- Email: [email protected]
Mucosal immune parameters, immune and antioxidant defence related genes expression and growth performance of zebrafish (Danio rerio) fed on Gracilaria gracilis powder
Fish and Shellfish Immunology 83 (2018) 232–237
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Mucosal immune parameters, immune and antioxidant defence related genes expression and growth performance of zebrafish (Danio rerio) fed on Gracilaria gracilis powder
T
Seyed Hossein Hoseinifara,1, Samira Yousefia, Gioele Capillob,1, Hamed Paknejada, Mohsen Khalilic, Alijan Tabarraeie, Hien Van Doand, Nunziacarla Spanòb, Caterina Faggiob,∗ a
Department of Fisheries, Faculty of Fisheries and Environmental Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina, Italy Medical Cellular & Molecular Research Center, Golestan University of Medical Sciences, Gorgan, Iran d Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai, 50200, Thailand e Infectious Diseases Research Center, Golestan University of Medical Sciences, Gorgan, Iran b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Gracilaria gracilis Danio rerio Immune parameters Antioxidant enzymes Growth
In the present study zebrafish (Danio rerio) has been used as model organism to establish the effects of dietary supplementation of Gracilaria gracilis powder (GP) on mucosal and innate immune parameters, antioxidant enzymes, and growth. In order to establish these features, zebrafish were fed for eight weeks with experimental diets containing different levels of Red algae, 0.25, 0.5 and 1% of GP; also, a group was fed with control diet. At the end of the experimental period the antioxidant superoxide dismutase and catalase (SOD, CAT) genes expression, interleukin 1 beta (il-1β), lysozyme (LYZ), tumor necrosis factor alpha (TNF-α) for immune-related genes expression, total immunoglobulin (Ig), total protein, alkaline phosphatase (ALP) activity for innate immune parameters, and growth performance have been established. The GP dietary supplementation showed differences in SOD and CAT expression in zebrafish whole body respect to the control group. Non-signifcant differences were noticed among the different groups in case of TNF-α, LYZ and il-1expression (P > 0.05). The skin mucus total Ig and total protein in the group fed on 1% of GP were significantly higher respect to control group (P < 0.05). 0.25 and 0.5% of GP dietary supplementation significantly enhanced skin mucus ALP activity levels (P < 0.05). No significant differences were recorded for growth performances among groups (P > 0.05). The results obtained in the present study revealed that G. gracilis could be takes in account as fishes diet supplementation for its immune system stimulants effects.
1. Introduction
[16–19]. Algae as an integration of fish feed show great potential in enhance immune system function and disease resistance [20]. Among the different seaweeds studied and evaluated as fish feed supplements, the most encouraging results are given by red algae. Red algae have a chemical composition that reveals a high content in proteins and diverse bioactive compounds with great pharmaceutical and biomedical potential [21,22]. Rhodophyta composition reveal high content in vitamin C, amino acids, peptides, omega-3 fatty acids, and proteins [23–25]. Furthermore, algae-derived supplements showed potential immune-stimulants effects for different fish species [26,27]. Peixoto and coworkers [28] demonstrated that dietary Gracilaria spp. supplementation enhanced the antioxidant capacity and improved innate
The correlation between feed composition and wellness of aquatic organisms is a well-explored field. Alimentation has important consequences on animal physiology, especially on growth performance and immune modulatory activity [1–3]. Fishes are widely studied organisms for their importance as bioindicators and as source of protein both from wild and cultured species [4–16]. Numerous studies have established the potential use of different algae as supplement or integration of fish feed. Macro and micro algae have been used as dietary integration or substitution to improve health and growth performance of different farmed fish species
∗
Corresponding author. Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina Viale Ferdinando Stagno d'Alcontres, 31-98166, S.Agata-Messina, Italy. E-mail address: [email protected] (C. Faggio). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.fsi.2018.09.046 Received 24 July 2018; Received in revised form 6 September 2018; Accepted 13 September 2018 Available online 14 September 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
Table 1 Composition of the basal diet used throughout the experiment. Proximate analysis (%) Dry matter Crude protein Crude lipid Ash
93.6 38.9 15.0 11
immune system indicators of the European seabass (Dicentrarchus labrax). Gracilaria gracilis is a marine red seaweed belonging to Rhodophyta, Florideae, Gigartinales, Gracilariaceae; it is widely used as raw material for agar extraction and for this reason is listed as agarophyte [29]. However, besides agar, G. gracilis represents a source of many other useful natural products such as lipids and fatty acids, sterols, proteins, phycobiliproteins, phenols, carbohydrates [29,30]; these latter authors defined G. gracilis as a “Multi Product Source”. Despite the well-studied characteristics of this seaweed (agar properties, biological cycle, chemical composition) the literature review revealed the presence of only few experiments that used Gracilaria species as feed supplement for commercial reared-species. The G. gracilis effects on antioxidant, immune mucosal parameters and growth of fish are absent in literature. The present study explores the potentiality of G. gracilis as supplement in fish diet, how it influences mucosal immune parameters, antioxidant enzymes and their related genes expression, and growth, on zebrafish (Danio rerio) as model organisms [31–33]. 2. Material & methods 2.1. Fish husbandry and experimental diets Zebrafish were purchased from a local farmer and transported to Aquaculture lab of GUASNR. After two weeks acclimatization to experimental condition, fish allocated to twelve aquaria (100 L) at rate of 50 zebrafish per aquarium. The feeding trial lasted for eight weeks and during the period fish were fed on experimental diets containing different levels of red algae up the apparent satiation, three times a day. Utmost care was considered to maintain water quality parameters, by regular cleaning, water exchange and aeration.
Fig. 1. Effects of 8-weeks feeding with different levels of Gracilaria gracilis powder on the relative expression of Superoxide dismutase (SOD) and Catalase (CAT) genes. Values are presented as the mean ± S.D. Bars assigned with different letter denote significant difference (P < 0.05).
waters and transported to the aquaculture laboratory of the University of Messina, where it has been washed with fresh water and epiphytes and/or other algal species were removed. Algal biomass has been oven dried at 45 °C for 72 h, in order to reduce the water content of algae, and then pulverized in a mortar. The Gracilaria powder (GP), then has been sent to the Department of Fisheries (Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran) for the experiments.
2.2. Algal collection and treatment Thalli of the red alga Gracilaria gracilis were collected from a natural bed in the Natural Oriented Reserve of Capo Peloro (Messina, Sicily, Italy). The collection site (38°15′49.7″N 15°37′34.9″E) was located in a canal connecting two coastal brackish lagoon [34], for a description of the area see Refs. [35,36]. Then, the algae were washed in the lagoon Table 2 The sequences of used primers and accession numbers. Primer name
Primer Sequence
Application
Accession number
sod q-PCRF sod q-PCRR cat q-PCRF cat q-PCRR il-1β q-PCRF il-1β q-PCRR tnfα q-PCRF tnfα q-PCRR lyz q-PCRF lyz q-PCRR β-actin q-PCRF β-actin q-PCR R
GGGTGGCAATGAGGAAAG GCCCACATAGAAATGCACAG GCATGTTGGAAAGACGACAC GTGGATGAAAGACGGAGACA CGTCTCCACATCTCGTACTCA GTGTCTTTCCTGTCCATCTCC CTGCTTCACGCTCCATAAGA CTGGTCCTGGTCATCTCTCC GGCAGTGGTGTTTTTGTGTC CGTAGTCCTTCCCCGTATCA AGCAGATGTGGATCAGCAAG TACCTCCCTTTGCCAGTTTC
antioxidant
BC055516.1
antioxidant
AJ007505.1
immune
AY340959.1
immune
AY427649.1
immune
NM_139180.1
Housekeeping gene
NM_131031.1
233
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
which fed to control group. The information on proximate composition of the basal diet is mentioned in Table 1. For preparation of treated diets, the basal diet was supplemented with 0.25, 0.5 and 1% of GP according to the method described elsewhere [2]. The prepared diets were kept in zip pack at the 4 °C. 2.4. Gene expression studies 2.4.1. Sample collection At the end of feeding trial, 15 specimens were randomly selected from each experimental unit and rapidly anesthetized by using clove powder (0.5 g/1). Then, the heads and fins were removed and whole body sample was prepared according to the protocol suggested by Ref. [38]. The samples were immediately stored in liquid nitrogen until use. 2.4.2. RNA isolation, cDNA synthesis and real-time PCR Evaluation of relative expression of immune and antioxidant related genes was done using Real time PCR and based on the protocol described elsewhere [39]. The BIOZOL Reagent protocol (Bioflux-Bioer, China) was used for isolation of RNA. The concentration of RNA was determined by Nanophotometer (IMPLEN-P100) reading at 260/ 280 nm and the integrity verified by evaluation of 28 S and 18 S ribosomal RNA (rRNA) using agarose gel (1.5%). DNase I (Fermentas, France) treating eliminated the DNA in the samples. The Fermentase protocol was followed for cDNA synthesis (Yousefi et al., 2018). Realtime PCR analysis was performed using Fermentase Maxima SYBR Green qPCR Master Mix (1×) in an iCycler (BioRad, USA). The obtained data were analyzed using the iQ5 optical system software version 2.0 (BioRad). We used the sequences available in GenBank for designing the qPCR primers for SOD, CAT, il-1β, LYZ and β-actin (Table 2). Also, β-actin gene was considered as reference gene. The relative mRNA expression levels of SOD, CAT, il-1β, TNF-α LYZ and βactin were calculated by the 2−ΔΔCt method. In all cases, each PCR was performed in triplicates. 2.5. Evaluation of mucosal immune parameters At the end of trial, nine 24-h starved zebrafish were randomly selected from each experimental unit and after anesthesia placed in polyethylene bags containing 5 mL of 50 mM NaCl (Sigma, Steinheim, Germany). The skin mucus collection was done following the method suggested previously [40,41]. To ease mucus collection the fish by gently rubbed inside the bags for 1–2 min. The collected samples were centrifuged and the supernatant stored at −80 °C until analysis. The standard protocol of Lowry et al. [42] was followed for determination of the total protein level in samples. In this method we used bovine serum albumin as standard. The absorbance was read using a spectrophotometer (Biochrom, Libra S12) at 750 nm. For determination of Alkaline phosphatase activity (ALP) was used a commercial kit (Ziest Chem Diagnostics kit, Iran). The absorption was read at 405 nm and the ALP activity was calculated based on the formula suggested by the manufacturer. The skin mucus total Ig level was determined according to the method described previously [40]. The method was based on two times determination of total protein, before and after removing immunoglobulin molecules by using a 12% solution of polyethylene glycol (Sigma).
Fig. 2. The effects of 8-weeks feeding with different levels of Gracilaria gracilis powder on the relative expression of lysozyme (LYZ), tumor necrosis factor alpha (TNF-alpha), interleukin 1 beta (IL1B) genes. Values are presented as the mean ± S.D. Bars assigned with the same letter denote no significant difference (P > 0.05).
2.5.1. Growth performance After eight week feeding on experimental diet, the growth performance parameters was calculated according to the following formula: Weight gain = W2 (g) − W1 (g); Specific growth rate (SGR) = 100 (ln W2−ln W1)/T
2.3. Preparation of experimental diets
Feed conversion ratio (FCR) = feed intake (g) / weight gain (g);
In this study we used a commercial diet (BioMar SAS, Nersac, France) which was suggested in a previous study [37] as basal diet
Where W1 is the initial weight, W2 is the final weight, T is duration of 234
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
Table 3 The effects different levels of dietary Gracilaria gracilis powder on mucosal immune parameters of zebrafish (Danio rerio). Values are presented as the mean ± S.D (n = 9). Dietary Gracilaria gracilis powder
Total Ig (mg ml−1) Total protein (mg ml−1) ALP (U ml−1)
0% (Control)
0.25%
0.5%
1%
22.38 ± 3.54 b 30.04 ± 3.67 b 193.9 ± 9.6c
27.32 ± 1.93 ab 35.31 ± 2.77ab 241.7 ± 4.6 b
29.95 ± 4.65 35.47 ± 3.84 262.2 ± 3.2a
ab ab
36.62 ± 3.81a 43.29 ± 2.43a 205.2 ± 3.7c
Values in a row assigned with different letters denote significant difference (P < 0.05). Table 4 The effects different levels of dietary Gracilaria gracilis powder on growth performance of zebrafish (Danio rerio). Values are presented as the mean ± S.D. Dietary Gracilaria gracilis powder 0% (Control) Initial weight (mg) Final weight (mg) WG (mg) SGR FCR
0.25% a
112.5 ± 0.75 271.12 ± 12.30a 158.64 ± 11.87a 1.57 ± 0.07a 1.99 ± 0.17a
0.5% a
112.19 ± 1.11 245.98 ± 10.26a 133.79 ± 10.95a 1.40 ± 0.09a 2.30 ± 0.26a
1% a
111.38 ± 1.21 260.58 ± 1.83a 149.19 ± 10.67a 1.51 ± 0.06a 1.96 ± 0.14a
112.20 ± 1.67a 242.20 ± 7.13a 130.00 ± 7.29a 1.37 ± 0.06a 2.22 ± 0.10a
Values in a row with same superscripts denote no significant difference (P > 0.05).
aquaculture plants [29]. In the present, study we evaluated the potential application of G. gracilis as dietary supplement in feeding Danio rerio as model organism, in order to establishes the effect of three different percentage of the alga in the feed. While green, red and brown algae have been study as potential feeding supplements, to our best knowledge, our study for the first time focuses the attention on G. gracilis effects on antioxidant, immune mucosal parameters and growth of zebrafish (Danio rerio). One of the most important possible use of GP as dietary supplement for fish feed is the fish immune response regulation using a natural and environmental-friendly derived product as functional feed additives, it could represent a potential product useful in antibiotic-free aquaculture [43–46]. For these reasons our study evaluated among the others features the relation between the three-different percentage of GP and the antioxidant genes expression in zebrafish. Despite there was not significant improvement of the SOD expression for the 0.25 and 0.5% of GP, the group treated with 1% of GP added feed revealed a moderate rise in this gene expression. Regarding the expression of CAT gene all three GP treatments gave a rising of its expression. SOD and CAT elevated gene expressions may lead to the hypothesis that the GP in the feed has positive effects on zebrafish antioxidant defence. Algal protein and phenols are known to be compounds with high antioxidant effects [47,48]. The presence of antioxidant compounds has been established in G. gracilis by Francavilla et al. (2013) which also tested the antioxidant effects of these using three different in-vitro assays: FRAP (ferric-reducing antioxidant power), ABTS [2-2′-azino-bis (3-ethylbenz-thiazoline-6-sulfonic acid)], and DPPH (2,2-diphenyl-2-picrylhydrazyl hydrate) Radical Scavenging Activity. The il-1β, LYZ, and TNF-α gene expressions not resulted to be influenced by the administration of the GP. Il-1β is a cytokine protein secreted by several types of immune cells and is involved in inflammation processes [49]; in fact, il-1β regulates the expression of several genes in infection diseases [50,51]. The maintenance of il-1β levels demonstrates that the three experimental diets did not influence the inflammation processes in the zebrafish. Among the others, also mucosal immune parameters have been evaluated (Total Ig, Total protein and ALP activity). A mucus layer that represents the first barrier to a wide range of bacterial and viral pathogens covers the skin of fishes. Skin mucus, in fact, contains different biologically active compounds [52–54]. The
feeding trial. 2.6. Statistical analysis The significant difference (P < 0.05) among treatments, in case of different parameters measure, was assessed by One-Way ANOVA followed by Duncan's multiple-range test. Prior to statistical analysis the normality of data were checked and confirmed. The statistical analysis was done using SPSS software 19 (SPSS, USA). 3. Results The effects of 8 weeks Danio rerio fed on different concentration of Gracilaria gracilis powder (0.25–0.5-1%) on the expression levels of immune (TNF-α and LYZ), antioxidant (SOD and CAT), and interleukin 1 beta (il-1β) genes are plotted in Figs. 1 and 2. The SOD antioxidant enzyme genes expression reported a non-significant differences between the group feed with the 1% GP supplement and the control one (Fig. 1). However, the CAT gene expression revealed significantly higher values between the three treated groups and the control group. After 8 weeks of experiment there were non-significant differences among the different groups in the expression of TNF-α, LYZ and il-1β in all the experimental feeding groups resulted to be down regulated in comparison to control fishes. Table 3 reports the levels of mucosal immune parameters of zebrafish treated with different percentages of GP supplement. The different treatments gave significant increase of the total IG in the group with 1% of GP respect to normal-fed group. The total protein levels followed this last. A significant (P < 0.05) increase of ALP activity was evident in the group fed with 0.25 and 0.5% of GP, with the highest values in this latter. Table 4 resumes the results of dietary GP supplementation respect to the fishes' growth. The GP fed groups do not showed significant (P > 0.05) differences regarding the WG respect to the control group. Similar results were found for both SGR and FCR. During the 8 weeks of experimental period no mortality has been recorded. 4. Discussion Gracilaria gracilis is a red alga with several potential applications, ranging from agar extraction to bioremediation in wastewater of 235
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
results of our study indicate an the total Ig and total protein values after 8 weeks of dietary supplement of GP at 1%. Also, the ALP activity resulted to be higher in fishes feed with GP supplementation than the control ones. ALP is the enzyme Alkaline Phosphatase with antibacterial properties thanks to its hydrolytic activity [55]. So, an increase of ALP activity suggests an improvement of immune status [56]. Our results are in accord with previous studies that established the roles of various algal components on modulation of the immunological response, mucosal immunity parameters, and their involvement in maintaining healthy condition in several species [57,58]. The growth performance in zebrafish fed on GP was no significant different respect to the control group. Previous studies on other species of seaweed belonging to the Gracilaria genus [59]. The results of growth performance are widely affected by many factors comprehending life stage, species, experimental conditions and others [37]; this well explains the different findings of literature. In conclusion, we assessed that GP dietary supplementation can upregulates the mucosal immune and antioxidant enzyme. Considering these results, the low cost of the alga and the possibility to obtain raw material for the production of GP from environmental-friendly aquaculture, or better from Integrated Multi Trophic Aquaculture practices [29], Gracilaria gracilis can be takes in account as a good product in diet supplementation for and from sustainable aquaculture. Future studies on other aspects/effects of GP dietary supplement are needed to assess the eligibility of GP use in fishes rearing.
[13] M.A. Burgos-Aceves, A. Cohen, Y. Smith, C. Faggio, Estrogen regulation of gene expression in the teleost fish immune system, Fish Shellfish Immunol. 58 (2016) 42–49, https://doi.org/10.1016/j.fsi.2016.09.006. [14] E.R. Lauriano, S. Pergolizzi, G. Capillo, M. Kuciel, A. Alesci, C. Faggio, Immunohistochemical characterization of Toll-like receptor 2 in gut epithelial cells and macrophages of goldfish Carassius auratus fed with a high-cholesterol diet, Fish Shellfish Immunol. 59 (2016), https://doi.org/10.1016/j.fsi.2016.11.003. [15] M.A. Burgos-Aceves, A. Cohen, Y. Smith, C. Faggio, MicroRNAs and their role on fish oxidative stress during xenobiotic environmental exposures, Ecotoxicol. Environ. Saf. 148 (2018) 995–1000, https://doi.org/10.1016/j.ecoenv.2017.12. 001. [16] R.M. Reda, R. Mahmoud, K.M. Selim, I.E. El-Araby, Effects of dietary acidifiers on growth, hematology, immune response and disease resistance of Nile tilapia, Oreochromis niloticus, Fish Shellfish Immunol. (2016), https://doi.org/10.1016/j. fsi.2016.01.040. [17] S. Xu, L. Zhang, Q. Wu, X. Liu, S. Wang, C. You, Y. Li, Evaluation of dried seaweed Gracilaria lemaneiformis as an ingredient in diets for teleost fish Siganus canaliculatus, Aquacult. Int. (2011), https://doi.org/10.1007/s10499-011-9418-z. [18] X. Xuan, X. Wen, S. Li, D. Zhu, Y. Li, Potential use of macro-algae Gracilaria lemaneiformis in diets for the black sea bream, Acanthopagrus schlegelii, juvenile, Aquaculture (2013), https://doi.org/10.1016/j.aquaculture.2013.07.022. [19] E.-S.M. Younis, A.S. Al-Quffail, N.A. Al-Asgah, A.-W.A. Abdel-Warith, Y.S. AlHafedh, Effect of dietary fish meal replacement by red algae, Gracilaria arcuata , on growth performance and body composition of Nile tilapia Oreochromis niloticus, Saudi J. Biol. Sci. (2017), https://doi.org/10.1016/j.sjbs.2017.06.012. [20] V.V. Trichet, Nutrition and immunity: an update, Aquacult. Res. (2010), https:// doi.org/10.1111/j.1365-2109.2009.02374.x. [21] G. Genovese, C. Faggio, C. Gugliandolo, A. Torre, A. Spanò, M. Morabito, T.L. Maugeri, Invitro evaluation of antibacterial activity of Asparagopsis taxiformis from the Straits of Messina against pathogens relevant in aquaculture, Mar. Environ. Res. (2012), https://doi.org/10.1016/j.marenvres.2011.10.002. [22] C. Faggio, M. Pagano, A. Dottore, G. Genovese, M. Morabito, Evaluation of anticoagulant activity of two algal polysaccharides, Nat. Prod. Res. 30 (2016) 1934–1937, https://doi.org/10.1080/14786419.2015.1086347. [23] C. Dawczynski, R. Schubert, G. Jahreis, Amino acids, fatty acids, and dietary fibre in edible seaweed products, Food Chem. (2007), https://doi.org/10.1016/j.foodchem. 2006.09.041. [24] P. MacArtain, C.I.R. Gill, M. Brooks, R. Campbell, I.R. Rowland, Nutritional value of edible seaweeds, Nutr. Rev. (2007), https://doi.org/10.1301/nr.2007.dec.535-543. [25] P. Matanjun, S. Mohamed, N.M. Mustapha, K. Muhammad, Nutrient content of tropical edible seaweeds, Eucheuma cottonii, Caulerpa lentillifera and Sargassum polycystum, J. Appl. Phycol. (2009), https://doi.org/10.1007/s10811-008-9326-4. [26] S. Thanigaivel, N. Chandrasekaran, A. Mukherjee, J. Thomas, Investigation of seaweed extracts as a source of treatment against bacterial fish pathogen, Aquaculture (2015), https://doi.org/10.1016/j.aquaculture.2015.05.039. [27] S. Thanigaivel, N. Chandrasekaran, A. Mukherjee, John Thomas, Seaweeds as an alternative therapeutic source for aquatic disease management, Aquaculture (2016), https://doi.org/10.1016/j.aquaculture.2016.08.001. [28] M.J. Peixoto, E. Salas-Leitón, L.F. Pereira, A. Queiroz, F. Magalhães, R. Pereira, H. Abreu, P.A. Reis, J.F.M. Gonçalves, R.O.D.A. Ozório, Role of dietary seaweed supplementation on growth performance, digestive capacity and immune and stress responsiveness in European seabass (Dicentrarchus labrax), Aquac. Reports (2016), https://doi.org/10.1016/j.aqrep.2016.03.005. [29] G. Capillo, M. Sanfilippo, V. Aliko, N. Spano, A. Spinelli, A. Manganaro, Gracilaria gracilis, source of agar: a short review, Curr. Org. Chem. 21 (2017) 380–386, https://doi.org/10.2174/1385272820666161017164605. [30] M. Francavilla, M. Franchi, M. Monteleone, C. Caroppo, The red seaweed gracilaria gracilis as a multi products source, Mar. Drugs (2013), https://doi.org/10.3390/ md11103754. [31] G. Montalbano, G. Capillo, R. Laurà, F. Abbate, M. Levanti, M.C. Guerrera, E. Ciriaco, A. Germanà, Neuromast hair cells retain the capacity of regeneration during heavy metal exposure, Ann. Anat. 218 (2018), https://doi.org/10.1016/j. aanat.2018.03.007. [32] P. Licata, R. Tardugno, S. Pergolizzi, G. Capillo, M. Aragona, A. Colombo, T. Gervasi, V. Pellizzeri, N. Cicero, M. Calò, In vivo effects of PCB-126 and genistein on vitellogenin expression in zebrafish, Nat. Prod. Res. (2018), https://doi.org/10. 1080/14786419.2018.1455048. [33] G. Montalbano, M.M.F. Abbate, M.N.M.C. Guerrera, R.L.J.A. Vega, Melatonin treatment suppresses appetite genes and improves adipose tissue plasticity in dietinduced obese zebra fi sh, Endocrine (2018), https://doi.org/10.1007/s12020-0181653-x. [34] A. Bottari, C. Bottari, P. Carveni, S. Giacobbe, N. Spanò, Genesis and geomorphologic and ecological evolution of the Ganzirri salt marsh (Messina, Italy), Quat. Int. 140–141 (2005) 150–158 https://doi.org/10.1016/j.quaint.2005.07.001. [35] G. Capillo, S. Silvestro, M. Sanfilippo, E. Fiorino, G. Giangrosso, V. Ferrantelli, I. Vazzana, C. Faggio, Assessment of electrolytes and metals profile of the Faro lake (Capo Peloro lagoon, sicily, Italy) and its impact on Mytilus galloprovincialis, Chem. Biodivers. (2018), https://doi.org/10.1002/cbdv.201800044. [36] A. Spinelli, G. Capillo, C. Faggio, D. Viatale, N. Spanò, Returning of Hippocampus hippocampus (linnaeus, 1758) (syngnathidae) in the Faro lake – oriented natural Reserve of Capo Peloro, Italy, Nat. Prod. Res. (2018), https://doi.org/10.1080/ 14786419.2018.1490909. [37] S. Yousefi, S.H. Hoseinifar, H. Paknejad, A. Hajimoradloo, The effects of dietary supplement of galactooligosaccharide on innate immunity, immune related genes expression and growth performance in zebrafish (Danio rerio), Fish Shellfish Immunol. 73 (2018) 192–196, https://doi.org/10.1016/j.fsi.2017.12.022.
References [1] S.H. Hoseinifar, R. Safari, M. Dadar, Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: insights from zebrafish model, Gen. Comp. Endocrinol. (2017), https://doi.org/10.1016/j.ygcen. 2016.11.008. [2] R. Safari, S.H. Hoseinifar, M. Kavandi, Modulation of antioxidant defense and immune response in zebra fish (Danio rerio) using dietary sodium propionate, Fish Physiol. Biochem. (2016), https://doi.org/10.1007/s10695-016-0253-z. [3] F.A. Guardiola, C. Porcino, R. Cerezuela, A. Cuesta, C. Faggio, M.A. Esteban, Impact of date palm fruits extracts and probiotic enriched diet on antioxidant status, innate immune response and immune-related gene expression of European seabass (Dicentrarchus labrax), Fish Shellfish Immunol. (2016), https://doi.org/10.1016/j. fsi.2016.03.152. [4] M.A. Burgos-Aceves, A. Cohen, G. Paolella, M. Lepretti, Y. Smith, C. Faggio, L. Lionetti, Modulation of mitochondrial functions by xenobiotic-induced microRNA: from environmental sentinel organisms to mammals, Sci. Total Environ. 645 (2018) 79–88, https://doi.org/10.1016/j.scitotenv.2018.07.109. [5] V. Aliko, M. Qirjo, E. Sula, V. Morina, C. Faggio, Antioxidant defense system, immune response and erythron profile modulation in gold fish, Carassius auratus, after acute manganese treatment, Fish Shellfish Immunol. 76 (2018) 101–109, https:// doi.org/10.1016/j.fsi.2018.02.042. [6] D. Carbone, C. Faggio, Importance of prebiotics in aquaculture as immunostimulants. Effects on immune system of Sparus aurata and Dicentrarchus labrax, Fish Shellfish Immunol. 54 (2016) 172–178, https://doi.org/10.1016/j.fsi. 2016.04.011. [7] R. Costa, A. Albergamo, M. Piparo, G. Zaccone, G. Capillo, A. Manganaro, P. Dugo, L. Mondello, Multidimensional gas chromatographic techniques applied to the analysis of lipids from wild-caught and farmed marine species, Eur. J. Lipid Sci. Technol. (2016), https://doi.org/10.1002/ejlt.201600043. [8] N. Gobi, B. Vaseeharan, R. Rekha, S. Vijayakumar, C. Faggio, Bioaccumulation, cytotoxicity and oxidative stress of the acute exposure selenium in Oreochromis mossambicus, Ecotoxicol. Environ. Saf. 162 (2018) 147–159, https://doi.org/10. 1016/j.ecoenv.2018.06.070. [9] H. Van Doan, S.H. Hoseinifar, C. Faggio, C. Chitmanat, N.T. Mai, S. Jaturasitha, E. Ringø, Effects of corncob derived xylooligosaccharide on innate immune response, disease resistance, and growth performance in Nile tilapia (Oreochromis niloticus) fingerlings, Aquaculture 495 (2018) 786–793, https://doi.org/10.1016/j. aquaculture.2018.06.068. [10] M. Anjugam, B. Vaseeharan, A. Iswarya, N. Gobi, M. Divya, M.P. Thangaraj, P. Elumalai, Effect of β-1, 3 glucan binding protein based zinc oxide nanoparticles supplemented diet on immune response and disease resistance in Oreochromis mossambicus against Aeromonas hydrophila, Fish Shellfish Immunol. 76 (2018) 247–259, https://doi.org/10.1016/j.fsi.2018.03.012. [11] C. Faggio, F. Fazio, S. Marafioti, F. Arfuso, G. Piccione, Oral administration of Gum Arabic: effects on haematological parameters and oxidative stress markers in Mugil cephalus, Iran, J. Fish. Sci. 14 (2015) 60–72. [12] E.R. Lauriano, C. Faggio, G. Capillo, N. Spanò, M. Kuciel, M. Aragona, S. Pergolizzi, Immunohistochemical characterization of epidermal dendritic-like cells in giant mudskipper, Periophthalmodon schlosseri, Fish Shellfish Immunol. 74 (2018) 380–385, https://doi.org/10.1016/j.fsi.2018.01.014.
236
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
[50] S. Bird, J. Zou, T. Wang, B. Munday, C. Cunningham, C.J. Secombes, Evolution of interleukin-1β, Cytokine Growth Factor Rev. 13 (2002) 483–502, https://doi.org/ 10.1016/S1359-6101(02)00028-X. [51] S.H. Hoseinifar, A. Ahmadi, M. Khalili, M. Raeisi, H. Van Doan, C.M. Caipang, The study of antioxidant enzymes and immune-related genes expression in common carp (Cyprinus carpio) fingerlings fed different prebiotics, Aquacult. Res. 48 (2017), https://doi.org/10.1111/are.13359. [52] M.A.O. Dawood, S. Koshio, M. Ishikawa, S. Yokoyama, M.F. El Basuini, M.S. Hossain, T.H. Nhu, A.S. Moss, S. Dossou, H. Wei, Dietary supplementation of beta-glucan improves growth performance, the innate immune response and stress resistance of red sea bream, Pagrus major, Aquacult. Nutr. 23 (2017) 148–159, https://doi.org/10.1111/anu.12376. [53] G. Zaccone, D.S. Fudge, T.M. Winegard, G. Capillo, M. Kuciel, K. Funakoshi, E.R. Lauriano, Confocal imaging and phylogenetic considerations of the subcutaneous neurons in the Atlantic hagfish Myxine glutinosa, Acta Zool. 96 (2015), https://doi.org/10.1111/azo.12068. [54] E.R. Lauriano, S. Pergolizzi, J. Gangemi, M. Kuciel, G. Capillo, M. Aragona, C. Faggio, Immunohistochemical colocalization of G protein alpha subunits and 5HT in the rectal gland of the cartilaginous fish Scyliorhinus canicula, Microsc. Res. Tech. 80 (2017), https://doi.org/10.1002/jemt.22896. [55] Y. Iger, M. Abraham, The process of skin healing in experimentally wounded carp, J. Fish. Biol. 36 (1990) 421–437, https://doi.org/10.1111/j.1095-8649.1990. tb05622.x. [56] Z. Roosta, A. Hajimoradloo, R. Ghorbani, S.H. Hoseinifar, The effects of dietary vitamin C on mucosal immune responses and growth performance in Caspian roach (Rutilus rutilus caspicus) fry, Fish Physiol. Biochem. 40 (2014) 1601–1607, https:// doi.org/10.1007/s10695-014-9951-6. [57] H.T.D. Bui, S. Khosravi, V. Fournier, M. Herault, K.J. Lee, Growth performance, feed utilization, innate immunity, digestibility and disease resistance of juvenile red seabream (Pagrus major) fed diets supplemented with protein hydrolysates, Aquaculture 418–419 (2014) 11–16, https://doi.org/10.1016/j.aquaculture.2013. 09.046. [58] B.O. Gabrielsen, E. Austreng, Growth, product quality and immune status of Atlantic salmon, Salmo salar L., fed wet feed with alginate, Aquacult. Res. 29 (1998) 397–401, https://doi.org/10.1046/j.1365-2109.1998.00215.x. [59] M. Araújo, P. Rema, I. Sousa-Pinto, L.M. Cunha, M.J. Peixoto, M.A. Pires, F. Seixas, V. Brotas, C. Beltrán, L.M.P. Valente, Dietary inclusion of IMTA-cultivated Gracilaria vermiculophylla in rainbow trout (Oncorhynchus mykiss) diets: effects on growth, intestinal morphology, tissue pigmentation, and immunological response, J. Appl. Phycol. 28 (2016) 679–689, https://doi.org/10.1007/s10811-0150591-8.
[38] H. Holbech, L. Andersen, G.I. Petersen, B. Korsgaard, K.L. Pedersen, P. Bjerregaard, Development of an ELISA for vitellogenin in whole body homogenate of zebrafish (Danio rerio), Comp. Biochem. Physiol. C Toxicol. Pharmacol. (2001), https://doi. org/10.1016/S1532-0456(01)00229-0. [39] R. Safari, S.H. Hoseinifar, S. Nejadmoghadam, A. Jafar, Transciptomic study of mucosal immune, antioxidant and growth related genes and non-specific immune response of common carp (Cyprinus carpio) fed dietary Ferula (Ferula assafoetida), Fish Shellfish Immunol. (2016), https://doi.org/10.1016/j.fsi.2016.05.038. [40] S.H. Hoseinifar, F. Zoheiri, C.M. Caipang, Dietary sodium propionate improved performance, mucosal and humoral immune responses in Caspian white fish (Rutilus frisii kutum) fry, Fish Shellfish Immunol. (2016), https://doi.org/10.1016/ j.fsi.2016.06.027. [41] S.H. Hoseinifar, A. Ahmadi, M. Raeisi, S.M. Hoseini, M. Khalili, N. Behnampour, Comparative study on immunomodulatory and growth enhancing effects of three prebiotics (galactooligosaccharide, fructooligosaccharide and inulin) in common carp (Cyprinus carpio), Aquacult. Res. (2017), https://doi.org/10.1111/are.13156. [42] O.H. LOWRY, N.J. ROSEBROUGH, A.L. FARR, R.J. RANDALL, Protein measurement with the Folin phenol reagent, J. Biol. Chem. (1951), https://doi.org/10.1016/ 0304-3894(92)87011-4. [43] D.L. Merrifield, G. Bradley, G.M. Harper, R.T.M. Baker, C.B. Munn, S.J. Davies, Assessment of the effects of vegetative and lyophilized Pediococcus acidilactici on growth, feed utilization, intestinal colonization and health parameters of rainbow trout (Oncorhynchus mykiss Walbaum), Aquacult. Nutr. 17 (2011) 73–79, https:// doi.org/10.1111/j.1365-2095.2009.00712.x. [44] C.M.A. Caipang, C.C. Lazado, Nutritional impacts on fish mucosa: immunostimulants, pre- and probiotics, Mucosal Heal. Aquac, 2015, pp. 211–272, , https://doi.org/10.1016/B978-0-12-417186-2.00009-1. [45] A. Oliva-Teles, Nutrition and health of aquaculture fish, J. Fish. Dis. 35 (2012) 83–108, https://doi.org/10.1111/j.1365-2761.2011.01333.x. [46] C. Pohlenz, D.M. Gatlin, Interrelationships between fish nutrition and health, Aquaculture 431 (2014) 111–117, https://doi.org/10.1016/j.aquaculture.2014.02. 008. [47] J. Bernal, J.A. Mendiola, E. Ibáñez, A. Cifuentes, Advanced analysis of nutraceuticals, J. Pharmaceut. Biomed. Anal. (2011), https://doi.org/10.1016/j.jpba. 2010.11.033. [48] L. Onofrejová, J. Vašíčková, B. Klejdus, P. Stratil, L. Mišurcová, S. Kráčmar, J. Kopecký, J. Vacek, Bioactive phenols in algae: the application of pressurizedliquid and solid-phase extraction techniques, J. Pharmaceut. Biomed. Anal. (2010), https://doi.org/10.1016/j.jpba.2009.03.027. [49] J. Zou, C. Secombes, The function of fish cytokines, Biology 5 (2016) 23, https:// doi.org/10.3390/biology5020023.
237
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Mucosal immune parameters, immune and antioxidant defence related genes expression and growth performance of zebrafish (Danio rerio) fed on Gracilaria gracilis powder
T
Seyed Hossein Hoseinifara,1, Samira Yousefia, Gioele Capillob,1, Hamed Paknejada, Mohsen Khalilic, Alijan Tabarraeie, Hien Van Doand, Nunziacarla Spanòb, Caterina Faggiob,∗ a
Department of Fisheries, Faculty of Fisheries and Environmental Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina, Italy Medical Cellular & Molecular Research Center, Golestan University of Medical Sciences, Gorgan, Iran d Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai, 50200, Thailand e Infectious Diseases Research Center, Golestan University of Medical Sciences, Gorgan, Iran b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Gracilaria gracilis Danio rerio Immune parameters Antioxidant enzymes Growth
In the present study zebrafish (Danio rerio) has been used as model organism to establish the effects of dietary supplementation of Gracilaria gracilis powder (GP) on mucosal and innate immune parameters, antioxidant enzymes, and growth. In order to establish these features, zebrafish were fed for eight weeks with experimental diets containing different levels of Red algae, 0.25, 0.5 and 1% of GP; also, a group was fed with control diet. At the end of the experimental period the antioxidant superoxide dismutase and catalase (SOD, CAT) genes expression, interleukin 1 beta (il-1β), lysozyme (LYZ), tumor necrosis factor alpha (TNF-α) for immune-related genes expression, total immunoglobulin (Ig), total protein, alkaline phosphatase (ALP) activity for innate immune parameters, and growth performance have been established. The GP dietary supplementation showed differences in SOD and CAT expression in zebrafish whole body respect to the control group. Non-signifcant differences were noticed among the different groups in case of TNF-α, LYZ and il-1expression (P > 0.05). The skin mucus total Ig and total protein in the group fed on 1% of GP were significantly higher respect to control group (P < 0.05). 0.25 and 0.5% of GP dietary supplementation significantly enhanced skin mucus ALP activity levels (P < 0.05). No significant differences were recorded for growth performances among groups (P > 0.05). The results obtained in the present study revealed that G. gracilis could be takes in account as fishes diet supplementation for its immune system stimulants effects.
1. Introduction
[16–19]. Algae as an integration of fish feed show great potential in enhance immune system function and disease resistance [20]. Among the different seaweeds studied and evaluated as fish feed supplements, the most encouraging results are given by red algae. Red algae have a chemical composition that reveals a high content in proteins and diverse bioactive compounds with great pharmaceutical and biomedical potential [21,22]. Rhodophyta composition reveal high content in vitamin C, amino acids, peptides, omega-3 fatty acids, and proteins [23–25]. Furthermore, algae-derived supplements showed potential immune-stimulants effects for different fish species [26,27]. Peixoto and coworkers [28] demonstrated that dietary Gracilaria spp. supplementation enhanced the antioxidant capacity and improved innate
The correlation between feed composition and wellness of aquatic organisms is a well-explored field. Alimentation has important consequences on animal physiology, especially on growth performance and immune modulatory activity [1–3]. Fishes are widely studied organisms for their importance as bioindicators and as source of protein both from wild and cultured species [4–16]. Numerous studies have established the potential use of different algae as supplement or integration of fish feed. Macro and micro algae have been used as dietary integration or substitution to improve health and growth performance of different farmed fish species
∗
Corresponding author. Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina Viale Ferdinando Stagno d'Alcontres, 31-98166, S.Agata-Messina, Italy. E-mail address: [email protected] (C. Faggio). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.fsi.2018.09.046 Received 24 July 2018; Received in revised form 6 September 2018; Accepted 13 September 2018 Available online 14 September 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
Table 1 Composition of the basal diet used throughout the experiment. Proximate analysis (%) Dry matter Crude protein Crude lipid Ash
93.6 38.9 15.0 11
immune system indicators of the European seabass (Dicentrarchus labrax). Gracilaria gracilis is a marine red seaweed belonging to Rhodophyta, Florideae, Gigartinales, Gracilariaceae; it is widely used as raw material for agar extraction and for this reason is listed as agarophyte [29]. However, besides agar, G. gracilis represents a source of many other useful natural products such as lipids and fatty acids, sterols, proteins, phycobiliproteins, phenols, carbohydrates [29,30]; these latter authors defined G. gracilis as a “Multi Product Source”. Despite the well-studied characteristics of this seaweed (agar properties, biological cycle, chemical composition) the literature review revealed the presence of only few experiments that used Gracilaria species as feed supplement for commercial reared-species. The G. gracilis effects on antioxidant, immune mucosal parameters and growth of fish are absent in literature. The present study explores the potentiality of G. gracilis as supplement in fish diet, how it influences mucosal immune parameters, antioxidant enzymes and their related genes expression, and growth, on zebrafish (Danio rerio) as model organisms [31–33]. 2. Material & methods 2.1. Fish husbandry and experimental diets Zebrafish were purchased from a local farmer and transported to Aquaculture lab of GUASNR. After two weeks acclimatization to experimental condition, fish allocated to twelve aquaria (100 L) at rate of 50 zebrafish per aquarium. The feeding trial lasted for eight weeks and during the period fish were fed on experimental diets containing different levels of red algae up the apparent satiation, three times a day. Utmost care was considered to maintain water quality parameters, by regular cleaning, water exchange and aeration.
Fig. 1. Effects of 8-weeks feeding with different levels of Gracilaria gracilis powder on the relative expression of Superoxide dismutase (SOD) and Catalase (CAT) genes. Values are presented as the mean ± S.D. Bars assigned with different letter denote significant difference (P < 0.05).
waters and transported to the aquaculture laboratory of the University of Messina, where it has been washed with fresh water and epiphytes and/or other algal species were removed. Algal biomass has been oven dried at 45 °C for 72 h, in order to reduce the water content of algae, and then pulverized in a mortar. The Gracilaria powder (GP), then has been sent to the Department of Fisheries (Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran) for the experiments.
2.2. Algal collection and treatment Thalli of the red alga Gracilaria gracilis were collected from a natural bed in the Natural Oriented Reserve of Capo Peloro (Messina, Sicily, Italy). The collection site (38°15′49.7″N 15°37′34.9″E) was located in a canal connecting two coastal brackish lagoon [34], for a description of the area see Refs. [35,36]. Then, the algae were washed in the lagoon Table 2 The sequences of used primers and accession numbers. Primer name
Primer Sequence
Application
Accession number
sod q-PCRF sod q-PCRR cat q-PCRF cat q-PCRR il-1β q-PCRF il-1β q-PCRR tnfα q-PCRF tnfα q-PCRR lyz q-PCRF lyz q-PCRR β-actin q-PCRF β-actin q-PCR R
GGGTGGCAATGAGGAAAG GCCCACATAGAAATGCACAG GCATGTTGGAAAGACGACAC GTGGATGAAAGACGGAGACA CGTCTCCACATCTCGTACTCA GTGTCTTTCCTGTCCATCTCC CTGCTTCACGCTCCATAAGA CTGGTCCTGGTCATCTCTCC GGCAGTGGTGTTTTTGTGTC CGTAGTCCTTCCCCGTATCA AGCAGATGTGGATCAGCAAG TACCTCCCTTTGCCAGTTTC
antioxidant
BC055516.1
antioxidant
AJ007505.1
immune
AY340959.1
immune
AY427649.1
immune
NM_139180.1
Housekeeping gene
NM_131031.1
233
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
which fed to control group. The information on proximate composition of the basal diet is mentioned in Table 1. For preparation of treated diets, the basal diet was supplemented with 0.25, 0.5 and 1% of GP according to the method described elsewhere [2]. The prepared diets were kept in zip pack at the 4 °C. 2.4. Gene expression studies 2.4.1. Sample collection At the end of feeding trial, 15 specimens were randomly selected from each experimental unit and rapidly anesthetized by using clove powder (0.5 g/1). Then, the heads and fins were removed and whole body sample was prepared according to the protocol suggested by Ref. [38]. The samples were immediately stored in liquid nitrogen until use. 2.4.2. RNA isolation, cDNA synthesis and real-time PCR Evaluation of relative expression of immune and antioxidant related genes was done using Real time PCR and based on the protocol described elsewhere [39]. The BIOZOL Reagent protocol (Bioflux-Bioer, China) was used for isolation of RNA. The concentration of RNA was determined by Nanophotometer (IMPLEN-P100) reading at 260/ 280 nm and the integrity verified by evaluation of 28 S and 18 S ribosomal RNA (rRNA) using agarose gel (1.5%). DNase I (Fermentas, France) treating eliminated the DNA in the samples. The Fermentase protocol was followed for cDNA synthesis (Yousefi et al., 2018). Realtime PCR analysis was performed using Fermentase Maxima SYBR Green qPCR Master Mix (1×) in an iCycler (BioRad, USA). The obtained data were analyzed using the iQ5 optical system software version 2.0 (BioRad). We used the sequences available in GenBank for designing the qPCR primers for SOD, CAT, il-1β, LYZ and β-actin (Table 2). Also, β-actin gene was considered as reference gene. The relative mRNA expression levels of SOD, CAT, il-1β, TNF-α LYZ and βactin were calculated by the 2−ΔΔCt method. In all cases, each PCR was performed in triplicates. 2.5. Evaluation of mucosal immune parameters At the end of trial, nine 24-h starved zebrafish were randomly selected from each experimental unit and after anesthesia placed in polyethylene bags containing 5 mL of 50 mM NaCl (Sigma, Steinheim, Germany). The skin mucus collection was done following the method suggested previously [40,41]. To ease mucus collection the fish by gently rubbed inside the bags for 1–2 min. The collected samples were centrifuged and the supernatant stored at −80 °C until analysis. The standard protocol of Lowry et al. [42] was followed for determination of the total protein level in samples. In this method we used bovine serum albumin as standard. The absorbance was read using a spectrophotometer (Biochrom, Libra S12) at 750 nm. For determination of Alkaline phosphatase activity (ALP) was used a commercial kit (Ziest Chem Diagnostics kit, Iran). The absorption was read at 405 nm and the ALP activity was calculated based on the formula suggested by the manufacturer. The skin mucus total Ig level was determined according to the method described previously [40]. The method was based on two times determination of total protein, before and after removing immunoglobulin molecules by using a 12% solution of polyethylene glycol (Sigma).
Fig. 2. The effects of 8-weeks feeding with different levels of Gracilaria gracilis powder on the relative expression of lysozyme (LYZ), tumor necrosis factor alpha (TNF-alpha), interleukin 1 beta (IL1B) genes. Values are presented as the mean ± S.D. Bars assigned with the same letter denote no significant difference (P > 0.05).
2.5.1. Growth performance After eight week feeding on experimental diet, the growth performance parameters was calculated according to the following formula: Weight gain = W2 (g) − W1 (g); Specific growth rate (SGR) = 100 (ln W2−ln W1)/T
2.3. Preparation of experimental diets
Feed conversion ratio (FCR) = feed intake (g) / weight gain (g);
In this study we used a commercial diet (BioMar SAS, Nersac, France) which was suggested in a previous study [37] as basal diet
Where W1 is the initial weight, W2 is the final weight, T is duration of 234
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
Table 3 The effects different levels of dietary Gracilaria gracilis powder on mucosal immune parameters of zebrafish (Danio rerio). Values are presented as the mean ± S.D (n = 9). Dietary Gracilaria gracilis powder
Total Ig (mg ml−1) Total protein (mg ml−1) ALP (U ml−1)
0% (Control)
0.25%
0.5%
1%
22.38 ± 3.54 b 30.04 ± 3.67 b 193.9 ± 9.6c
27.32 ± 1.93 ab 35.31 ± 2.77ab 241.7 ± 4.6 b
29.95 ± 4.65 35.47 ± 3.84 262.2 ± 3.2a
ab ab
36.62 ± 3.81a 43.29 ± 2.43a 205.2 ± 3.7c
Values in a row assigned with different letters denote significant difference (P < 0.05). Table 4 The effects different levels of dietary Gracilaria gracilis powder on growth performance of zebrafish (Danio rerio). Values are presented as the mean ± S.D. Dietary Gracilaria gracilis powder 0% (Control) Initial weight (mg) Final weight (mg) WG (mg) SGR FCR
0.25% a
112.5 ± 0.75 271.12 ± 12.30a 158.64 ± 11.87a 1.57 ± 0.07a 1.99 ± 0.17a
0.5% a
112.19 ± 1.11 245.98 ± 10.26a 133.79 ± 10.95a 1.40 ± 0.09a 2.30 ± 0.26a
1% a
111.38 ± 1.21 260.58 ± 1.83a 149.19 ± 10.67a 1.51 ± 0.06a 1.96 ± 0.14a
112.20 ± 1.67a 242.20 ± 7.13a 130.00 ± 7.29a 1.37 ± 0.06a 2.22 ± 0.10a
Values in a row with same superscripts denote no significant difference (P > 0.05).
aquaculture plants [29]. In the present, study we evaluated the potential application of G. gracilis as dietary supplement in feeding Danio rerio as model organism, in order to establishes the effect of three different percentage of the alga in the feed. While green, red and brown algae have been study as potential feeding supplements, to our best knowledge, our study for the first time focuses the attention on G. gracilis effects on antioxidant, immune mucosal parameters and growth of zebrafish (Danio rerio). One of the most important possible use of GP as dietary supplement for fish feed is the fish immune response regulation using a natural and environmental-friendly derived product as functional feed additives, it could represent a potential product useful in antibiotic-free aquaculture [43–46]. For these reasons our study evaluated among the others features the relation between the three-different percentage of GP and the antioxidant genes expression in zebrafish. Despite there was not significant improvement of the SOD expression for the 0.25 and 0.5% of GP, the group treated with 1% of GP added feed revealed a moderate rise in this gene expression. Regarding the expression of CAT gene all three GP treatments gave a rising of its expression. SOD and CAT elevated gene expressions may lead to the hypothesis that the GP in the feed has positive effects on zebrafish antioxidant defence. Algal protein and phenols are known to be compounds with high antioxidant effects [47,48]. The presence of antioxidant compounds has been established in G. gracilis by Francavilla et al. (2013) which also tested the antioxidant effects of these using three different in-vitro assays: FRAP (ferric-reducing antioxidant power), ABTS [2-2′-azino-bis (3-ethylbenz-thiazoline-6-sulfonic acid)], and DPPH (2,2-diphenyl-2-picrylhydrazyl hydrate) Radical Scavenging Activity. The il-1β, LYZ, and TNF-α gene expressions not resulted to be influenced by the administration of the GP. Il-1β is a cytokine protein secreted by several types of immune cells and is involved in inflammation processes [49]; in fact, il-1β regulates the expression of several genes in infection diseases [50,51]. The maintenance of il-1β levels demonstrates that the three experimental diets did not influence the inflammation processes in the zebrafish. Among the others, also mucosal immune parameters have been evaluated (Total Ig, Total protein and ALP activity). A mucus layer that represents the first barrier to a wide range of bacterial and viral pathogens covers the skin of fishes. Skin mucus, in fact, contains different biologically active compounds [52–54]. The
feeding trial. 2.6. Statistical analysis The significant difference (P < 0.05) among treatments, in case of different parameters measure, was assessed by One-Way ANOVA followed by Duncan's multiple-range test. Prior to statistical analysis the normality of data were checked and confirmed. The statistical analysis was done using SPSS software 19 (SPSS, USA). 3. Results The effects of 8 weeks Danio rerio fed on different concentration of Gracilaria gracilis powder (0.25–0.5-1%) on the expression levels of immune (TNF-α and LYZ), antioxidant (SOD and CAT), and interleukin 1 beta (il-1β) genes are plotted in Figs. 1 and 2. The SOD antioxidant enzyme genes expression reported a non-significant differences between the group feed with the 1% GP supplement and the control one (Fig. 1). However, the CAT gene expression revealed significantly higher values between the three treated groups and the control group. After 8 weeks of experiment there were non-significant differences among the different groups in the expression of TNF-α, LYZ and il-1β in all the experimental feeding groups resulted to be down regulated in comparison to control fishes. Table 3 reports the levels of mucosal immune parameters of zebrafish treated with different percentages of GP supplement. The different treatments gave significant increase of the total IG in the group with 1% of GP respect to normal-fed group. The total protein levels followed this last. A significant (P < 0.05) increase of ALP activity was evident in the group fed with 0.25 and 0.5% of GP, with the highest values in this latter. Table 4 resumes the results of dietary GP supplementation respect to the fishes' growth. The GP fed groups do not showed significant (P > 0.05) differences regarding the WG respect to the control group. Similar results were found for both SGR and FCR. During the 8 weeks of experimental period no mortality has been recorded. 4. Discussion Gracilaria gracilis is a red alga with several potential applications, ranging from agar extraction to bioremediation in wastewater of 235
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
results of our study indicate an the total Ig and total protein values after 8 weeks of dietary supplement of GP at 1%. Also, the ALP activity resulted to be higher in fishes feed with GP supplementation than the control ones. ALP is the enzyme Alkaline Phosphatase with antibacterial properties thanks to its hydrolytic activity [55]. So, an increase of ALP activity suggests an improvement of immune status [56]. Our results are in accord with previous studies that established the roles of various algal components on modulation of the immunological response, mucosal immunity parameters, and their involvement in maintaining healthy condition in several species [57,58]. The growth performance in zebrafish fed on GP was no significant different respect to the control group. Previous studies on other species of seaweed belonging to the Gracilaria genus [59]. The results of growth performance are widely affected by many factors comprehending life stage, species, experimental conditions and others [37]; this well explains the different findings of literature. In conclusion, we assessed that GP dietary supplementation can upregulates the mucosal immune and antioxidant enzyme. Considering these results, the low cost of the alga and the possibility to obtain raw material for the production of GP from environmental-friendly aquaculture, or better from Integrated Multi Trophic Aquaculture practices [29], Gracilaria gracilis can be takes in account as a good product in diet supplementation for and from sustainable aquaculture. Future studies on other aspects/effects of GP dietary supplement are needed to assess the eligibility of GP use in fishes rearing.
[13] M.A. Burgos-Aceves, A. Cohen, Y. Smith, C. Faggio, Estrogen regulation of gene expression in the teleost fish immune system, Fish Shellfish Immunol. 58 (2016) 42–49, https://doi.org/10.1016/j.fsi.2016.09.006. [14] E.R. Lauriano, S. Pergolizzi, G. Capillo, M. Kuciel, A. Alesci, C. Faggio, Immunohistochemical characterization of Toll-like receptor 2 in gut epithelial cells and macrophages of goldfish Carassius auratus fed with a high-cholesterol diet, Fish Shellfish Immunol. 59 (2016), https://doi.org/10.1016/j.fsi.2016.11.003. [15] M.A. Burgos-Aceves, A. Cohen, Y. Smith, C. Faggio, MicroRNAs and their role on fish oxidative stress during xenobiotic environmental exposures, Ecotoxicol. Environ. Saf. 148 (2018) 995–1000, https://doi.org/10.1016/j.ecoenv.2017.12. 001. [16] R.M. Reda, R. Mahmoud, K.M. Selim, I.E. El-Araby, Effects of dietary acidifiers on growth, hematology, immune response and disease resistance of Nile tilapia, Oreochromis niloticus, Fish Shellfish Immunol. (2016), https://doi.org/10.1016/j. fsi.2016.01.040. [17] S. Xu, L. Zhang, Q. Wu, X. Liu, S. Wang, C. You, Y. Li, Evaluation of dried seaweed Gracilaria lemaneiformis as an ingredient in diets for teleost fish Siganus canaliculatus, Aquacult. Int. (2011), https://doi.org/10.1007/s10499-011-9418-z. [18] X. Xuan, X. Wen, S. Li, D. Zhu, Y. Li, Potential use of macro-algae Gracilaria lemaneiformis in diets for the black sea bream, Acanthopagrus schlegelii, juvenile, Aquaculture (2013), https://doi.org/10.1016/j.aquaculture.2013.07.022. [19] E.-S.M. Younis, A.S. Al-Quffail, N.A. Al-Asgah, A.-W.A. Abdel-Warith, Y.S. AlHafedh, Effect of dietary fish meal replacement by red algae, Gracilaria arcuata , on growth performance and body composition of Nile tilapia Oreochromis niloticus, Saudi J. Biol. Sci. (2017), https://doi.org/10.1016/j.sjbs.2017.06.012. [20] V.V. Trichet, Nutrition and immunity: an update, Aquacult. Res. (2010), https:// doi.org/10.1111/j.1365-2109.2009.02374.x. [21] G. Genovese, C. Faggio, C. Gugliandolo, A. Torre, A. Spanò, M. Morabito, T.L. Maugeri, Invitro evaluation of antibacterial activity of Asparagopsis taxiformis from the Straits of Messina against pathogens relevant in aquaculture, Mar. Environ. Res. (2012), https://doi.org/10.1016/j.marenvres.2011.10.002. [22] C. Faggio, M. Pagano, A. Dottore, G. Genovese, M. Morabito, Evaluation of anticoagulant activity of two algal polysaccharides, Nat. Prod. Res. 30 (2016) 1934–1937, https://doi.org/10.1080/14786419.2015.1086347. [23] C. Dawczynski, R. Schubert, G. Jahreis, Amino acids, fatty acids, and dietary fibre in edible seaweed products, Food Chem. (2007), https://doi.org/10.1016/j.foodchem. 2006.09.041. [24] P. MacArtain, C.I.R. Gill, M. Brooks, R. Campbell, I.R. Rowland, Nutritional value of edible seaweeds, Nutr. Rev. (2007), https://doi.org/10.1301/nr.2007.dec.535-543. [25] P. Matanjun, S. Mohamed, N.M. Mustapha, K. Muhammad, Nutrient content of tropical edible seaweeds, Eucheuma cottonii, Caulerpa lentillifera and Sargassum polycystum, J. Appl. Phycol. (2009), https://doi.org/10.1007/s10811-008-9326-4. [26] S. Thanigaivel, N. Chandrasekaran, A. Mukherjee, J. Thomas, Investigation of seaweed extracts as a source of treatment against bacterial fish pathogen, Aquaculture (2015), https://doi.org/10.1016/j.aquaculture.2015.05.039. [27] S. Thanigaivel, N. Chandrasekaran, A. Mukherjee, John Thomas, Seaweeds as an alternative therapeutic source for aquatic disease management, Aquaculture (2016), https://doi.org/10.1016/j.aquaculture.2016.08.001. [28] M.J. Peixoto, E. Salas-Leitón, L.F. Pereira, A. Queiroz, F. Magalhães, R. Pereira, H. Abreu, P.A. Reis, J.F.M. Gonçalves, R.O.D.A. Ozório, Role of dietary seaweed supplementation on growth performance, digestive capacity and immune and stress responsiveness in European seabass (Dicentrarchus labrax), Aquac. Reports (2016), https://doi.org/10.1016/j.aqrep.2016.03.005. [29] G. Capillo, M. Sanfilippo, V. Aliko, N. Spano, A. Spinelli, A. Manganaro, Gracilaria gracilis, source of agar: a short review, Curr. Org. Chem. 21 (2017) 380–386, https://doi.org/10.2174/1385272820666161017164605. [30] M. Francavilla, M. Franchi, M. Monteleone, C. Caroppo, The red seaweed gracilaria gracilis as a multi products source, Mar. Drugs (2013), https://doi.org/10.3390/ md11103754. [31] G. Montalbano, G. Capillo, R. Laurà, F. Abbate, M. Levanti, M.C. Guerrera, E. Ciriaco, A. Germanà, Neuromast hair cells retain the capacity of regeneration during heavy metal exposure, Ann. Anat. 218 (2018), https://doi.org/10.1016/j. aanat.2018.03.007. [32] P. Licata, R. Tardugno, S. Pergolizzi, G. Capillo, M. Aragona, A. Colombo, T. Gervasi, V. Pellizzeri, N. Cicero, M. Calò, In vivo effects of PCB-126 and genistein on vitellogenin expression in zebrafish, Nat. Prod. Res. (2018), https://doi.org/10. 1080/14786419.2018.1455048. [33] G. Montalbano, M.M.F. Abbate, M.N.M.C. Guerrera, R.L.J.A. Vega, Melatonin treatment suppresses appetite genes and improves adipose tissue plasticity in dietinduced obese zebra fi sh, Endocrine (2018), https://doi.org/10.1007/s12020-0181653-x. [34] A. Bottari, C. Bottari, P. Carveni, S. Giacobbe, N. Spanò, Genesis and geomorphologic and ecological evolution of the Ganzirri salt marsh (Messina, Italy), Quat. Int. 140–141 (2005) 150–158 https://doi.org/10.1016/j.quaint.2005.07.001. [35] G. Capillo, S. Silvestro, M. Sanfilippo, E. Fiorino, G. Giangrosso, V. Ferrantelli, I. Vazzana, C. Faggio, Assessment of electrolytes and metals profile of the Faro lake (Capo Peloro lagoon, sicily, Italy) and its impact on Mytilus galloprovincialis, Chem. Biodivers. (2018), https://doi.org/10.1002/cbdv.201800044. [36] A. Spinelli, G. Capillo, C. Faggio, D. Viatale, N. Spanò, Returning of Hippocampus hippocampus (linnaeus, 1758) (syngnathidae) in the Faro lake – oriented natural Reserve of Capo Peloro, Italy, Nat. Prod. Res. (2018), https://doi.org/10.1080/ 14786419.2018.1490909. [37] S. Yousefi, S.H. Hoseinifar, H. Paknejad, A. Hajimoradloo, The effects of dietary supplement of galactooligosaccharide on innate immunity, immune related genes expression and growth performance in zebrafish (Danio rerio), Fish Shellfish Immunol. 73 (2018) 192–196, https://doi.org/10.1016/j.fsi.2017.12.022.
References [1] S.H. Hoseinifar, R. Safari, M. Dadar, Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: insights from zebrafish model, Gen. Comp. Endocrinol. (2017), https://doi.org/10.1016/j.ygcen. 2016.11.008. [2] R. Safari, S.H. Hoseinifar, M. Kavandi, Modulation of antioxidant defense and immune response in zebra fish (Danio rerio) using dietary sodium propionate, Fish Physiol. Biochem. (2016), https://doi.org/10.1007/s10695-016-0253-z. [3] F.A. Guardiola, C. Porcino, R. Cerezuela, A. Cuesta, C. Faggio, M.A. Esteban, Impact of date palm fruits extracts and probiotic enriched diet on antioxidant status, innate immune response and immune-related gene expression of European seabass (Dicentrarchus labrax), Fish Shellfish Immunol. (2016), https://doi.org/10.1016/j. fsi.2016.03.152. [4] M.A. Burgos-Aceves, A. Cohen, G. Paolella, M. Lepretti, Y. Smith, C. Faggio, L. Lionetti, Modulation of mitochondrial functions by xenobiotic-induced microRNA: from environmental sentinel organisms to mammals, Sci. Total Environ. 645 (2018) 79–88, https://doi.org/10.1016/j.scitotenv.2018.07.109. [5] V. Aliko, M. Qirjo, E. Sula, V. Morina, C. Faggio, Antioxidant defense system, immune response and erythron profile modulation in gold fish, Carassius auratus, after acute manganese treatment, Fish Shellfish Immunol. 76 (2018) 101–109, https:// doi.org/10.1016/j.fsi.2018.02.042. [6] D. Carbone, C. Faggio, Importance of prebiotics in aquaculture as immunostimulants. Effects on immune system of Sparus aurata and Dicentrarchus labrax, Fish Shellfish Immunol. 54 (2016) 172–178, https://doi.org/10.1016/j.fsi. 2016.04.011. [7] R. Costa, A. Albergamo, M. Piparo, G. Zaccone, G. Capillo, A. Manganaro, P. Dugo, L. Mondello, Multidimensional gas chromatographic techniques applied to the analysis of lipids from wild-caught and farmed marine species, Eur. J. Lipid Sci. Technol. (2016), https://doi.org/10.1002/ejlt.201600043. [8] N. Gobi, B. Vaseeharan, R. Rekha, S. Vijayakumar, C. Faggio, Bioaccumulation, cytotoxicity and oxidative stress of the acute exposure selenium in Oreochromis mossambicus, Ecotoxicol. Environ. Saf. 162 (2018) 147–159, https://doi.org/10. 1016/j.ecoenv.2018.06.070. [9] H. Van Doan, S.H. Hoseinifar, C. Faggio, C. Chitmanat, N.T. Mai, S. Jaturasitha, E. Ringø, Effects of corncob derived xylooligosaccharide on innate immune response, disease resistance, and growth performance in Nile tilapia (Oreochromis niloticus) fingerlings, Aquaculture 495 (2018) 786–793, https://doi.org/10.1016/j. aquaculture.2018.06.068. [10] M. Anjugam, B. Vaseeharan, A. Iswarya, N. Gobi, M. Divya, M.P. Thangaraj, P. Elumalai, Effect of β-1, 3 glucan binding protein based zinc oxide nanoparticles supplemented diet on immune response and disease resistance in Oreochromis mossambicus against Aeromonas hydrophila, Fish Shellfish Immunol. 76 (2018) 247–259, https://doi.org/10.1016/j.fsi.2018.03.012. [11] C. Faggio, F. Fazio, S. Marafioti, F. Arfuso, G. Piccione, Oral administration of Gum Arabic: effects on haematological parameters and oxidative stress markers in Mugil cephalus, Iran, J. Fish. Sci. 14 (2015) 60–72. [12] E.R. Lauriano, C. Faggio, G. Capillo, N. Spanò, M. Kuciel, M. Aragona, S. Pergolizzi, Immunohistochemical characterization of epidermal dendritic-like cells in giant mudskipper, Periophthalmodon schlosseri, Fish Shellfish Immunol. 74 (2018) 380–385, https://doi.org/10.1016/j.fsi.2018.01.014.
236
Fish and Shellfish Immunology 83 (2018) 232–237
S.H. Hoseinifar et al.
[50] S. Bird, J. Zou, T. Wang, B. Munday, C. Cunningham, C.J. Secombes, Evolution of interleukin-1β, Cytokine Growth Factor Rev. 13 (2002) 483–502, https://doi.org/ 10.1016/S1359-6101(02)00028-X. [51] S.H. Hoseinifar, A. Ahmadi, M. Khalili, M. Raeisi, H. Van Doan, C.M. Caipang, The study of antioxidant enzymes and immune-related genes expression in common carp (Cyprinus carpio) fingerlings fed different prebiotics, Aquacult. Res. 48 (2017), https://doi.org/10.1111/are.13359. [52] M.A.O. Dawood, S. Koshio, M. Ishikawa, S. Yokoyama, M.F. El Basuini, M.S. Hossain, T.H. Nhu, A.S. Moss, S. Dossou, H. Wei, Dietary supplementation of beta-glucan improves growth performance, the innate immune response and stress resistance of red sea bream, Pagrus major, Aquacult. Nutr. 23 (2017) 148–159, https://doi.org/10.1111/anu.12376. [53] G. Zaccone, D.S. Fudge, T.M. Winegard, G. Capillo, M. Kuciel, K. Funakoshi, E.R. Lauriano, Confocal imaging and phylogenetic considerations of the subcutaneous neurons in the Atlantic hagfish Myxine glutinosa, Acta Zool. 96 (2015), https://doi.org/10.1111/azo.12068. [54] E.R. Lauriano, S. Pergolizzi, J. Gangemi, M. Kuciel, G. Capillo, M. Aragona, C. Faggio, Immunohistochemical colocalization of G protein alpha subunits and 5HT in the rectal gland of the cartilaginous fish Scyliorhinus canicula, Microsc. Res. Tech. 80 (2017), https://doi.org/10.1002/jemt.22896. [55] Y. Iger, M. Abraham, The process of skin healing in experimentally wounded carp, J. Fish. Biol. 36 (1990) 421–437, https://doi.org/10.1111/j.1095-8649.1990. tb05622.x. [56] Z. Roosta, A. Hajimoradloo, R. Ghorbani, S.H. Hoseinifar, The effects of dietary vitamin C on mucosal immune responses and growth performance in Caspian roach (Rutilus rutilus caspicus) fry, Fish Physiol. Biochem. 40 (2014) 1601–1607, https:// doi.org/10.1007/s10695-014-9951-6. [57] H.T.D. Bui, S. Khosravi, V. Fournier, M. Herault, K.J. Lee, Growth performance, feed utilization, innate immunity, digestibility and disease resistance of juvenile red seabream (Pagrus major) fed diets supplemented with protein hydrolysates, Aquaculture 418–419 (2014) 11–16, https://doi.org/10.1016/j.aquaculture.2013. 09.046. [58] B.O. Gabrielsen, E. Austreng, Growth, product quality and immune status of Atlantic salmon, Salmo salar L., fed wet feed with alginate, Aquacult. Res. 29 (1998) 397–401, https://doi.org/10.1046/j.1365-2109.1998.00215.x. [59] M. Araújo, P. Rema, I. Sousa-Pinto, L.M. Cunha, M.J. Peixoto, M.A. Pires, F. Seixas, V. Brotas, C. Beltrán, L.M.P. Valente, Dietary inclusion of IMTA-cultivated Gracilaria vermiculophylla in rainbow trout (Oncorhynchus mykiss) diets: effects on growth, intestinal morphology, tissue pigmentation, and immunological response, J. Appl. Phycol. 28 (2016) 679–689, https://doi.org/10.1007/s10811-0150591-8.
[38] H. Holbech, L. Andersen, G.I. Petersen, B. Korsgaard, K.L. Pedersen, P. Bjerregaard, Development of an ELISA for vitellogenin in whole body homogenate of zebrafish (Danio rerio), Comp. Biochem. Physiol. C Toxicol. Pharmacol. (2001), https://doi. org/10.1016/S1532-0456(01)00229-0. [39] R. Safari, S.H. Hoseinifar, S. Nejadmoghadam, A. Jafar, Transciptomic study of mucosal immune, antioxidant and growth related genes and non-specific immune response of common carp (Cyprinus carpio) fed dietary Ferula (Ferula assafoetida), Fish Shellfish Immunol. (2016), https://doi.org/10.1016/j.fsi.2016.05.038. [40] S.H. Hoseinifar, F. Zoheiri, C.M. Caipang, Dietary sodium propionate improved performance, mucosal and humoral immune responses in Caspian white fish (Rutilus frisii kutum) fry, Fish Shellfish Immunol. (2016), https://doi.org/10.1016/ j.fsi.2016.06.027. [41] S.H. Hoseinifar, A. Ahmadi, M. Raeisi, S.M. Hoseini, M. Khalili, N. Behnampour, Comparative study on immunomodulatory and growth enhancing effects of three prebiotics (galactooligosaccharide, fructooligosaccharide and inulin) in common carp (Cyprinus carpio), Aquacult. Res. (2017), https://doi.org/10.1111/are.13156. [42] O.H. LOWRY, N.J. ROSEBROUGH, A.L. FARR, R.J. RANDALL, Protein measurement with the Folin phenol reagent, J. Biol. Chem. (1951), https://doi.org/10.1016/ 0304-3894(92)87011-4. [43] D.L. Merrifield, G. Bradley, G.M. Harper, R.T.M. Baker, C.B. Munn, S.J. Davies, Assessment of the effects of vegetative and lyophilized Pediococcus acidilactici on growth, feed utilization, intestinal colonization and health parameters of rainbow trout (Oncorhynchus mykiss Walbaum), Aquacult. Nutr. 17 (2011) 73–79, https:// doi.org/10.1111/j.1365-2095.2009.00712.x. [44] C.M.A. Caipang, C.C. Lazado, Nutritional impacts on fish mucosa: immunostimulants, pre- and probiotics, Mucosal Heal. Aquac, 2015, pp. 211–272, , https://doi.org/10.1016/B978-0-12-417186-2.00009-1. [45] A. Oliva-Teles, Nutrition and health of aquaculture fish, J. Fish. Dis. 35 (2012) 83–108, https://doi.org/10.1111/j.1365-2761.2011.01333.x. [46] C. Pohlenz, D.M. Gatlin, Interrelationships between fish nutrition and health, Aquaculture 431 (2014) 111–117, https://doi.org/10.1016/j.aquaculture.2014.02. 008. [47] J. Bernal, J.A. Mendiola, E. Ibáñez, A. Cifuentes, Advanced analysis of nutraceuticals, J. Pharmaceut. Biomed. Anal. (2011), https://doi.org/10.1016/j.jpba. 2010.11.033. [48] L. Onofrejová, J. Vašíčková, B. Klejdus, P. Stratil, L. Mišurcová, S. Kráčmar, J. Kopecký, J. Vacek, Bioactive phenols in algae: the application of pressurizedliquid and solid-phase extraction techniques, J. Pharmaceut. Biomed. Anal. (2010), https://doi.org/10.1016/j.jpba.2009.03.027. [49] J. Zou, C. Secombes, The function of fish cytokines, Biology 5 (2016) 23, https:// doi.org/10.3390/biology5020023.
237