene were
1622
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
Fig. 1. Fluorescence micrographs of (A) CHI-FITC encapsulated chondrocytes, and (B) FITC-only treated chondrocytes. The red fluorescence and arrow indicate the locations of cell nuclei. Green fluorescence indicates the presence of CHI. Bar ¼ 10 mm.
detected in 11/12 encapsulated chondrocytes tested. Of these, 91.7% expressed Type II collagen, 87.5% expressed aggrecan, 70.8% expressed lubricin, and 83.3% expressed osteopontin. Fig. 5 shows the ECM gene expression data. Compared to non-encapsulated cells, encapsulation significantly increased Type II collagen at 40% cell deformation (p ¼ 0.015) but the difference was not significant at 20% cell deformation (p ¼ 0.37) (Fig. 5A). In contrast, at both 20% and 40% cell deformation Type II collagen was significantly increased in chondrons (p ¼ 0.047 and p ¼ 0.0131, respectively). At 20% cell deformation, Type II collagen gene expression was significantly higher in chondrons than in encapsulated chondrocytes but at 40% compression there was no significant difference between the two. Compared to non-encapsulated chondrocytes, aggrecan gene expression was generally increased with encapsulation at both 20% and 40% cell deformation levels, but not to the same level as the chondron (p ¼ 0.045 at 20% and p ¼ 0.028 at 40% cell deformation) (Fig. 5B). There was little difference in lubricin gene expression between the non-encapsulated chondrocytes, encapsulated chondrocytes and chondrons at 20% and 40% compression (Fig. 5C). Chondrocytes and encapsulated chondrocytes were significantly less responsive than chondrons with respect to osteopontin expression at 20% cell deformation (p ¼ 0.043 for chondrocytes and p ¼ 0.0014 for encapsulated chondrocytes) (Fig. 5D). Encapsulation improved the mechanoresponsiveness but not to the same degree
Fig. 2. The zeta potential values of unencapsulated chondrocytes, chondrocytes encapsulated with CHI alone, and chondrocytes encapsulated with both CHI and HA. Data are expressed as the mean SEM (n ¼ 4). * Represents p < 0.05.
Fig. 3. A 7-day time course experiment to demonstrate that the polyelectrolyte coating did not influence chondrocyte metabolism. Freshly isolated chondrocytes (unencapsulated) and chondrocytes encapsulated with CHI and HA (encapsulated) were assessed for (A) cell number, (B) cell viability, and (C) total sulphated GAG production after 1, 3, 5 and 7 days in culture. Data are expressed as the mean SEM (n ¼ 4).
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
1623
Fig. 4. Representative force–displacement curves of cells compressed to a final deformation of 30%, 50% and 70% for a single chondrocyte, diameter 8.9 mm (A), a single chondron, diameter 9.3 mm (B), and a single encapsulated chondrocyte, diameter 9.2 mm (C). Each cell was compressed at 6 mm s1.
Fig. 5. Gene expression of (A) aggrecan, (B) type II collagen, (C) lubricin and (D) osteopontin for chondrocytes, encapsulated chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 C for 18 h and then lysed. The data were normalised to 18s rRNA and represent mean SEM. Twelve cells were assessed and n represents the number of cells that were positive for each specific gene tested. * represents p < 0.05 and ** represents p < 0.01.
1624
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
as the native PCM. Finally, mechanical compression of encapsulated chondrocytes had no significant effect on SOX9 gene expression (Fig. 6). 4. Discussion In this study polyelectrolyte multilayer shells where successfully applied to chondrocytes. The layer by layer procedure was validated using two different approaches. In the first validation approach, chondrocytes were encapsulated with FITC-labelled CHI and visualised under a microscope. There was some variation in the intensity of the fluorescence amongst the encapsulated chondrocytes. This variation could be due to the differences in surface electrostatic charges within the enzymatically isolated chondrocyte population. Higher surface electrostatic charges would attract more encapsulation material. In the second validation approach zeta potential measurements were performed on chondrocytes, chondrocytes encapsulated with CHI only, and chondrocytes encapsulated with both CHI and HA. In our study, the magnitude and the trend in the zeta potential were in agreement with previous work [21,30]. Assessing zeta potential of cells is challenging since there is no wide agreement on the testing buffer for cells or the number of cells needed for an experiment. Different cell concentrations have been shown to affect the velocity of a migrating cell during the zeta potential measurement which has led to false values. Different buffers have been shown to negatively affect zeta potential reading [32]. The most important factor affecting zeta potential is the pH [33]. However when testing cells it is important to use a testing buffer with a physiological pH. In our assessment we tried a range of cell concentrations (0.2–2 million/ ml) and three different buffers; DMEM, HBSS and PBS (data not shown). The zeta potential readings for HBSS were highly scattered and negatively charged. We could not complete the measurement for DMEM since it generated too many bubbles in the measurement container. PBS gave the most stable readings and the zeta potential
Fig. 6. Gene expression of SOX9 for chondrocytes, encapsulated chondrocytes and chondrons after dynamic compression of either 20% or 40% cell deformation at 0.3 Hz for 10 min. Single cells were either lysed immediately (control) or incubated at 37 C for 18 h and then lysed. The data were normalised to 18s rRNA and represent mean SEM. Twelve cells were assessed and n represents the number of cells that were positive for each specific gene tested.
was almost neutral. At cell concentration below 0.5 million/ml the readings were the most stable. Consequently a cell concentration of 0.2 million/ml was used in further measurements. The biological properties of the encapsulated chondrocytes were preserved. A 7-day pellet culture study demonstrated that encapsulated chondrocytes and non-encapsulated chondrocytes had comparable cell number, cell viability, and sulphated GAG production. GAGs are one of the major macromolecular components constituting the ECM. Most sulphated GAG chains are covalently linked to core proteins to form proteoglycans, which are located at the cell surface and in the ECM. Encapsulated chondrocytes were able to maintain sulphated GAG synthesis at almost identical levels to unencapsulated chondrocytes which suggests that encapsulation did neither interfere with GAG synthesis nor release into the surrounding ECM. Thus we can conclude that the approach used for the assembly of polyelectrolyte multilayers was mild and did not involve covalent interaction. Encapsulation provided mechanical protection to the chondrocytes and even appeared to mimic the mechanical properties of chondrons. First, single encapsulated chondrocytes, chondrons and chondrocytes were compressed by micromanipulation with final deformations of 30%, 50% and 70%. Force–displacement curves showed that the larger the deformation at the end of compression, the greater the force on the cell (and also the larger the subsequent force relaxation, see [19]). There were no significant differences in force–displacement relations between encapsulated chondrocytes and chondrons, but both required higher forces to achieve 30% and 50% deformation than the chondrocytes. There was no significant difference in the force corresponding to 70% deformation among chondrocytes, encapsulated chondrocytes and chondrons, which suggests that the resistance to deformation at such level might be dominated by intracellular component, such as cell nucleus. Overall, encapsulating chondrocytes creates a construct with stiffness similar to a chondron. Second, single encapsulated chondrocytes, chondrons and chondrocytes were dynamically compressed to 20% and 40% load. The two levels of deformation represent medium and high mechanical compression levels [19]. After dynamic compression, each cell was collected for single cell RT-PCR. Generally the results showed how the presence of the PCM enhanced the loading responsiveness to 20% and 40% load. In particular expressions of type II collagen and aggrecan genes in encapsulated chondrocytes were more responsive to dynamic loading than those in chondrocytes, although not to the same extent as in chondrons. There were no noticeable differences in the other genes tested. By contrast the mechanical strength was restored. These results may demonstrate how adhesion to HA alone may not be sufficient to reproduce the mature cell response and that other factors may be required. Our single cell RT-PCR approach has some limitations. The complex and time consuming procedure of dynamically loading single cells is restrictive. As a consequence we were only able to examine a single time point and therefore we were not able to determine changes in gene expression over time. Despite this, the results of this study have clearly demonstrated that polyelectrolyte multilayer shells can be applied to individual chondrocytes. The encapsulation procedure that we present herein serves as a model for defining the precise roles of the PCM. The inclusion of other components within the polyelectrolyte cell coat could provide interesting methods of influencing cellular behaviour. 5. Conclusion This study has shown that polyelectrolyte multilayer shells can be applied to chondrocytes, whilst preserving their biological properties and improving their biomechanical properties. A 7-day
Q.G. Wang et al. / Biomaterials 31 (2010) 1619–1625
pellet culture study demonstrated that encapsulated chondrocytes and non-encapsulated chondrocytes had comparable cell number, cell viability, and sulphated GAG production. Encapsulation provided mechanical protection to the chondrocytes and even appeared to mimic the mechanical properties of chondrons. Moreover, encapsulation bridged the gap in mechanoresponsiveness between chondrocytes and chondrons. These findings may be useful for designing artificial matrices for tissue engineering which aim to mimic PCM function for mechanical strength and signalling motifs. Acknowledgments This work was supported by the EPSRC (EP/C511727/1). We thank our industrial collaborator, Mr Barry White, Hyaltech Ltd., Edinburgh, UK for providing the hyaluronan. Author disclosure statement The authors have no competing financial interests. Appendix Figures with essential colour discrimination. Figs. 1 and 4 in this article may be difficult to interpret in black and white. The full colour images can be found in the on-line version, at doi:10.1016/ j.biomaterials.2009.11.021. References [1] Goldberg AJ, Lee DA, Bader DL, Bentley G. Autologous chondrocyte implantation. Culture in a TGF-beta-containing medium enhances the re-expression of a chondrocytic phenotype in passaged human chondrocytes in pellet culture. J Bone Joint Surg Br 2005;87:128–34. [2] Smith P, Shuler FD, Georgescu HI, Ghivizzani SC, Johnstone B, Niyibizi C, et al. Genetic enhancement of matrix synthesis by articular chondrocytes: comparison of different growth factor genes in the presence and absence of interleukin-1. Arthritis Rheum 2000;43:1156–64. [3] Woodfield TB, Miot S, Martin I, van Blitterswijk CA, Riesle J. The regulation of expanded human nasal chondrocyte re-differentiation capacity by substrate composition and gas plasma surface modification. Biomaterials 2006;27:1043–53. [4] Poole CA. Articular cartilage chondrons: form, function and failure. J Anat 1997;191(Pt 1):1–13. [5] Graff RD, Kelley SS, Lee GM. Role of pericellular matrix in development of a mechanically functional neocartilage. Biotechnol Bioeng 2003;82:457–64. [6] Knight MM, Ross JM, Sherwin AF, Lee DA, Bader DL, Poole CA. Chondrocyte deformation within mechanically and enzymatically extracted chondrons compressed in agarose. Biochim Biophys Acta 2001;1526:141–6. [7] Guilak F, Alexopoulos LG, Upton ML, Youn I, Choi JB, Cao L, et al. The pericellular matrix as a transducer of biomechanical and biochemical signals in articular cartilage. Ann N Y Acad Sci 2006;1068:498–512. [8] Larson CM, Kelley SS, Blackwood AD, Banes AJ, Lee GM. Retention of the native chondrocyte pericellular matrix results in significantly improved matrix production. Matrix Biol 2002;21:349–59.
1625
[9] Poole CA, Honda T, Skinner SJ, Schofield JR, Hyde KF, Shinkai H. Chondrons from articular cartilage (II): analysis of the glycosaminoglycans in the cellular microenvironment of isolated canine chondrons. Connect Tissue Res 1990;24:319–30. [10] Wang QG, El Haj AJ, Kuiper NJ. Glycosaminoglycans in the pericellular matrix of chondrons and chondrocytes. J Anat 2008;213:266–73. [11] Wang QG, Magnay JL, Nguyen B, Thomas CR, Zhang Z, El Haj AJ, et al. Gene expression profiles of dynamically compressed single chondrocytes and chondrons. Biochem Biophys Res Commun 2009;379:738–42. [12] Lee GM, Caterson B. When cultured in alginate beads, chondrons produce a more fibrillar matrix than isolated chondrocytes. Trans Orthop Res Soc 1995;20:394. [13] Kelley SS, Blackwood AD, Caterson B, Lee GM. Retention of the in vivo-formed pericellular matrix affects proteoglycan synthesis in vitro. Trans Orthop Res Soc 1996;21:768. [14] Lee GM, Loeser RF. Interactions of the chondrocyte with its pericellular matrix. Cell Mater 1998;8:135–49. [15] Adams MA. The mechanical environment of chondrocytes in articular cartilage. Biorheology 2006;43:537–45. [16] Buschmann MD, Gluzband YA, Grodzinsky AJ, Hunziker EB. Mechanical compression modulates matrix biosynthesis in chondrocyte/agarose culture. J Cell Sci 1995;108(Pt 4):1497–508. [17] Greco F, Specchia N, Falciglia F, Toesca A, Nori S. Ultrastructural analysis of the adaptation of articular cartilage to mechanical stimulation. Ital J Orthop Traumatol 1992;18:311–21. [18] Quinn TM, Grodzinsky AJ, Buschmann MD, Kim YJ, Hunziker EB. Mechanical compression alters proteoglycan deposition and matrix deformation around individual cells in cartilage explants. J Cell Sci 1998;111(Pt 5):573–83. [19] Nguyen BV, Wang Q, Kuiper NJ, El Haj AJ, Thomas CR, Zhang Z. Straindependent viscoelastic behaviour and rupture force of single chondrocytes and chondrons under compression. Biotechnol Lett 2009;31:803–9. [20] Svaldo-Lanero T, Krol S, Magrassi R, Diaspro A, Rolandi R, Gliozzi A, et al. Morphology, mechanical properties and viability of encapsulated cells. Ultramicroscopy 2007;107:913–21. [21] Diaspro A, Silvano D, Krol S, Cavalleri O, Gliozzi A. Single living cell encapsulation in nano-organized polyelectrolyte shells. Langmuir 2002;18:5047–50. [22] Suh JK, Matthew HW. Application of chitosan-based polysaccharide biomaterials in cartilage tissue engineering: a review. Biomaterials 2000;21:2589–98. [23] Fuerstenau MC. Chemistry of flotation. New York: SME/AIME; 1985. [24] Ahn SJ, Costa J, Emanuel JR. PicoGreen quantitation of DNA: effective evaluation of samples pre- or post-PCR. Nucleic Acids Res 1996;24:2623–5. [25] Yoshida S, Yamada K, Hamaguchi K, Nishimura M, Hatakeyama E, Tsuchida H, et al. Immunohistochemical study of human advanced glycation end-products (AGE) and growth factors in cardiac tissues of patients on maintenance dialysis and with kidney transplantation. Clin Nephrol 1998;49:273–80. [26] Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta 1986;883:173–7. [27] Zhang Z, Ferenczi MA, Lush AC, Thomas CR. A novel micromanipulation technique for measuring the bursting strength of single mammalian cells. Appl Microbiol Biotechnol 1991;36:208–10. [28] Mashmoushy H, Zhang Z, Thomas CR. Micromanipulation measurement of the mechanical properties of Baker’s yeast cells. Biotechnol Tech 1998;12:925–9. [29] Wang CX, Cowen C, Zhang Z, Thomas CR. High-speed compression of single alginate microspheres. Chem Eng Sci 2005;60:6649–57. [30] Veerabadran NG, Goli PL, Stewart-Clark SS, Lvov YM, Mills DK. Nanoencapsulation of stem cells within polyelectrolyte multilayer shells. Macromol Biosci 2007;7:877–82. [31] Zahr AS, Pishko MV. Encapsulation of paclitaxel in macromolecular nanoshells. Biomacromolecules 2007;8:2004–10. [32] Burns DB, Zydney AL. Buffer effects on the zeta potential of ultrafiltration membranes. J Membr Sci 2000;172:39–48. [33] Tippe A. Electrophoretic measurements about the relation between transition voltage and zeta-potential of biological membranes. Biochim Biophys Acta 1981;641:395–400.