Multifactorial control of reproductive and growth axis in male goldfish: Influences of GnRH, GnIH and thyroid hormone

Molecular and Cellular Endocrinology 500 (2020) 110629

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Multifactorial control of reproductive and growth axis in male goldfish: Influences of GnRH, GnIH and thyroid hormone

T

Y. Maa, C. Ladisaa, J.P. Changa,b, H.R. Habibia,∗ a b

Department of Biological Sciences University of Calgary, 2500 University Drive NW, Calgary, Alberta, Canada, T2N 1N4 Department of Biological Sciences University of Alberta, Edmonton, Alberta, Canada, T6G 2E9

A R T I C LE I N FO

A B S T R A C T

Keywords: Gonadotropin-inhibitory hormone (GnIH) Gonadotropin-releasing hormone (GnRH) Growth and reproduction Thyroid hormone Goldfish Seasonality

Reproduction and growth are under multifactorial control of neurohormones and peripheral hormones. This study investigated seasonally related effects of GnIH, GnRH, and T3 on the reproductive and growth axis in male goldfish at three stages of gonadal recrudescence. The effects of injection treatments with GnRH, GnIH and/or T3 were examined by measuring serum LH and GH levels, as well as peripheral transcript levels, using a factorial design. As expected, GnRH elevated serum LH and GH levels in a seasonally dependant manner, with maximal elevations of LH in late stages of gonadal recrudescence (Spring) and maximal increases in GH in the regressed gonadal stage (Summer). GnIH injection increased serum LH and GH levels only in fish at the regressed stage but exerted both stimulatory and inhibitory effects on GnRH-induced LH responses depending on season. T3 treatment mainly had stimulatory effects on circulating LH levels and inhibitory effects on serum GH concentrations. In the liver and testes, we observed seasonal differences in thyroid receptors, estrogen receptors, vitellogenin, follicle-stimulating hormone receptor, aromatase and IGF-I transcript levels that were tissue- and sex-specific. Generally, there were no clear correlation between circulating LH and GH levels and peripheral transcript levels, presumably due to time-related response and possible direct interaction of GnRH and GnIH at the level of liver and testis. The results support the hypothesis that GnRH and GnIH are important components of multifactorial mechanisms that work in concert with T3 to regulate reciprocal control of reproduction and growth in goldfish.

1. Introduction Control of reproduction and growth are multifactorial and involve hormones of the brain-pituitary-peripheral target axis (Blazquez et al., 1998; Klausen et al., 2003; Chang et al., 2000; Trudeau, 1997). In fish and in a number of other vertebrates, reproduction and growth follows a clear seasonal cycle involving changes in gonadal development, circulating hormones and metabolism. A key regulator of reproduction is gonadotropin-releasing hormone (GnRH), which stimulates production and secretion of the gonadotropins (follicle-stimulating hormone, FSH and luteinizing hormone, LH). LH and FSH, in turn, stimulate gametogenesis and hormone production in the ovary and testis. These components form the hypothalamo-pituitary-gonad (HPG) axis important for the control of reproduction (for review see: Zohar et al., 2010; Trudeau, 1997). Growth is regulated by growth hormone (GH); its synthesis and secretion are also controlled by various neurohomones (for review see: Klausen et al., 2003; Chang et al., 2012; Canosa et al., 2007). During the reproductive season in oviparous species, significant

∗

growth of gonads occurs which requires investment of metabolic energy to sustain development of eggs and sperm. Therefore, maximal growth and reproduction do not occur simultaneously in seasonally breeding animals and co-ordinated endocrine changes would be needed to achieve these seasonal reproductive changes (Sohn et al., 1999; Pasmanik and Callard, 1988). GnRH homologs in vertebrate species are categorized into three main types, GnRH1, GnRH2, and GnRH3, where one species can express multiple forms (for review see: Klausen et al., 2003; Chang and Pemberton, 2018; Zohar et al., 2010; Okubo and Nagahama, 2008). GnRH1 is the main pituitary regulator for mammals and includes the isoform found in humans (Okubo and Nagahama, 2008). GnRH2 is found in all vertebrate classes and is thought to be involved in changing behaviour, feeding activities, and energy balance due to expression found in a variety of regions in the mid brain (Yu et al., 1987; Schneider and Rissman, 2008; Xia et al., 2014). GnRH3 is found in teleost species and in the absence of GnRH1 expression, GnRH3 compensates and regulates pituitary action (Okubo and Nagahama, 2008). In goldfish

Corresponding author. partment of Biological Sciences, University of Calgary, 2500 University Drive NW, Calgary, Alberta, T2N. 1N4, Canada. E-mail address: [email protected] (H.R. Habibi).

https://doi.org/10.1016/j.mce.2019.110629 Received 21 June 2019; Received in revised form 17 October 2019; Accepted 18 October 2019 Available online 31 October 2019 0303-7207/ © 2019 Elsevier B.V. All rights reserved.

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

these responses were accompanied by elevations in GH mRNA expression in cells prepared from goldfish at late recrudescence but reduced GH mRNA expression in cells prepared from fish at mid recrudescence and regressed states (Moussavi et al., 2014). In contrast, GnIH reduced basal GH release from goldfish pituitary cells prepared from fish at mid recrudescence when applied in rapid cell column perfusion studies (Moussavi et al., 2014). Thus, GnIH influences on fish GH release and synthesis are species-specific, seasonally dependent, may consist of a combination of direct pituitary and non-pituitary effects, as well as exhibit treatment protocol and time-course differences. Adding to the possible complexity of the results on GnRH and GnIH effects, many of these studies have used mixed sex groups. The full picture of somatotrope regulation (and to certain extends, that of gonadotropes) by these factors within males and seasonally reproducing animals remains unclear. Thyroid hormones (T3 and T4) are also known to affect reproduction and growth in different species, including fish (for review Cyr and Eales, 1996; Cyr and Eales, 1988; Nelson et al., 2010; Habibi et al., 2012; Tovo-Neto et al., 2018). In goldfish, blood thyroid hormone levels are highest during regressed gonadal stage and decrease to minimum levels during spawning (Sohn et al., 1999). Treatment with T3 was shown to decrease gonadal expression of estrogen receptors and aromatase in male goldfish (Nelson et al., 2010). Furthermore, T3 injection was shown to significantly reduce sex hormone production in male goldfish at early and mid-stages of recrudescence (Allan and Habibi, 2012). In zebrafish, T3 was shown to stimulate the proliferation of Sertoli cells and spermatogonia type-A in testis (Morais et al., 2013). While T3 reduced pituitary LH and gonadal estrogen receptor expression, it enhanced vitellogenesis by increasing liver estrogen receptors, which primes the liver for reproduction at early stages of gonadal recrudescence (Nelson and Habibi, 2016). Thyroid hormones are also known to work synergistically with GH to increase overall growth (Louis et al., 2010; Lostroh and Li, 1958; for review see: Gouveia et al., 2018; Cabello and Wrutniak, 1989), and are crucial for metamorphosis of in amphibians and certain fish species (Power et al., 2001; Einarsdóttir et al., 2006; Manzon and Manzon, 2017). In addition, treatment with T3 increased GH mRNA expression in the rainbow trout (Moav and McKeown, 1992), although no such effects were seen in goldfish (Allan and Habibi, 2012). In contrast, thyroid hormones inhibited GH release and synthesis by direct actions at the pituitary level in eel (Rousseau et al., 2002). Thus, despite possible species differences, thyroid hormones are also factors in the control of reproduction and growth. In the present study, we have used male goldfish as a model organism that undergoes seasonal reproductive cycling to test the hypothesis that GnRH, GnIH and thyroid hormones are important components of the multifactorial mechanisms underlying reciprocal control of reproduction and growth. The effects of GnRH and GnIH, applied alone or in combination in vivo, on several indices including, serum LH and GH levels; mRNA expression of FSH receptors (FSHR), estrogen receptors (ERα, ERβ1), and aromatase (Cyp19a) in testes; and mRNA expression of thyroid hormone receptors (TRα1, TRβ), vitellogenin (Vtg), insulin-like growth factor-I (IGF-I), ERα, and ERβ1 in liver were monitored at three distinct stages of gonadal recrudescence. In addition to examining the changes in liver thyroid receptors, the effects of T3 injection on GnRH and/or GnIH treatment-induced serum LH and GH responses were also investigated as an attempt to more directly examine thyroid hormone influences.

specifically, chicken GnRHII (cGnRHII, GnRH2) and salmon GnRH (sGnRH, GnRH3) are the two native isoforms expressed in the brain and both GnRH forms reach the pituitary (Peter et al., 1985; Kim et al., 1995). The multifactorial control of reproduction also involves other neurohormones such as the RF-amide gonadotropin-inhibitory hormone (GnIH), which was first discovered in Japanese quail and was reported to inhibit gonadotropin synthesis and release from the pituitary (Tsutsui et al., 2000). Many species have genes for multiple forms of GnIH (for review see: Ullah et al., 2016). Specifically in goldfish, there are three GnIH genes but only GnIH-3 (GnIH: SGTGLSATLPQRF-NH2) expression has been detected in the hypothalamus (Sawada et al., 2002). Although most mammalian and bird studies of GnIH have yielded inhibitory effects on gonadotrope function, studies in other vertebrates like fish have found both stimulatory and inhibitory effects of GnIH (for review see: Muñoz-Cueto et al., 2017; Tsutsui and Ubuka, 2018; Ubuka and Parhar, 2018). In goldfish, GnIH was shown to inhibit both synthesis and release of gonadotropins in early stages of gonadal recrudescence, but not in pre-spawning fish (Moussavi et al., 2012). In the cinnamon clownfish (Amphiprion melanopus) intraperitoneal (ip) injection of GnIH was shown to inhibit expression of gonadotropin α and β subunits (Choi et al., 2016). In cichlid fish, cichlid GnIH1 (cdGnIH1) inhibited the expression of both gonadotropins, but cdGnIH2 was stimulatory for FSHβ subunit expression (Di Yorio et al., 2016). In grass puffer (Takifugu niphobles), increased FSHβ and LHβ mRNA expression during spawning season coincide with increased GnIH and GnIH receptor (GnIHR) mRNA expression (Ando et al., 2018). In male A. altiparanae, zebrafish (z)GnIH-3 had no effects on basal gonadotropin expression but inhibited cGnRHII-induced gonadotropin subunits transcript expression, and increased cGnRHII transcript expression (Branco et al., 2019). Despite the fact that a number of investigators have demonstrated that GnIH exerts both stimulatory and inhibitory actions, depending season and species, both GnRH and GnIH are accepted as important components of multifactorial control of reproduction. There is also evidence that GnRH and GnIH may participate in the multifactorial control of somatotrope functions in some fish species. Studies in goldfish have shown that GnRH exerts stimulatory actions on GH synthesis and release (Marchant et al., 1989; Moussavi et al., 2014; Klausen et al., 2003). Binding sites for GnRH isoforms have been identified in somatotropes in goldfish (Cook et al., 1991), cichlid fish (Parhar et al., 2002), and pejerrey (Stefano et al., 1999). Direct actions of GnRH isoforms on GH release and synthesis have been demonstrated and particularly well characterized in goldfish (Habibi et al., 1992; Marchant et al., 1989; Klausen et al., 2001, 2005; Chang et al., 1996; Chang and Pemberton, 2018). GnRH has also been shown to stimulate GH production in other fish species, including tilapia (Melamed et al., 1995), common carp (Li et al., 2002), pejerrey (Montaner et al., 2001), and masu salmon (Bhandari et al., 2003). In contrast, other studies observed no increase in serum GH levels after GnRH treatment in the turbot (Rousseau et al., 2001), eel (Rousseau et al., 1999), or catfish (Lescroart et al., 1996); these results may indicate the presence of species and/or experimental condition differences. Likewise, although GnIH has been shown to be stimulatory to GH release in mammals (Johnson et al., 2007; Johnson and Fraley, 2008), the situation in fish is not as straight forward. Briefly, although GnIH receptors were reported to be absent in tilapia somatotropes (Biran et al., 2014), GnIH neurons have been shown to project to GH cells in the European sea bass (Paullada-Salmerón et al., 2016a) while brain injections of GnIH stimulated pituitary GH mRNA expression (PaulladaSalmerón et al., 2016b). GnIH also elevated GH mRNA expression in primary pituitary cell cultures prepared from grass puffer (Shahjahan et al., 2016), as well as GH release from pituitary cultures of cichlid C. dimerus (Di Yorio et al., 2016). In vitro GnIH applications generally stimulated GH accumulation in media in 24-hr static incubation experiments with primary cultures of goldfish pituitary cells; however,

2. Methods 2.1. Animals Adult goldfish (Carrassius auratus) were obtained for three seasonal time points (360 fish per season, 20 fish per treatment group) representing three different gonadal stages: regressed phase 2

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

administered as single injection containing mixture of hormones in 100 μL. Sham injection (only PBS) was used as control (PBS + PBS, 0 h first injection +12 h s injection). A double injection of GnRH was shown to induce greater response than single injection in stimulating LH release in goldfish (Omeljaniuk et al., 1989). sGnRH (Pyr-HWSYGWLPG-NH2) was bought from Bachem (Torrance, California, USA), goldfish GnIH (SGTGLSATLPQRF-NH2; GnIH) was made by the University of Calgary Peptide Services (Calgary, AB, Canada), and 3,5,3’ tri-iodothyronine (T3) was bought from Sigma Aldrich (Sigma Aldrich St Louis, Missouri, USA). Doses of hormones per fish were calculated from average weight of fish in each season using the following doses per gram of wet fish weight: 100 ng sGnRH/g of fish, 50 ng GnIH/g of fish, 1 ng T3/g of fish (Allan and Habibi, 2012; Moussavi et al., 2014, 2013; Nelson et al., 2010). After 24 h of hormone treatments, fish were bled to collect blood and then dissected to collect testes and liver samples; these were all separated by sex and stored in −80 °C for further tests. Only tissue and blood samples obtained from male fish were used in this study. Prior to storage at −80 °C, blood samples were allowed to clot and centrifuged for serum isolation. Serum was then used for radioimmunoassays (RIAs) to detect GH and LH levels using well-established protocols (Peter et al., 1984; Marchant et al., 1989).

Table 1 Water conditions for the three seasonal stages. Temperature and daylight cycles (lights were turned on at 9 a.m. daily and turned off after appropriate daylight length for the three seasons) appropriate for preservation of gonadal stage of fish and similar to those found in their natural environment in Pennsylvania (USA). Month

Gonadal Phase

Water Temperature (°C)

Daylight (hours)

December–January March–April June–August

mid recrudescence late recrudescence regressed

14 16 19

12 14 14

(July–August), mid recrudescence (December–January), and late recrudescence (March–April). All fish were at least one year old and sexually mature (post-pubertal). Fish were imported from a fish farm located in Pennsylvania (USA) and exposed to natural daylight cycles and temperature throughout the year; these were supplied by a local vendor (Aquatic Imports, Calgary, AB, Canada). Average body weight of fish for regressed phase and mid recrudescence was 60 g, and late recrudescence fish had average weight of 22 g. Variability in size of fish were due to availability of goldfish from the supplier at the time of experiments due to large numbers needed. Fish were kept in a flowthrough system in tanks of 5 or 6 in daylight and temperature conditions similar to their natural environment (Table 1), and fed once a day at 2 h after lights on (lights on at 9 a.m.), to satiation with commercial goldfish flake food (Nutrafin, Baie d’Urfé, QC, Canada). Fish were acclimated to these laboratory conditions for 4–7 days before experiments began. Fish were anesthetized with a buffered MS-222 solution (tricane methanesulfonate,160 mg/L, Sigma Aldrich St Louis, Missouri, USA) before injections were administered. The same concentration of MS-222 was used for the collection of blood samples and to euthanize fish at the end of the experiments, which was followed by spinal transection as secondary measures prior to the harvesting of gonads and liver. Samples of blood, testes, and liver were obtained from male goldfish for the present study. No mortality was observed during experiments. All animal protocols were approved by the university's animal care committee and in accordance with the Canadian Council on Animal Care's guidelines.

2.3. RNA extraction and PCR Total RNA was extracted from liver and testicular tissue samples using Trizol extraction as per manufacturer's instructions (Invitrogen, Burlington, ON, Canada) and purity and quantity were assessed with a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA). Any remaining DNA was digested using a DNase I kit (Thermo Scientific, Waltham, MA, USA), then cDNA synthesis took place using the High Capacity Multiscribe cDNA kit (Invitrogen, Burlington, ON, Canada). The cDNA samples from tissues were used in real-time quantitative (Q)PCR to investigate mRNA expression changes. Primers (Table 3) for all tissues have been well-established and characterized in our group (Moussavi et al., 2014, 2013; Allan and Habibi, 2012; Nelson et al., 2010; Sinha et al., 2012). Based on the most stability observed between treatment groups in testes or liver, the house-keeping genes GAPDH and β-actin were used as the internal control for genes tested for testes and liver, respectively (Table 3). For

2.2. Injection treatments

Table 3 Sequences of primers used in transcript analysis of liver and testicular tissues during QPCR and appropriate annealing temperatures. All primers were designed and validated using Primer3 online software (Whitehead Institute of Biomedical Research, Cambridge, MA, USA).

All hormones were administered ip in phosphate-buffered saline (PBS). Hormone doses were adjusted accordingly to the dosages per gram of average weight of fish in each season (Table 2). Injections (100 μL) were administered at 0 and 12 h (9 a.m. and 9 p.m.) following a factorial design; sGnRH, GnIH, with and without T3 (Table 2); euthanization and tissue collection took place at 24 h after the first injection (9 a.m. the following day). Combined hormone treatments were Table 2 Injection combinations of sGnRH (100 ng/g fish wet weight) and GnIH (50 ng/g fish), dissolved in PBS solution; double injection of PBS served as control. Treatments were either co-injected with or without T3 (1 ng/g fish). Intraperitoneal injections were made at 0 h (9 a.m.) and 12 h (9 p.m.) followed by sampling at 24 h. T3-treated fish received T3 at both 0 and 12 h. Group

0h

12 h

1 2 3 4 5 6 7 8 9

PBS GnIH GnIH GnIH PBS PBS GnRH GnIH + GnRH GnIH + GnRH

GnRH GnIH GnRH GnIH + GnRH PBS GnIH GnRH GnRH GnIH + GnRH

Gene

Primer

Sequence (5’ – 3′)

Annealing Temperature (°C)

β-actin (Liver)

forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse

CCTCCATTGTTGGCAGACC CCTCTCTTGCTTTGAGCCTC TGATGCTGGTGCCCTGTATGTAGT TGTCCTGGTTGACTCCCATCACAA GAAGTGCGCATGGTGGCTTGTATT AGCTGCCATATCAGGAGCAGTGAT CAGGGGCATTGGTGTGA GCAGCGTGTCTACAAGC GAGGAAGAGTAGCAGCACTG GGCTGTGTTTCTGTCGTGAG GGCAGGATGAGAACAAGTGG GTAAATCTCGGGTGGCTCTG AGCCTGCCATGCCAGCC CCTCCTGATCCTCGAAGACC GAGGAGCAGCAGAAGACGG GTTGCCTTGGGCGTTTGTGG CGTCCACAATCCTACCTTCG TGAGAAACGGTGATTAGCGG TTGTGCGGGTTTGGATCAATGGTG TTCCGATACACTGCAGACCCAGTT

57

GAPDH (Testes) Vtg IGF-I ERα ERβI TRαI TRβ FSHR Cyp19a1 (aromatase)

3

57 55 57.1 55 55 55 55 56 58

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

et al., 1991), is the GnRH used in all experiments in this study. The effects of GnRH were investigated following single or double injections, 12-hrs apart. A previous study from Omeljaniuk et al. (1989) showed enhanced GnRH effectiveness using double injections of GnRH, applied 12-hrs apart, in stimulating LH release in goldfish. To facilitate comparisons of treatment effects on serum LH and GH levels across seasons, hormone responses were normalized to values in controls at late recrudescence. As expected, double injection with GnRH (GnRH + GnRH; first injection + second injection) resulted in significant elevations of serum LH levels in fish at late stages of recrudescence but had no effects in fish at regressed or mid stages of recrudescence (Fig. 2a). However, significant increases in GH levels were observed following double GnRH injection at regressed stage of gonadal recrudescence and no significant effects were observed in fish at mid and late stages of gonadal recrudescence (Fig. 2c). The ability of GnRH to alter serum LH levels at late recrudescence and GH at regressed state were also consistent with the results of the two-way ANOVA analysis which revealed significant overall GnRH influences at these reproductive stages (Fig. 2). Theses results suggest the seasonal patterns of sensitivity of LH and GH secretion responses to GnRH are different.

QPCR, SsoFast Eva Green Supermix was used (BioRad, Mississauga, Ontario, Canada). The QPCR thermal cycling steps are as follows: initial denaturing step of 2 min at 95 °C, 36 cycle repeats of 15 s at 95 °C, 15 s at 55–60 °C appropriate annealing temperature (Table 3), 72 °C extension for 1 min. A melt curve was recorded for each plate at the end of amplification to ensure only one peak was present to signify only one product was amplified. All PCR samples were run as triplicates. 2.4. Statistical analysis Randomly selected serum samples were analyzed by RIA to reach maximum of n = 12. Only a maximum of n = 9 samples were run for QPCR. Basal circulating hormone levels are reported as serum concentrations (ng/ml; mean ± SEM) and then analyzed by one-way ANOVA followed by Tukey's post-hoc honest significant difference (HSD) multiple comparison test. Hormone responses to treatment groups were normalized to the average concentration in the control (PBS + PBS) group having the highest averaged values in the three experimental seasons (reported as a percentage of the averaged concentration of the highest control group). In particular to examine the influence of T3 on GnRH and/or GnIH treatments, these serum LH and GH data were analyzed by two-way ANOVA followed by Bonferroni's multiple comparison. Housekeeping genes for liver and testes were chosen based on stability of mRNA levels within specific tissues. GAPDH and β-actin have been tested in goldfish to ensure suitability and effectiveness based on the following criteria: i) the Ct values of the gene should be within 15–25, and ii) all samples should amplify within 2 Ct values of each other. For the liver we used β-actin and for the gonads we used GAPDH based on these criteria. Basal mRNA levels of transcripts in tissues from males were normalized to housekeeping genes using the ΔΔCq method. QPCR data of hormonal treatments were normalized to respective housekeeping genes using the ΔΔCq method, then expressed as a percentage of the averaged values of the control group with highest basal mRNA levels among the three experimental seasons examined. All QPCR data was analyzed via Kruskal-Wallis followed by Dunn's multiple comparison test using Prism software (GraphPad Software Inc., La Jolla, CA, USA). Differences were considered significant when p < 0.05. We used Kruskal-Wallis test for QPCR data because a number of data sets did not follow normal distribution.

3.3. Effects of GnIH on basal and GnRH-induced LH and GH response The effects of GnIH were investigated, alone and in combinations with GnRH in fish at different stages of gonadal recrudescence. A single injection of GnIH alone (PBS + GnIH) elevated serum LH levels in fish at regressed phase although two-way ANOVA revealed no general effects of GnIH alone treatments on serum LH in any season tested (Fig. 2b). Treatment with GnIH inhibited the LH responses to double GnRH injection in fish at late stages of gonadal recrudescence (Fig. 2a and e); this observation is consistent with the lack of overall effect of combination GnIH and GnRH treatments on LH at late recrudescence by two-way ANOVA. No significant changes were observed in GH levels following either single or double injections of GnIH alone at any reproductive stage although GH values were almost twice that of controls with double GnIH administration in fish at regressed state (Fig. 2d). Interestingly, this last observation correlated with the presence of an overall effect of GnIH alone at regressed state as indicated by ANOVA analysis. GnIH treatment, applied either as a single or double injection, reduced the GH responses to double GnRH applications in the regressed fish to values not different from controls (Fig. 2c and f). A significant GnRH and GnIH combination treatment effect on serum GH was also observed at this reproductive stage. No effects on GH levels were observed in mid and late gonadal stage fish when GnIH and GnRH were administered together (Fig. 2f) except for the GnIH + GnIH&GnRH group that increased serum GH concentrations in late recrudescent fish (Fig. 2f).

3. Results 3.1. Circulating basal levels of GH and LH Testicular appearance of fish was visually assessed to determine their gonadal recrudescence stage (Fig. 1a). After the spawning season and the stop of spermiation, male goldfish process narrow testis not actively undergoing spermatogenesis (July–August; regressed gonadal state). Early recrudescence is when testis begin the process of spermatogenesis (September–October). Mid recrudescence is characterized by fish containing actively developing testis undergoing spermatogenesis (December–January). Late recrudescence is characterized by fully mature testis with increased amount of sperm (March–April). In the present study we compared fish at three stages of reproductive cycle, regressed, mid and late recrudescence. Basal circulating level of LH in male goldfish did not fluctuate significantly in the three seasonal reproductive stages, but there was a trend for higher levels in mid and late stages of gonadal recrudescence compared to the regressed phase (Fig. 1b). However, GH level changed significantly throughout the seasonal cycle, with higher levels in the regressed phase compared to the mid and late stages of recrudescence (Fig. 1c).

3.4. T3 effects on basal serum LH and GH, and GnRH- and GnIH-induced LH and GH responses Two-way ANOVA revealed the presence of significant T3 effects on serum LH, as well as significant interactions with GnIH and combination treatments with GnRH and GnIH at regressed stage (Fig. 2). Treatment with T3 significantly elevated basal LH levels in regressed fish (Fig. 2a) but had no effects on GnRH-stimulated LH responses in late recrudescence (Fig. 2a). Treatment with T3 did not influence GnIHinduced LH responses in regressed fish and the effects of treatments with GnIH alone and T3 alone were not additive (Fig. 2b). Although an interaction between T3 and GnIH alone treatments was indicated by two-way ANOVA at mid recrudescence, no significant differences between any of the groups were observed with post-hoc tests (Fig. 2b). However, the presence of T3 elevated LH levels in combined treatment with GnRH and GnIH in regressed (GnIH + GnIH&GnRH) and mid recrudescence (GnIH&GnRH + GnRH) relative to controls (Fig. 2e).

3.2. Control of LH and GH secretion by GnRH The preoptic hypothalamic GnRH form in goldfish, sGnRH (Yu 4

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

Fig. 1. Representative photos of testes during the three seasonal gonadal stages of recrudescence (a). Basal circulating levels of LH (b) and GH (c) detected using RIA in male goldfish at three gonadal reproductive states (regressed, mid recrudescence, and late recrudescence). Control groups (PBS + PBS injected; mean ± SEM, n = 4–12) were used to determine basal circulating hormone levels. Groups identified by different letters of the alphabet are significantly different from one another (P < 0.05; ANOVA followed by Tukey's multiple comparisons test). Where significant differences between groups are absent by ANOVA, identifiers are not included in the graphic presentation of the results.

higher levels at regressed and mid recrudescence, compared to late recrudescence (Fig. 3e). In the testis, the seasonal pattern of ERβ1 transcript levels was found to be different from that of the male liver (Fig. 3h). Higher ERβ1 mRNA levels were observed in the mid and late recrudescence testis compared to the regressed state (Fig. 3h). GnRH treatment reduced ERβI mRNA levels in the liver from males in regressed and mid recrudescent stages but had a stimulatory effect in late recrudescence (Fig. 4b). No correlation was observed between ERβI mRNA levels and GnRH-induced serum LH responses. Treatment with GnIH reduced liver ERβI mRNA levels in mid recrudescent fish and increased them in late recrudescence fish (Fig. 4b). Combined treatments with GnIH&GnRH + GnIH&GnRH in regressed, GnIH + GnIH& GnRH in mid, and GnIH&GnRH + GnRH in late recrudescence increased liver ERβI mRNA levels (Fig. 4b). In testis, treatments with single GnRH injection elevated ERβI mRNA levels in the regressed stage, whereas these levels were reduced by double GnRH injection in mid recrudescence (Fig. 5b). Double GnIH injection treatments increased testicular ERβI mRNA levels in regressed and late recrudescence stages (Fig. 5b). Stimulation of testicular ERβI mRNA levels was also observed following treatments with GnIH&GnRH + GnIH&GnRH in mid and GnIH + GnRH in late recrudescence; however, inhibitory effects on testicular ERβI mRNA levels resulted from GnIH + GnRH treatment in mid recrudescence (Fig. 5b).

Two-way ANOVA revealed the presence of T3 effects on GH release at all three stages of testicular recrudescence, as well as significant interactions with GnRH at regressed and late recrudescence, GnIH at mid recrudescence, and combination GnRH and GnIH treatments at all three reproductive stages (Fig. 2). Treatment with T3 generally had no significant effects on basal serum GH levels (Fig. 2c) but had an overall suppressive influence on GnRH-elicited, as well as GnIH-induced, GH secretion in all reproductive seasons (Fig. 2c and d), apart from stimulating GnIH-induced GH responses in mid recrudescence (PBS + GnIH, Fig. 2d; and GnIH + GnIH&GnRH, Fig. 2f). 3.5. Transcripts in liver and/or testis Transcript levels for several genes involved in reproduction and growth were measured using QPCR. The results demonstrate seasonal pattern for all transcripts in the liver and testis (Fig. 3). 3.5.1. ERα In the liver, ERα mRNA levels were significantly higher in the regressed and mid recrudescence stages as compared to late recrudescence (Fig. 3d). In the testis, ERα seasonal pattern was found to be different from that in the liver. Significantly higher levels of ERα were found in testis at late recrudescence, compared to regressed stage. Liver ERα mRNA levels were increased in GnRH-treated fish in all seasonal stages whereas treatment of GnIH elevated ERα transcript levels only in late recrudescence (Fig. 4a). Effects of GnRH treatment on ERα partially correlated with the observed GnRH-induced LH responses seen in late recrudescence. In regressed and mid recrudescence stages, GnIH inhibited GnRH-induced ERα mRNA level in male goldfish liver (Fig. 4a). Single GnRH injection treatment resulted in higher levels of ERα mRNA in testis of fish at mid recrudescence, but not at other reproductive stages (Fig. 4a). However, single GnIH injection treatment reduced testicular ERα mRNA levels in mid recrudescence while double GnIH treatment increased them in regressed and late stages of gonadal recrudescence (Fig. 5a). Interestingly, GnIH + GnRH combination treatment significantly elevated testicular ERα mRNA levels at all three gonadal stages (Fig. 5a). Likewise, GnIH + GnIH&GnRH increased testicular ERα mRNA levels at regressed state (Fig. 5a). On the other hand, treatments with GnIH&GnRH + GnIH&GnRH resulted in significant reduction of testicular ERα mRNA levels in late recrudescence (Fig. 5a).

3.5.3. Vtg Although the Vtg gene is at very low expression in males, it can be stimulated by estrogen (Nelson and Habibi, 2016; Marlatt et al., 2010). Thus, we tested the effects of treatment with GnRH and GnIH in the male liver. In male liver, basal Vtg mRNA expression levels were higher in mid and late stages of recrudescence compared to regressed state fish (Fig. 3f). We found seasonally related changes in responsiveness to GnRH and GnIH in the male liver (Fig. 6). Partial correlation was found between Vtg mRNA levels in liver and GnRH-stimulated serum LH responses in the late recrudescence stage (Figs. 2a–6). Single GnRH injection treatment in fish at regressed gonadal stage and double GnRH injection treatment at late recrudescence increased Vtg mRNA levels (Fig. 6). Treatments with single and double GnIH injection were found to stimulate Vtg mRNA levels in the regressed and late recrudescent fish, whereas double GnIH injection increased Vtg mRNA levels in mid recrudescence (Fig. 6). Concomitant treatments with GnRH and GnIH were without effects on the liver Vtg mRNA levels in the regressed gonadal stage (Fig. 6). Treatment with GnIH + GnIH&GnRH reduced liver Vtg mRNA levels in mid recrudescence, whereas stimulation of Vtg mRNA levels was observed following GnIH&GnRH + GnIH&GnRH

3.5.2. ERβ1 A clear seasonal pattern was also observed for ERβI in the liver, with 5

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

(caption on next page)

6

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

Fig. 2. GnRH- and/or GnIH-induced changes in serum levels of LH and GH in male goldfish in the absence (open bar) and in the presence of T3 (grey bar) at three seasonal reproductive stages (mean ± SEM; regressed n = 5–12; mid recrudescence n = 3–12, groups PBS + GnIH with T3 and GnIH + GnIH&GnRH with T3 had low replicate number n = 3; late recrudescence n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Serum hormone values are presented as a percentage of the averaged concentrations of control group (PBS + PBS injected) in late recrudescence. Controls of each season were placed at the start of each set of treatments for visual comparison. Within each season, groups identified by different letters are significantly different from one another (two-way ANOVA followed by Bonferroni's multiple comparison test, p < 0.05). In seasons where significant differences between groups are absent, identifiers are not included. Groups were only statistically tested for significance within the sections shown (as indicated by the vertical dashed lines) and were not tested for statistical significance between seasons. P-values of two-way ANOVA are presented in tables above bars (factors tested in two-way ANOVA were GnIH and/or GnRH and co-treatments with T3) and asterisks in tables indicate where factors had significant effects, p < 0.05.

demonstrated a clear seasonal pattern in the male liver with significantly higher levels in the mid recrudescence stage (Fig. 3c). We observed no clear correlation between circulating GH concentrations and liver IGF-I mRNA levels (Figs. 2c & 3c). Double GnRH injections increased IGF-I transcript levels in mid and late stages of gonadal recrudescence (Fig. 7). Treatments with single and double GnIH injection

treatment at late recrudescence (Fig. 6). 3.5.4. IGF-I IGF-I is involved in both growth and reproduction, and in particular, IGF mediates many of the effects of GH on somatic growth (for review see: Reinecke, 2010; Rousseau and Dufour, 2007). The present results

Fig. 3. Basal levels of mRNA expression of various genes related to reproduction and growth in liver and testicular tissue of male goldfish in three seasonal reproductive stages (regressed, mid recrudescence, and late recrudescence). Expression was measured by QPCR and normalized to β-actin (liver) or GAPDH (testis). Values are means ± SEM (n = 4–9). Groups identified by different letters are significantly different from one another (Kruskal-Wallis test followed by Dunn's multiple comparisons test, p < 0.05). Where significant differences between groups are absent by Kruskal-Wallis test, identifiers are not included. 7

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

Fig. 4. Effects of GnRH and/or GnIH treatments on mRNA expression of estrogen receptors ERα and ERβ1 in the male goldfish liver at three seasonal reproductive stages (regressed, n = 4–9; mid recrudescence, n = 3–9; late recrudescence, n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Levels of mRNA expression were detected using QPCR and normalized to β-actin. Data presented (mean ± SEM) are expressed as a percentage of the averaged relative expression levels in controls (PBS + PBS) at mid recrudescence. Control groups were placed at the front of each set of treatment groups for visual comparison. Asterisks denote significant differences from controls (Kruskal-Wallis test followed by Dunn's multiple comparisons test; * = p < 0.05, ** = p < 0.01, *** = p < 0.001).

in regressed and late recrudescence fish increased IGF-I mRNA levels (Fig. 7). However, double GnIH injection treatments reduced IGF-I mRNA levels in the mid recrudescence stage (Fig. 7). During the regressed gonadal stage, GnIH + GnIH&GnRH and GnIH&GnRH + GnIH &GnRH treatments increased IGF-I mRNA level (Fig. 7). No significant effects were observed in combination treatments during mid

recrudescence (Fig. 7), although GnIH&GnRH + GnRH and GnIH& GnRH + GnIH&GnRH treatments increased IGF-I mRNA levels in the late gonadal recrudescence stage (Fig. 7). 3.5.5. TRαI and TRβ Thyroid hormones are also known to influence both reproduction 8

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

Fig. 5. Effects of GnRH and/or GnIH on mRNA expression of estrogen receptor genes ERα and ERβ1 in the male goldfish testes at three seasonal reproductive stages (regressed, n = 4–9; mid recrudescence, n = 3–9; late recrudescence, n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Levels of mRNA expression were detected using QPCR and normalized to GAPDH. ERα and ERβ1 data presented (mean ± SEM) are expressed as a percentage of the averaged relative expression levels in controls (PBS + PBS) at late and mid recrudescence, respectively. Control groups were placed at the front of each set of treatment groups for visual comparison. Asterisks denote significant differences from controls (Kruskal-Wallis test followed by Dunn's multiple comparisons test; * = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001).

&GnRH treatments reduced TRαI mRNA levels (Fig. 8a). In mid recrudescence stage, treatment with GnIH + GnIH&GnRH increased TRαI mRNA levels, but GnIH&GnRH + GnRH treatment reduced TRαI mRNA levels (Fig. 8a). The seasonal pattern for TRβ mRNA levels was found to be different from that of TRα1 in the liver of males, with significantly higher levels

and growth (for reviews see: Habibi et al., 2012; Mullur et al., 2014). In the male liver, TRαI expression was found to undergo seasonal changes, and with higher levels in mid recrudescence compared to regressed and late recrudescence stages (Fig. 3a). Treatments with GnRH or GnIH alone increased TRαI mRNA levels in regressed and late recrudescent fish (Fig. 8a). In regressed stage fish, GnIH + GnRH and GnIH + GnIH 9

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

Fig. 6. Effects of GnRH and/or GnIH on mRNA expression of Vtg in the male goldfish liver at three seasonal reproductive stages (regressed, n = 4–9; mid recrudescence, n = 3–9; late recrudescence, n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Levels of mRNA expression were detected using QPCR and normalized to β-actin. Data presented (mean ± SEM) are expressed as a percentage of the averaged relative expression levels in controls (PBS + PBS) at mid recrudescence. Control groups were placed at the front of each set of treatment groups for visual comparison. Asterisks denote significant differences from controls (Kruskal-Wallis test followed by Dunn's multiple comparisons test; * = p < 0.05, ** = p < 0.01, *** = p < 0.001).

Fig. 7. Effects of GnRH and/or GnIH on mRNA expression of IGF-I in the male goldfish liver at three seasonal reproductive stages (regressed, n = 4–9; mid recrudescence, n = 3–9; late recrudescence, n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Levels of mRNA expression were detected using QPCR and normalized to β-actin. Data presented (mean ± SEM) are expressed as a percentage of the averaged relative expression levels in controls (PBS + PBS) at mid recrudescence. Control groups were placed at the front of each set of treatment groups for visual comparison. Asterisks denote significant differences from controls (Kruskal-Wallis test followed by Dunn's multiple comparisons test; * = p < 0.05, ** = p < 0.01, *** = p < 0.001).

in the regressed and mid recrudescence stages, compared to late recrudescence (Fig. 3b). Treatment with GnRH reduced TRβ mRNA levels in the regressed gonadal stage, but increased TRβ mRNA levels in late recrudescence (Fig. 8b). Treatments with GnIH also increased TRβ mRNA levels in liver of males during late recrudescence (Fig. 8b). In the regressed stage, GnIH&GnRH + GnRH treatment decreased TRβ mRNA levels, while treatment with GnIH&GnRH + GnIH&GnRH increased 10

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

Fig. 8. Effects of GnRH and/or GnIH on mRNA expression of thyroid hormone receptors TRα1 and TRβ in the male goldfish liver at three seasonal reproductive stages (regressed, n = 4–9; mid recrudescence, n = 3–9; late recrudescence, n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Levels of mRNA expression were detected using QPCR and normalized to β-actin. Data presented (mean ± SEM) are expressed as a percentage of the averaged relative expression levels in controls (PBS + PBS) at mid recrudescence. Control groups were placed at the front of each set of treatment groups for visual comparison. Asterisks denote significant differences from controls (Kruskal-Wallis test followed by Dunn's multiple comparisons test; * = p < 0.05, ** = p < 0.01, *** = p < 0.001).

were found in late recrudescence compared to regressed and mid recrudescence stages (Fig. 3j). There was no clear correlation between aromatase mRNA levels and circulating basal LH concentrations, as well as following hormone treatments (Fig. 9). Treatments with single GnRH injection, double GnIH injection, and GnIH + GnRH increased aromatase mRNA level in mid recrudescent fish (Fig. 9). In late recrudescence, lower level of aromatase mRNA was observed following

TRβ mRNA levels (Fig. 8b). In mid stages of recrudescence, GnIH + GnRH treatment reduced TRβ mRNA levels (Fig. 8b). In late recrudescence, GnIH&GnRH + GnRH treatment increased TRβ mRNA levels (Fig. 8b).

3.5.6. Aromatase In the testis, significantly higher aromatase (Cyp19a) mRNA levels 11

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

Fig. 10. Effects of GnRH and/or GnIH on mRNA expression of follicle stimulating hormone receptor (FSHR) in the male goldfish testes at three seasonal reproductive stages (regressed, n = 4–9; mid recrudescence, n = 3–9; late recrudescence, n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Levels of mRNA expression were detected using QPCR and normalized to GAPDH. Data presented (mean ± SEM) are expressed as a percentage of the averaged relative expression levels in controls (PBS + PBS) at late recrudescence. Control groups were placed at the front of each set of treatment groups for visual comparison. Asterisks denote significant differences from controls (Kruskal-Wallis test followed by Dunn's multiple comparisons test; * = p < 0.05, ** = p < 0.01, *** = p < 0.001).

Fig. 9. Effects of GnRH and/or GnIH on mRNA expression of gonadal aromatase (cyp19a) in the male goldfish testes at three seasonal reproductive stages (regressed, n = 4–9; mid recrudescence, n = 3–9; late recrudescence, n = 4–9). Treatments are denoted as 0 h injection+12 h injection. Levels of mRNA expression were detected using QPCR and normalized to GAPDH. Data presented (mean ± SEM) are expressed as a percentage of the averaged relative expression levels in controls (PBS + PBS) at late recrudescence. Control groups were placed at the front of each set of treatment groups for visual comparison. Asterisks denote significant differences from controls (KruskalWallis test followed by Dunn's multiple comparisons test; * = p < 0.05, ** = p < 0.01).

12

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

differences in these interactions following in vivo treatments. GnIH in goldfish can have both an inhibitory and stimulatory action on reproductive processes according to the maturational status of the fish (Moussavi et al., 2012, 2013, 2014). The treatment of different combinations of GnRH and GnIH in goldfish has been shown to elicit different effects on LH and GH release during in vitro experiments utilizing cell perifusions (Moussavi et al., 2013, 2014). In addition to regulation of secretion, GnIH is also known to influence GH and LH gene expression. In amphibians, GnIH stimulates GH gene expression (Koda et al., 2002). Similar stimulation of GH gene expression by GnIH-related peptides was also observed in the grass puffer (Shahjahan et al., 2016). The effects of GnIH on both gonadotropin and GH mRNA expression in goldfish are direct and have seasonal variations as demonstrated by studies carried out in vitro (Moussavi et al., 2012, 2014). Briefly, GnIH elevated goldfish pituitary basal GH mRNA expression in early recrudescence but reduced its expression in mid and late recrudescence (Moussavi et al., 2014); however, LHβ mRNA levels were elevated in early and late recrudescence but reduced at mid recrudescence, while FSHβ mRNA levels were consistently suppressed (Moussavi et al., 2012). In cichlid fish, GnIH variants also had both inhibitory and stimulatory actions: while treatment with cd-LPQRF-1 inhibited LH release, cd-LPQRF-2 stimulated FSH release in cultured pituitary cells (Di Yorio et al., 2016). In male European sea bass, native sbGnIH2 reduced LH and GH mRNA levels, although plasma LH levels remained unchanged (Paullada-Salmeron et al., 2016a,b). In the cinnamon clownfish, GnIH reduced gonadotropin α and β subunits expression in vivo (Choi et al., 2016). GnIH-induced stimulation of LH, FSH, and testosterone levels have also been observed in male hamsters (Ancel et al., 2012; Ubuka et al., 2012). These results highlight variations in GnIHinduced responses, depending on species and reproductive cycle. Taken together, GnIH predominantly exerts an inhibitory action on the brainpituitary gonadal axis, while stimulating the somatotropic axis in male goldfish, depending on the season. Thus, in addition to GnRH, GnIH contributes to the complex multifactorial control of growth and reproduction in goldfish. Previous studies demonstrated that thyroid hormones influence reproduction in fish (for review Cyr and Eales, 1996; Cyr and Eales, 1988; Nelson et al., 2010; Habibi et al., 2012; Tovo-Neto et al., 2018). In goldfish, circulating T3 levels are high during summer in fish with regressed gonads and the maximum period of growth, and T3 levels are reduced significantly in late gonadal recrudescence at the time of spawning (Sohn et al., 1999). In the present study, we tested the effects of T3 on basal and GnRH- and/or GnIH- induced serum LH and GH changes (summarized in Supplementary Table S1, Table S2, and Table S3). A previous study using dispersed pituitary cells prepared from both male and female goldfish demonstrated that T3 administration, in vitro, reduced LHβ subunit mRNA levels at early recrudescence without having effect in other reproductive seasons on gonadotropin subunit and GH mRNA levels (Allan and Habibi, 2012). Other studies have also shown that T3 injection dose-dependently reduced LHβ mRNA levels measured at 36 h post-injection in male pituitaries of fish in mid recrudescence stage (Nelson et al., 2010). In the present study, T3 increased basal LH secretion in the regressed stage, while reducing basal GH secretion and the GH responses to either applications of GnRH or GnIH alone in the regressed stage. In other seasons, T3 treatment was without effect on LH secretion, but reduced GH secretion in mid recrudescence. Taken together, the diverging effects of T3 on serum LH and GH levels as compared to pituitary hormone mRNA levels may indicate a dissociation between gene expression and hormone secretion (and/or clearance). However, other possible explanations on the differences between the T3 effects on pituitary hormone gene expression and circulating hormone levels exist. In the present study we tested the response to T3 at 24 h. While the 24-hr time course may be suitable for studying responses to GnRH and GnIH, it may not be ideal for studying the effects of T3. In this context, while peptide hormones like GnRH and GnIH utilize G-protein coupled receptors that activate second

single dose GnIH, GnIH&GnRH + GnRH, and GnIH&GnRH + GnIH& GnRH treatments (Fig. 9). No changes in aromatase mRNA levels were observed in the testis of regressed phase fish following hormone treatments (Fig. 9). 3.5.7. FSHR FSHRs are important mediators of FSH-induced testicular development and steroidogenesis (for review see: Schulz et al., 2010). We observed a clear seasonal pattern for FSHR mRNA expression in the testis with significantly higher levels in late recrudescence (Fig. 3i). Testicular FSHR mRNA levels partially correlated with changes in LH responses to various treatments during the regressed phase (Fig. 10). Treatment with a single GnRH injection increased FSHR mRNA levels in regressed and mid gonadal recrudescence stages (Fig. 10). While a double GnIH injection treatment increased FSHR mRNA levels in the regressed and late stages of recrudescence, a single GnIH injection treatment reduced testicular FSHR mRNA levels in mid recrudescence (Fig. 10). Increased testicular levels of FSHR mRNA were observed following GnIH + GnIH&GnRH treatment in the regressed gonadal stage, and following GnIH + GnRH treatment in the mid recrudescence stage (Fig. 10). No effects were observed following combined treatments with GnRH and GnIH in the late stages of recrudescence (Fig. 10). 4. Discussion Results in this study demonstrate seasonal changes in basal GH concentration, with highest levels observed during the post spawning regressed phase; this corresponds with the period of minimal testicular size and spermatogenesis, and the period of maximum growth response. This is consistent with a previous study in goldfish by Marchant and Peter (1986) demonstrating that GH levels peak during late spring and remain relatively high in the summer in fish at regressed stage, decreasing to the lowest levels during mid recrudescence. High GH level was found to correspond with increased somatic and linear growth rates during the sexually regressed season (Marchant and Peter, 1986). Seasonal reproductive changes in basal circulating levels of LH were found to be minimal in the present study, possibly because sharp increases in serum LH occur mainly during spawning in male goldfish (Stacey et al., 1979). On the other hand, maximum LH response to GnRH stimulation occurred during late recrudescence while maximum response in GH secretion was observed in regressed gonadal season (summarized in Supplementary Table S1). Stimulation of LH subunit transcript expression by GnRH treatment in vivo has been investigated before and was shown to undergo seasonal changes in responsiveness, and with significant increases only at late stages of gonadal recrudescence (Moussavi et al., 2013). In the present study, GnRH stimulated GH release in regressed male goldfish during the growth season. These observations on GnRH effects on serum GH levels are also consistent with a number of previous studies demonstrating GnRH stimulation of GH expression and release in various fish species, including the goldfish (Melamed et al., 1995; Habibi et al., 1992; Li et al., 2002; Moussavi et al., 2014; Chang et al., 1996, 2012; Klausen et al., 2003, 2005; Marchant et al., 1989; Bhandari et al., 2003; Montaner et al., 2001). Thus, the present results support the hypothesis that GnRH stimulates both LH- and GH-cell functions and is a contributing factor in the seasonally related reciprocal control of growth and reproduction in male goldfish. The present study demonstrates GnIH stimulation of basal GH release in fish at regressed gonadal stage, and inhibition of GnRH-induced LH secretion during late recrudescence (summarized in Supplementary Table S2 and Table S3). This is consistent with previous studies in goldfish (Moussavi et al., 2013, 2014). Combining GnRH and GnIH following a factorial design of hormone treatments allowed us to investigate the interaction between these two hormones and the seasonal 13

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

found to be higher in the regressed and mid recrudescence, compared to late recrudescence. These corresponding seasonal changes in liver TR, ER and IGF-I transcripts are interesting and may be correlated with seasonal changes in growth and vitellogenesis. T3 has been shown to upregulate ERα to enhance the vitellogenic effects of estrogen in goldfish (Nelson and Habibi, 2016). The importance and positive correlations of thyroid hormones and TRs on liver IGF-I production are well known (Ramos et al., 2001; Schmid et al., 1992, 2004). Not only is IGF-I important in mediating the growth-promoting effects of GH (Rousseau and Dufour, 2007), it also plays a role in promoting vitellogenesis (Wuertz et al., 2007). Although vitellogenesis is not a physiological event in male fish, none-the-less, these changes point to the importance of some of these liver transcripts in the seasonal control of somatic growth. We also measured the levels of these same transcripts following treatments with GnRH and/or GnIH in the liver and testis of goldfish. The results are complex and in most cases do not show a clear correlation with the circulating LH and GH levels. The lack of a clear correlation may have been the results of the compounding effects of direct actions of GnRH and GnIH on the liver and testis, as well as their indirect influences via regulation of pituitary LH, FSH and GH release. In this context, hypothalamic GnRH and GnIH in goldfish exert their actions on the pituitary via direct innervations since teleosts lack a median eminence and portal system (Tsukahara et al., 1986). Normally, the levels of GnRH or GnIH in circulation are undetectable or lower than 1 pg/mL and therefore not likely to exert effects on peripheral tissues through endocrine mechanisms (Peter et al., 1990; Smith et al., 2012). However, the presence and action of both GnIH and GnRH and their respective receptors have also been identified in peripheral tissues in different species, including gonadal tissue in goldfish (Tsutsui et al., 2010; Habibi and Pati, 1993; Fallah et al., 2019; Pati and Habibi, 1993, 1998; Ubuka et al., 2014). Likewise, GnRHR expression has been detected in the liver of the hermaphroditic fish Kryptolebias marmoratus (Rhee et al., 2008) and GnRH expression in the human liver has also been reported (Kakar and Jennes, 1995). Similarly, Wang et al. (2018) reported expression of GnIH transcripts in the liver of half-smooth tongue sole (C. semilaevis). Thus, injections with GnRH and/or GnIH created the possibility that they could exert direct actions on the liver and testis in addition to their actions on the pituitary. The results of GnRH and GnIH treatments demonstrate seasonally related effects in both liver and testes. GnRH exerted stimulatory effects on liver ERα transcript levels and co-injection with GnIH inhibited GnRH-induced responses during regressed and mid recrudescence stages while GnIH itself did not affect ERα transcript levels at these reproductive stages. These observations suggest that GnIH may serve to inhibit GnRH-induced estrogen sensitivity in male liver to impede vitellogenesis during entry into the gonadal recrudescence season as ERα is the primary stimulator of vitellogenin production (Nelson and Habibi, 2010). Although GnIH treatments did increase overall liver Vtg mRNA levels during all seasons tested, GnIH could potentially act through other mediators of vitellogenesis and not ERα to stimulate Vtg mRNA synthesis. Partial correlations were observed between testicular mRNA levels of aromatase, ERα and FSHR following GnRH, GnIH and/or their combination treatments over the three reproductive stages. In particular, correlations were observed between ERα and FSHR expression in the combination treatment groups in sexually regressed and mid recrudescence, and between ERα and aromatase in mid recrudescence; between FSHR, aromatase and ERα in the GnRH alone groups in mid recrudescence, and for ERα and FSHR in regressed and mid recrudescence; and between ERα and FSHR following GnIH alone treatment in late recrudescence. In addition, there is a clear interaction between GnIH and GnRH. However, these changes are in generally not well correlated with serum LH responses, suggesting that direct GnRH and/ or GnIH action at the level of the testis, or at other extra-pituitary sites, plays an important role. The functional relevance of these correlated

messenger systems which may exert more rapid effects on intracellular events (Chang et al., 2012; Ubuka and Parhar, 2018), thyroid hormones act through nuclear receptors (Nelson and Habibi, 2006) as well as membrane receptors including integrin αVβ3 to trigger rapid MAPK/ ERK pathway (Bergh et al., 2005; Cody et al., 2007) and calcium dependent non-genomic actions in the cytoplasm (for review see: Senese et al., 2014; Bassett et al., 2003). Importantly TH non-genomic actions have been demonstrated in the pituitary of rats (Storey et al., 2002). Thus the time course of effects resulting from ip injection of T3 may not be the same as those elicited by GnIH and/or GnRH because of its combination of genomic and non-genomic actions. Furthermore, in the present study, exogenous T3 treatments were expected to increase circulating T3 levels over and above normal seasonal levels especially in the regressed season when normal circulating level of T3 is already high (Sohn et al., 1999). As a result, the present study of the effects of T3 may not be ideally suited to provide clear results that can clarify its role in the reciprocal control of LH and GH production in goldfish. In hindsight, a better approach would be to block thyroid hormone synthesis to investigate the roles of thyroid hormones on GnRH and GnIH influences. It should be noted that goldfish cannot be sexed accurately prior to dissection, especially in sexually regressed stages. In the present study, fish were randomly distributed into tanks containing both sexually mature male and female. At the end, fish were sacrificed and samples obtained for analysis. Only at that time was it possible to sex the fish. As a result, two groups including PBS + GnIH with T3 and GnIH + GnIH& GnRH with T3 at mid recrudescence gonadal stage had low replicate numbers, which may be considered as a potential limitation in this study. All the other groups had larger replicate numbers as indicated. It should also be noted that fish used in this study at different reproductive seasons were not the same size, although they were all sexually mature and post pubertal. While hormonal profile were likely similar in all fish used, we cannot completely rule out influence of size which can be considered as a limitation of this study. The present study provides information on tissue-specific seasonal patterns of transcript levels for various genes involved in the process of reproduction and growth in the liver and testes. The results demonstrated different seasonal patterns for ERα and ERβI transcript levels in the liver and testis. In the liver, both ERα and ERβI transcript levels were higher in the regressed and mid recrudescence males than in late recrudescence. In female fish, ERα and ERβI are involved in the control of vitellogenesis (Nelson et al., 2007; Nelson and Habibi, 2010, 2013), which starts at the end of regressed phase, continues through mid-recrudescence, and is completed by late recrudescence. The liver in male fish contains the Vtg gene, but it is not expressed significantly due to low circulating levels of estrogens under normal situations. Interestingly, not only are the levels of testicular ERα and ERβI transcript levels lower than those in the male liver, the pattern of seasonal changes in these two tissues were also different. The presence of ERs has been demonstrated in the testis of a number of vertebrates, including fishes, and ERs are known to mediate estrogen actions on spermatogenesis and male reproduction (Miura et al., 1999; Verderame and Scudiero, 2018; Dostalova et al., 2017). In the present study, we observed significantly higher levels of ERα and ERβI transcript levels in testicular tissue at late recrudescence which corresponds with higher expression of aromatase in the testis. These observations suggest that local conversion of testosterone to estrogen in the testis may be important in late gonadal recrudescence in males. These changes are also correlated with higher levels of FSHRs in the testis at late stages of gonadal recrudescence, indicating the importance of FSH control of testicular functions at this reproductive stage. The present results also demonstrate that similar transcript levels for TRαI and TRβ are present in male liver; this is consistent with previous finding in goldfish (Nelson and Habibi, 2006). Higher TRαI and IGF-1 transcript levels in liver were observed in mid recrudescence compared to other seasons, while transcript levels for TRβ and ERs were 14

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

in goldfish. In the regressed season GnIH stimulates GH secretion, and inhibits GnRH-induced LH response in late gonadal recrudescence. T3 may participate in the reciprocal regulation during growth phase, stimulating gonadotrope activity and inhibiting somatotrope activity. These hormones contribute to overall multifactorial regulation of growth and reproduction. In general, our results provide an insight into mechanisms controlling reciprocal control of somatotropic and gonadotropic function in fish and other oviparous species.

changes is at present unknown and requires further studies but changes in these transcript levels may be related to some of the known direct testicular actions of GnRH and GnIH. For example, GnRH is known to stimulate apoptosis in the mature testis when gonadotropin levels are low (Andreu-Vieyra and Habibi, 2001, 2005). There is also evidence for direct GnIH regulation of steroidogenesis and spermatogenesis in zebrafish (Fallah et al., 2019), house sparrow (McGuire and Bentley, 2010) and Syrian hamsters (Zhao et al., 2010). Interestingly, IGF-I also plays a positive role in the regulation of testicular steroidogenesis and IGF-I is also expressed in the testis (Le Gac et al., 1996; Reinecke et al., 1997; Reinecke, 2009). In this study, GnRH applied alone elevated liver IGF-I transcript levels only at mid and late recrudescence; whereas GnIH, applied either alone or in combination with GnRH, increased liver IGF-I mRNA expression in regressed and late recrudescence males, but it exhibited inhibitory effects in mid recrudescence. As discussed above, basal IGF-I expression in the liver is also highest at mid recrudescence in males. These changes in IGF-I transcripts is consistent with the idea that GnRH through its effects on IGF-I expression may regulate the increase in steroidogenic responsiveness during mid and late testicular recrudescence; on the other hand, GnIH may exert a positive a influence on IGF-I-mediated growth effects in regressed fish and serves as a negative modulator of testicular steroidogenesis during the switch from growth to early testicular regrowth stages through its negative influence on liver IGF-I expression. This hypothesis remains to be tested, and such experiments should include monitoring of the seasonal changes in testicular IGF-I expression and its regulation by neuroendocrine regulators such as GnRH and GnIH in addition to gonadotropins and GH. In the white seabream Diplodus sargus, testicular expression of IGF-I has been shown to be upregulated by exogenously applied GnRH and GH (Perez et al., 2016). Injections with GH or pituitary extracts increased testicular IGF-I mRNA levels in the rainbow trout (Perrot and Funkenstein, 1999). However, in the female gilthead seabream Sparus aurata, GnRH attenuates GH-induced IGF-I expression in the liver (Carnevali et al., 2005). Future measurements of LHR and enzymes that are involved in androgen synthesis may provide additional information and insights into hormonal regulation of testicular function in goldfish (Schulz et al., 2010). As indicated in the introduction, neuroendocrine regulation of reproduction and growth in fish is multifactorial in nature and involves many other factors in addition to GnRH, GnIH and thyroid hormone; these additional factors include ghrelin, neuropeptide Y (NPY), pituitary adenylate cyclase-activating polypeptide (PACAP) and dopamine (for review see: Chang et al., 2012; Zohar et al., 2010; Wong et al., 2006). In this regard, PACAP and ghrelin are stimulatory to LH and GH release in goldfish and may have additive or potentiating effects on GnRH influences on pituitary hormone release (Grey and Chang, 2011; Chang et al., 2001, 2009; Wong et al., 2000; Unniappan and Peter, 2004). NPY also stimulates LH and GH release through direct actions on pituitary cells and indirectly through stimulation of GnRH neurons (Peng et al., 1990, 1993). Dopamine is known to be an inhibitor of LH and stimulator of GH production in certain fish species, including goldfish (Omeljaniuk et al., 1987, 1989; Wong et al., 1992; De Leeuw et al., 1989; Chang and Peter, 1983; Yu and Peter, 1990; Chang et al., 1990; Sloley et al., 1992). Dopamine inhibits both basal and GnRHinduced LH release (Chang et al., 1984, 1983) and demonstrates seasonal responsiveness in GH release (Wong et al., 1993). Whether and how these neuroendocrine regulators interact with and/or influence the seasonal variation in basal and GnRH/GnIH-induced LH and GH release, and effects on liver and gonadal transcripts, should be further investigated to understand complexity of seasonal control of growth and reproduction.

Funding This work was supported by the funding from Natural Sciences and Engineering Research Council of Canada to HRH (NSERC Discovery Grant; project no. 1254045) and to JPC (NSERC Discovery Grant; project no. 121399). YM and CL were supported by NSERC grants to HRH, and YM was also supported by Queen Elizabeth II scholarship. Acknowledgements Authors would like to thank Mr. Enezi Khalid (UofA) and Mr. George Kinley (UofA) for their technical assistance on radioimmunoassays. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mce.2019.110629. References Allan, E.R.O., Habibi, H.R., 2012. Direct effects of triiodothyronine on production of anterior pituitary hormones and gonadal steroids in goldfish. Mol. Reprod. Dev. 79, 592–602. https://doi.org/10.1002/mrd.22066. Ancel, C., Bentsen, A.H., Sébert, M.E., Tena-Sempere, M., Mikkelsen, J.D., Simonneaux, V., 2012. Stimulatory effect of RFRP-3 on the gonadotrophic axis in the male Syrian hamster: the exception proves the rule. Endocrinology 153, 1352–1563. https://doi. org/10.1210/en.2011-1622. Ando, H., Shahjahan, M., Kitahashi, T., 2018. Periodic regulation of expression of genes for kisspeptin, gonadotropin-inhibitory hormone and their receptors in the grass puffer: implications in seasonal, daily and lunar rhythms of reproduction. Gen. Comp. Endocrinol. 265, 149–153. https://doi.org/10.1016/j.ygcen.2018.04.006. Andreu-Vieyra, C.V., Buret, A.G., Habibi, H.R., 2005. Gonadotropin-releasing hormone induction of apoptosis in the testes of goldfish (Crassius auratus). Endocrinology 146, 1588–1596. https://doi.org/10.1210/en.2004-0818. Andreu-Vieyra, C.V., Habibi, H.R., 2001. Effects of salmon GnRH and chicken GnRH-II on testicular apoptosis in goldfish (Carassius auratus). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 129, 483–487. https://doi.org/10.1016/S1096-4959(01) 00343-8. Bassett, J.H.D., Harvey, C.B., Williams, G.R., 2003. Mechanisms of thyroid hormone receptor-specific nuclear and extra nuclear actions. Mol. Cell. Endocrinol. 213, 1–11. https://doi.org/10.1016/j.mce.2003.10.033. Bergh, J.J., Lin, H.Y., Lansing, L., Mohamed, S.N., Davis, F.B., Mousa, S., Davis, P.J., 2005. Integrin αVβ3 contains a cell surface receptor site for thyroid hormone that is linked to activation of mitogen-activated protein kinase and induction of angiogenesis. Endocrinology 146, 2864–2871. https://doi.org/10.1210/en.2005-0102. Bhandari, R.K., Taniyama, S., Kitahashi, T., Ando, H., Yamauchi, K., Zohar, Y., Ueda, H., Urano, A., 2003. Seasonal changes of responses to gonadotropin-releasing hormone analog in expression of growth hormone/prolactin/somatolactin genes in the pituitary of masu salmon. Gen. Comp. Endocrinol. 130, 55–63. https://doi.org/10.1016/ S0016-6480(02)00536-1. Biran, J., Golan, M., Mizrahi, N., Ogawa, S., Parhar, I.S., Levavi-Sivan, B., 2014. LPXRFa, the piscine ortholog of GnIH, and LPXRF receptor positively regulate gonadotropin secretion in tilapia (Oreochromis niloticus). Endocrinology 155, 4391–4401. https:// doi.org/10.1210/en.2013-2047. Blázquez, M., Bosma, P.T., Fraser, E.J., Van Look, K.J., Trudeau, V.L., 1998. Fish as models for the neuroendocrine regulation of reproduction and growth. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 119, 345–364. https://doi.org/ 10.1016/S0742-8413(98)00023-1. Branco, G.S., Melo, A.G., Ricci, J.M.B., Digmayer, M., de Jesus, L.W.O., Habibi, H.R., Nóbrega, R.H., 2019. Effects of GnRH and the dual regulatory actions of GnIH in the pituitary explants and brain slices of Astyanax altiparanae males. Gen. Comp. Endocrinol. 273, 209–217. https://doi.org/10.1016/j.ygcen.2018.08.006. Cabello, G., Wrutniak, C., 1989. Thyroid hormone and growth : relationships with growth hormone effects and regulation. Reprod. Nutr. Dev. 29, 387–402. https://doi.org/10. 1051/rnd:19890401. Canosa, L.F., Chang, J.P., Peter, R.E., 2007. Neuroendocrine control of growth hormone

5. Conclusion In summary, results from this study demonstrate that both GnRH and GnIH serve as important regulators of circulating GH and LH levels 15

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al. in fish. Gen. Comp. Endocrinol. 151, 1–26. https://doi.org/10.1016/j.ygcen.2006.12. 010. Carnevali, O., Cardinali, M., Maradonna, F., Parisi, M., Olivotto, I., Polzonetti-Magni, A.M., Mosconi, G., Funkenstein, B., 2005. Hormonal regulation of hepatic IGF-I and IGF-II gene expression in the marine teleost Sparus aurata. Mol. Reprod. Dev. 71, 12–18. https://doi.org/10.1002/mrd.20122. Chang, J.P., Habibi, H.R., Yu, Y., Moussavi, M., Grey, C.L., Pemberton, J.G., 2012. Calcium and other signalling pathways in neuroendocrine regulation of somatotroph functions. Cell Calcium 51, 240–252. https://doi.org/10.1016/j.ceca.2011.11.001. Chang, J.P., Johnson, J.D., Sawisky, G.R., Grey, C.L., Mitchell, G., Booth, M., Volk, M.M., Parks, S.K., Thompson, E., Goss, G.G., Klausen, C., Habibi, H.R., 2009. Signal transduction in multifactorial neuroendocrine control of gonadotropin secretion and synthesis in teleosts-studies on the goldfish model. Gen. Comp. Endocrinol. 161, 42–52. https://doi.org/10.1016/j.ygcen.2008.09.005. Chang, J.P., Johnson, J.D., Van Goor, F., Wong, C.J., Yunker, W.K., Uretsky, A.D., Taylor, D., Jobin, R.M., Wong, A.O., Goldberg, J.I., 2000. Signal transduction mechanisms mediating secretion in goldfish gonadotropes and somatotropes. Biochem. Cell Biol. 78, 139–153. Chang, J.P., MacKenzie, D.S., Gould, D.R., Peter, R.E., 1984. Effects of dopamine and norepinephrine on in vitro spontaneous and gonadotropin-releasing hormone-induced gonadotropin release by dispersed cells or fragments of the goldfish pituitary. Life Sci. 35, 2027–2033. https://doi.org/10.1016/0024-3205(84)90559-9. Chang, J.P., Pemberton, J.G., 2018. Comparative aspects of GnRH-Stimulated signal transduction in the vertebrate pituitary – contributions from teleost model systems. Mol. Cell. Endocrinol. 463, 142–167. https://doi.org/10.1016/j.mce.2017.06.002. Chang, J.P., Peter, R.E., 1983. Effects of dopamine on gonadotropin release in female goldfish, Carassius auratus. Neuroendocrinology 36, 351–357. https://doi.org/10. 1159/000123480. Chang, J.P., Van Goor, F., Jobin, R.M., Lo, A., 1996. GnRH signaling in goldfish pituitary cells. Neurosignals 5, 70–80. https://doi.org/10.1159/000109176. Chang, J.P., Wirachowsky, N.R., Kwong, P., Johnson, J.D., 2001. PACAP stimulation of gonadotropin-II secretion in goldfish pituitary cells: mechanisms of action and interaction with gonadotropin releasing hormone signalling. J. Neuroendocrinol. 13, 540–550. https://doi.org/10.1046/j.1365-2826.2001.00667.x. Chang, J.P., Yu, K.L., Wong, A.O.L., Peter, R.E., 1990. Differential actions of dopamine receptor subtypes on gonadotropin and growth hormone release in vitro in goldfish. Neuroendocrinology 51, 664–674. https://doi.org/10.1159/000125408. Choi, Y.J., Kim, N.N., Habibi, H.R., Choi, C.Y., 2016. Effects of gonadotropin inhibitory hormone or gonadotropin-releasing hormone on reproduction-related genes in the protandrous cinnamon clownfish, Amphiprion melanopus. Gen. Comp. Endocrinol. 235, 89–99. https://doi.org/10.1016/j.ygcen.2016.06.010. Cody, V., Davis, P.J., Davis, F.B., 2007. Molecular modeling of the thyroid hormone interactions with alpha v beta 3 integrin. Steroids 72, 165–170. Cook, H., Berkenbosch, J.W., Fernhout, M.J., Yu, K.L., Peter, R.E., Chang, J.P., Rivier, J.E., 1991. Demonstration of gonadotropin releasing-hormone receptors on gonadotrophs and somatotrophs of the goldfish: an electron microscope study. Regul. Pept. 36, 369–378. https://doi.org/10.1016/0167-0115(91)90070-W. Cyr, D.G., Eales, J.G., 1988. In vitro effects of thyroid hormones on gonadotropin-induced estradiol-17β secretion by ovarian follicles of rainbow trout, Salmo gairdneri. Gen. Comp. Endocrinol. 69, 80–87. https://doi.org/10.1016/0016-6480(88)90055-X. Cyr, D.G., Eales, J.G., 1996. Interrelationships between thyroidal and reproductive endocrine systems in fish. Rev. Fish Biol. Fish. 6, 165–200. https://doi.org/10.1007/ BF00182342. De Leeuw, R., Habibi, H.R., Nahorniak, C.S., Peter, R.E., 1989. Dopaminergic regulation of pituitary gonadotrophin-releasing hormone receptor activity in the goldfish (Crassius auratus). J. Endocrinol. 121, 239–247. https://doi.org/10.1677/joe.0. 1210239. Di Yorio, M.P., Pérez Sirkin, D.I., Delgadin, T.H., Shimizu, A., Tsutsui, K., Somoza, G.M., Vissio, P.G., 2016. Gonadotrophin-inhibitory hormone in the cichlid fish Cichlasoma dimerus: structure, brain distribution and differential effects on the secretion of gonadotrophins and growth hormone. J. Neuroendocrinol. 28, 1–10. https://doi.org/ 10.1111/jne.12377. Dostalova, P., Zatecka, E., Dvorakova-Hortova, K., 2017. Of oestrogens and sperm: a review of the roles of oestrogens and oestrogen receptors in male reproduction. Int. J. Mol. Sci. 18, E904. https://doi.org/10.3390/ijms18050904. Einarsdóttir, I.E., Silva, N., Power, D.M., Smáradóttir, H., Björnsson, B.T., 2006. Thyroid and pituitary gland development from hatching through metamorphosis of a teleost flatfish, the Atlantic halibut. Anat. Embryol. 211, 47–60. https://doi.org/10.1007/ s00429-005-0055-z. Fallah, H.P., Tovo-Neto, A., Yeung, E.C., Nóbrega, R.H., Habibi, H.R., 2019. Paracrine/ autocrine control of spermatogenesis by gonadotropin-inhibitory hormone. Mol. Cell. Endocrinol. 492, 110440. https://doi.org/10.1016/j.mce.2019.04.020. Gouveia, C.H.A., Miranda-Rodrigues, M., Martins, G.M., Neofiti-Papi, B., 2018. Thyroid hormone and skeletal development. Vitam. Horm. 106https://doi.org/10.1016/bs. vh.2017.06.002. 838-472. Grey, C.L., Chang, J.P., 2011. Differential modulation of ghrelin-induced GH and LH release by PACAP and dopamine in goldfish pituitary cells. Gen. Comp. Endocrinol. 23, 1273–1287. https://doi.org/10.1016/j.ygcen.2013.06.020. Habibi, H.R., Nelson, E.R., Allan, E.R.O., 2012. New insights into thyroid hormone function and modulation of reproduction in goldfish. Gen. Comp. Endocrinol. 175, 19–26. https://doi.org/10.1016/j.ygcen.2011.11.003. Habibi, H.R., Pati, D., 1993. Extrapituitary gonadotropin-releasing hormone (GnRH) binding sites in goldfish. Fish Physiol. Biochem. 11, 43–49. https://doi.org/10.1007/ BF00004549. Habibi, H.R., Peter, R.E., Nahorniak, C.S., Raymond, R.C., Millar, R.P., 1992. Activity of vertebrate gonadotropin-releasing hormones and analogs with variant amino acid

residues in positions 5, 7 and 8 in the goldfish pituitary. Regul. Pept. 37, 271–284. https://doi.org/10.1016/0167-0115(92)90620-A. Johnson, M.A., Fraley, G.S., 2008. Rat RFRP-3 alters hypothalamic GHRH expression and growth hormone secretion but does not affect KiSS-1 gene expression or the onset of puberty in male rats. Neuroendocrinology 88, 305–315. https://doi.org/10.1159/ 000145718. Johnson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide-3 stimulates GH secretion, inhibits LH secretion, and has variable effects on sex behavior in the adult male rat. Horm. Behav. 51, 171–180. https://doi.org/10.1016/j.yhbeh.2006. 09.009. Kakar, S.S., Jennes, L., 1995. Expression of gonadotropin-releasing hormone and gonadotropin-releasing hormone receptor mRNAs in various non-reproductive human tissues. Cancer Lett. 98, 57–62. https://doi.org/10.1016/S0304-3835(06)80010-8. Kim, M.H., Oka, Y., Amano, M., Kobayashi, M., Okuzawa, K., Hasegawa, Y., Kawashima, S., Suzuki, Y., Aida, K., 1995. Immunocytochemical localization of sGnRH and cGnRH‐II in the brain of goldfish, Carassius auratus. J. Comp. Neurol. 356, 72–82. https://doi.org/10.1002/cne.903560105. Klausen, C., Chang, J.P., Habibi, H.R., 2001. The effect of gonadotropin-releasing hormone on growth hormone and gonadotropin subunit gene expression in the pituitary of goldfish, Carassius auratus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 129, 511–516. https://doi.org/10.1016/S1096-4959(01)00351-7. Klausen, C., Chang, J.P., Habibi, H.R., 2003. Time- and dose-related effects of gonadotropin-releasing hormone on growth hormone and gonadotropin subunit gene expression in the goldfish pituitary. Can. J. Physiol. Pharmacol. 80, 915–924. https:// doi.org/10.1139/y02-118. Klausen, C., Tsuchiya, T., Chang, J.P., Habibi, H.R., 2005. PKC and ERK are differentially involved in gonadotropin-releasing hormone-induced growth hormone gene expression in the goldfish pituitary. Am. J. Physiol. Integr. Comp. Physiol. 289, R1625–R1633. https://doi.org/10.1152/ajpregu.00188.2005. Koda, A., Ukena, K., Teranishi, H., Ohta, S., Yamamoto, K., Kikuyama, S., Tsutsui, K., 2002. A novel amphibian hypothalamic neuropeptide: isolation, localization, and biological activity. Endocrinology 143, 411–419. https://doi.org/10.1210/endo.143. 2.8630. Le Gac, F., Loir, M., Le Bail, P.Y., Ollitrault, M., 1996. Insulin-like growth factor (IGF-I) mRNA and IGF-I receptor in trout testis and in isolated spermatogenic and Sertoli cells. Mol. Reprod. Dev. 44, 23–35. https://doi.org/10.1002/(SICI)10982795(199605)44:1<23::AID-MRD3>3.0.CO;2-V. Lescroart, O., Roelants, I., Mikolajczyk, T., Bosma, P.T., Schulz, R.W., Kühn, E.R., Ollevier, F., 1996. A radioimmunoassay for African catfish growth hormone: validation and effects of substances modulating the release of growth hormone. Gen. Comp. Endocrinol. 104, 147–155. https://doi.org/10.1006/gcen.1996.0157. Li, W.S., Lin, H.R., Wong, A.O.L., 2002. Effects of gonadotropin-releasing hormone on growth hormone secretion and gene expression in common carp pituitary. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 132, 335–341. https://doi.org/10.1016/ S1096-4959(02)00039-8. Lostroh, A.J., Li, C.H., 1958. Effect of growth hormone and thyroxine on body weight of hypophysectomized C3H mice. Endocrinology 62, 484–492. https://doi.org/10. 1210/endo-62-4-484. Louis, A., Bartke, A., Masternak, M.M., 2010. Effects of growth hormone and thyroxine replacement therapy on insulin signaling in Ames dwarf mice. J. Gerontol. A Biol. Sci. Med. Sci. 65, 344–352. https://doi.org/10.1093/gerona/glq018. Manzon, R.G., Manzon, L.A., 2017. Lamprey metamorphosis: thyroid hormone signaling in a basal vertebrate. Mol. Cell. Endocrinol. 459, 28–42. https://doi.org/10.1016/j. mce.2017.06.015. Marchant, T.A., Dulka, J.G., Peter, R.E., 1989. Relationship between serum growth hormone levels and the brain and pituitary content of immunoreactive somatostatin in the goldfish, Carassius auratus L. Gen. Comp. Endocrinol. 73, 458–468. https://doi. org/10.1016/0016-6480(89)90203-7. Marchant, T.A., Peter, R.E., 1986. Seasonal variations in body growth rates and circulating levels of growth hormone in the goldfish, Crassius auratus. J. Exp. Zool. 237, 231–239. https://doi.org/10.1002/jez.1402370209. Marlatt, V.L., Lakoff, J., Crump, K., Martyniuk, C.J., Watt, J., Jewell, L., Atkinson, S., Blais, J.M., Sherry, J., Moon, T.W., Trudeau, V.L., 2010. Sex- and tissue-specific effects of waterborne estrogen on estrogen receptor subtypes and E2-mediated gene expression in the reproductive axis of goldfish. Comp. Biochem. Physiol. Mol. Integr. Physiol. 156, 92–101. https://doi.org/10.1016/j.cbpa.2010.01.001. McGuire, N.L., Bentley, G.E., 2010. A functional neuropeptide system in vertebrate gonads: gonadotropin-inhibitory hormone and its receptor in testes of field-caught house sparrow (Passer domesticus). Gen. Comp. Endocrinol. 166, 565–572. https:// doi.org/10.1016/j.ygcen.2010.01.010. Melamed, P., Eliahu, N., Levavi-Sivan, B., Ofir, M., Farchi-Pisanty, O., Rentier-Delrue, F., Smal, J., Yaron, Z., Naor, Z., 1995. Hypothalamic and thyroidal regulation of growth hormone in tilapia. Gen. Comp. Endocrinol. 97, 13–30. https://doi.org/10.1006/ gcen.1995.1002. Miura, T., Miura, C., Ohta, T., Nader, M.R., Todo, T., Yamauchi, K., 1999. Estradiol-17β stimulates the renewal of spermatogonial stem cells in males. Biochem. Biophys. Res. Commun. 264, 230–234. https://doi.org/10.1006/bbrc.1999.1494. Moav, B., McKeown, B.A., 1992. Thyroid hormone increases transcription of growth hormone mRNA in rainbow trout pituitary. Horm. Metab. Res. 24, 10–14. https:// doi.org/10.1055/s-2007-1003242. Montaner, A.D., Park, M.K., Fischer, W.H., Craig, A.G., Chang, J.P., Somoza, G.M., Rivier, J.E., Sherwood, N.M., 2001. Primary structure of a novel gonadotropin-releasing hormone in the brain of a teleost, Pejerrey. Endocrinology 142, 1453–1460. https:// doi.org/10.1210/endo.142.4.8077. Morais, R.D., Nóbrega, R.H., Gómez-González, N.E., Schmidt, R., Bogerd, J., França, L.R., Schulz, R.W., 2013. Thyroid hormone stimulates the proliferation of Sertoli cells and

16

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

T.A., 1990. Actions of gonadotropin-releasing hormone (GnRH) in the goldfish. Prog. Clin. Biol. Res. 342, 393–398. Peter, R.E., Nahorniak, C.S., Chang, J.P., Crim, L.W., 1984. Gonadotropin release from the pars distalis of goldfish, Carassius auratus, transplanted beside the brain or into the brain ventricles: additional evidence for gonadotropin-release-inhibitory factor. Gen. Comp. Endocrinol. 55, 337–346. https://doi.org/10.1016/0016-6480(84)90001-7. Peter, R.E., Nahorniak, C.S., Sokolowska, M., Chang, J.P., Rivier, J.E., Vale, W.W., King, J.A., Millar, R.P., 1985. Structure-activity relationships of mammalian, chicken, and salmon gonadotropin releasing hormones in vivo in goldfish. Gen. Comp. Endocrinol. 58, 231–242. https://doi.org/10.1016/0016-6480(85)90339-9. Power, D.M., Llewellyn, L., Faustino, M., Nowell, M.A., Björnsson, B.T., Einarsdottir, I.E., Canario, A.V.M., Sweeney, G.E., 2001. Thyroid hormones in growth and development of fish. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 130, 447–459. https://doi. org/10.1016/S1532-0456(01)00271-X. Ramos, S., Goya, L., Alvarez, C., Martín, M.A., Pascual-Leone, A.M., 2001. Effect of thyroxine administration on the IGF/IGF binding protein system in neonatal and adult thyroidectomized rats. J. Endocrinol. 169, 111–122. Reinecke, M., 2009. Insulin-like growth factors and fish reproduction. Biol. Reprod. 82, 656–661. https://doi.org/10.1095/biolreprod.109.080093. Reinecke, M., 2010. Insulin-like growth factors and fish reproduction. Biol. Reprod. 82, 656–661. https://doi.org/10.1095/biolreprod.109.080093. Reinecke, M., Schmid, A., Ermatinger, R., Loffing-Cueni, D., 1997. Insulin-like growth factor I in the teleost Oreochromis mossambicus, the tilapia: gene sequence, tissue expression, and cellular localization. Endocrinology 138, 3613–3619. https://doi. org/10.1210/endo.138.9.5375. Rhee, J.S., Seo, J.S., Raisuddin, S., Ki, J.S., Lee, K.W., Kim, I.C., Yoon, Y.D., Lee, J.S., 2008. Gonadotropin-releasing hormone receptor (GnRHR) gene expression is differently modulated in gender types of the hermaphroditic fish Kryptolebias marmoratus by endocrine disrupting chemicals. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 147, 357–365. https://doi.org/10.1016/j.cbpc.2008.01.007. Rousseau, K., Dufour, S., 2007. Comparative aspects of GH and metabolic regulation in lower vertebrates. Neuroendocrinology 86, 165–174. https://doi.org/10.1159/ 000101029. Rousseau, K., Le Belle, N., Marchelidon, J., Dufour, S., 1999. Evidence that corticotropinreleasing hormone acts as a growth hormone-releasing factor in a primitive teleost, the European eel (Anguilla anguilla). J. Neuroendocrinol. 11, 385–392. https://doi. org/10.1046/j.1365-2826.1999.00334.x. Rousseau, K., Le Belle, N., Pichavant, K., Marchelidon, J., Chow, B.K.C., Boeuf, G., Dufour, S., 2001. Pituitary growth hormone secretion in the turbot, a phylogenetically recent teleost, is regulated by a species-specific pattern of neuropeptides. Neuroendocrinology 74, 375–385. https://doi.org/10.1159/000054704. Rousseau, K., Le Belle, N., Sbaihi, M., Marchelidon, J., Schmitz, M., Dufour, S., 2002. Evidence for a negative feedback in the control of eel growth hormone by thyroid hormones. J. Endocrinol. 175, 605–613. https://doi.org/10.1677/joe.0.1750605. Sawada, K., Ukena, K., Satake, H., Iwakoshi, E., Minakata, H., Tsutsui, K., 2002. Novel fish hypothalamic neuropeptide: cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide. Eur. J. Biochem. 269, 6000–6008. https://doi.org/10.1046/j.1432-1033.2002.03351.x. Schmid, C., Brändie, M., Zwimpfer, C., Zapf, J., Wiesli, P., 2004. Effect of thyroxine replacement on creatinine, insulin-like growth factor 1, acid-labile subunit, and vascular endothelial growth factor. Clin. Chem. 50, 228–231. https://doi.org/10.1373/ clinchem.2003.021022. Schmid, C., Schläpfer, I., Futo, E., Waldvogel, M., Schwander, J., Zapf, J., Froesch, E.R., 1992. Triiodothyronine (T3) stimulates insulin-like growth factor (IGF)-1 and IGF binding protein (IGFBP)-2 production by rat osteoblasts in vitro. Acta Endocrinol. 126, 467–473. Schneider, J.S., Rissman, E.F., 2008. Gonadotropin-releasing hormone II: a multi-purpose neuropeptide. Integr. Comp. Biol. 48, 588–595. https://doi.org/10.1093/icb/icn018. Schulz, R.W., de França, L.R., Lareyre, J.J., LeGac, F., Chiarini-Garcia, H., Nobrega, R.H., Miura, T., 2010. Spermatogenesis in fish. Gen. Comp. Endocrinol. 165, 390–411. https://doi.org/10.1016/j.ygcen.2009.02.013. Senese, R., Cioffi, F., de Lange, P., Goglia, F., Lanni, A., 2014. Thyroid: biological actions of ‘nonclassical’ thyroid hormones. J. Endocrinol. 221, R1–R12. https://doi.org/10. 1530/joe-13-0573. Shahjahan, M., Doi, H., Ando, H., 2016. LPXRFamide peptide stimulates growth hormone and prolactin gene expression during the spawning period in the grass puffer, a semilunar synchronized spawner. Gen. Comp. Endocrinol. 227, 77–83. https://doi.org/ 10.1016/j.ygcen.2015.09.008. Sinha, A.K., Liew, H.J., Diricx, M., Kumar, V., Darras, V.M., Blust, R., De Boeck, G., 2012. Combined effects of high environmental ammonia, starvation and exercise on hormonal and ion-regulatory response in goldfish (Carassius auratus L.). Aquat. Toxicol. 114–115, 153–164. https://doi.org/10.1016/J.AQUATOX.2012.02.027. Sloley, B.D., Kah, O., Trudeau, V.L., Dulka, J.G., Peter, R.E., 1992. Amino acid neurotransmitters and dopamine in brain and pituitary of the goldfish: involvement in the regulation of gonadotropin secretion. J. Neurochem. 58, 2254–2262. https://doi.org/ 10.1111/j.1471-4159.1992.tb10971.x. Smith, J.T., Young, I.R., Veldhuis, J.D., Clarke, I.J., 2012. Gonadotropin-inhibitory hormone (GnIH) secretion into the ovine hypophyseal portal system. Endocrinology 153, 3368–3375. https://doi.org/10.1210/en.2012-1088. Sohn, Y.C., Yoshiura, Y., Kobayashi, M., Aida, K., 1999. Seasonal changes in mRNA levels of gonadotropin and thyrotropin subunits in the goldfish, Carassius auratus. Gen. Comp. Endocrinol. 113, 436–444. https://doi.org/10.1006/gcen.1998.7224. Stacey, N.E., Cook, A.F., Peter, R.E., 1979. Ovulatory surge of gonadotropin in the goldfish, Carassius auratus. Gen. Comp. Endocrinol. 37, 246–249. https://doi.org/10. 1016/0016-6480(79)90113-8. Stefano, A.V., Vissio, P.G., Paz, D.A., Somoza, G.M., Maggese, M.C., Barrantes, G.E., 1999.

single type A spermatogonia in adult zebrafish (Danio rerio) testis. Endocrinology 154, 4365–4376. https://doi.org/10.1210/en.2013-1308. Moussavi, M., Wlasichuk, M., Chang, J.P., Habibi, H.R., 2012. Seasonal effect of GnIH on gonadotrope functions in the pituitary of goldfish. Mol. Cell. Endocrinol. 350, 53–60. https://doi.org/10.1016/j.mce.2011.11.020. Moussavi, M., Wlasichuk, M., Chang, J.P., Habibi, H.R., 2013. Seasonal effect of gonadotrophin inhibitory hormone on gonadotrophin-releasing hormone-induced gonadotroph functions in the goldfish pituitary. J. Neuroendocrinol. 25, 506–516. https:// doi.org/10.1111/jne.12024. Moussavi, M., Wlasichuk, M., Chang, J.P., Habibi, H.R., 2014. Seasonal effects of GnIH on basal and GnRH-induced goldfish somatotrope functions. J. Endocrinol. 223, 191–202. https://doi.org/10.1530/joe-14-0441. Mullur, R., Liu, Y.Y., Brent, G.A., 2014. Thyroid hormone regulation of metabolism. Physiol. Rev. 94, 355–382. https://doi.org/10.1152/physrev.00030.2013. Muñoz-Cueto, J.A., Paullada-Salmerón, J.A., Aliaga-Guerrero, M., Cowan, M.E., Parhar, I.S., Ubuka, T., 2017. A journey through the gonadotropin-inhibitory hormone system of fish. Front. Endocrinol. 8, 285. https://doi.org/10.3389/fendo.2017. 00285. Nelson, E.R., Allan, E.R.O., Pang, F.Y., Habibi, H.R., 2010. Thyroid hormone and reproduction: regulation of estrogen receptors in goldfish gonads. Mol. Reprod. Dev. 77, 784–794. https://doi.org/10.1002/mrd.21219. Nelson, E.R., Habibi, H.R., 2006. Molecular characterization and sex-related seasonal expression of thyroid receptor subtypes in goldfish. Mol. Cell. Endocrinol. 253, 83–95. https://doi.org/10.1016/j.mce.2006.05.003. Nelson, E.R., Habibi, H.R., 2010. Functional significance of nuclear estrogen receptor subtypes in the liver of goldfish. Endocrinology 151, 1668–1676. https://doi.org/10. 1210/en.2009-1447. Nelson, E.R., Habibi, H.R., 2013. Estrogen receptor function and regulation in fish and other vertebrates. Gen. Comp. Endocrinol. 192, 15–24. https://doi.org/10.1016/j. ygcen.2013.03.032. Nelson, E.R., Habibi, H.R., 2016. Thyroid hormone regulates vitellogenin by inducing estrogen receptor alpha in the goldfish liver. Mol. Cell. Endocrinol. 436, 259–267. https://doi.org/10.1016/j.mce.2016.08.045. Nelson, E.R., Wiehler, W.B., Cole, W.C., Habibi, H.R., 2007. Homologous regulation of estrogen receptor subtypes in goldfish (Carassius auratus). Mol. Reprod. Dev. 74, 1105–1112. https://doi.org/10.1002/mrd.20634. Okubo, K., Nagahama, Y., 2008. Structural and functional evolution of gonadotropinreleasing hormone in vertebrates. Acta Physiol. 193, 3–15. https://doi.org/10.1111/ j.1748-1716.2008.01832.x. Omeljaniuk, R.J., Habibi, H.R., Peter, R.E., 1989. Alterations in pituitary GnRH and dopamine receptors associated with the seasonal variation and regulation of gonadotropin release in the goldfish (Carassius auratus). Gen. Comp. Endocrinol. 74, 392–399. https://doi.org/10.1016/S0016-6480(89)80036-X. Omeljaniuk, R.J., Shih, S.H., Peter, R.E., 1987. In-vivo evaluation of dopamine receptormediated inhibition of gonadotrophin secretion from the pituitary gland of the goldfish, Carassius auratus. J. Endocrinol. 114, 449–458. https://doi.org/10.1677/ joe.0.1140449. Parhar, I.S., Soga, T., Sakuma, Y., Millar, R.P., 2002. Spatio-temporal expression of gonadotropin-releasing hormone receptor subtypes in gonadotropes, somatotropes and lactotropes in the cichlid fish. J. Neuroendocrinol. 14, 657–665. https://doi.org/10. 1046/j.1365-2826.2002.00817.x. Pasmanik, M., Callard, G.V., 1988. Changes in brain aromatase and 5α-reductase activities correlate significantly with seasonal reproductive cycles in goldfish (crassius auratus). Endocrinology 122, 1349–1356. https://doi.org/10.1210/endo-122-41349. Pati, D., Habibi, H.R., 1993. Characterization of gonadotropin-releasing hormone receptors in goldfish ovary: variation during follicular development. Am. J. Physiol. Integr. Comp. Physiol. 264, R227–R234. https://doi.org/10.1152/ajpregu.1993.264. 2.r227. Pati, D., Habibi, H.R., 1998. Presence of salmon gonadotropin-releasing hormone (GnRH) and compounds with GnRH-like activity in the ovary of goldfish. Endocrinology 139, 2015–2024. https://doi.org/10.1210/endo.139.4.5877. Paullada-Salmerón, J.A., Cowan, M., Aliaga-Guerrero, M., Gómez, A., Zanuy, S., Mañanos, E., Muñoz-Cueto, J.A., 2016a. LPXRFa peptide system in the European sea bass: a molecular and immunohistochemical approach. J. Comp. Neurol. 524, 176–198. https://doi.org/10.1002/cne.23833. Paullada-Salmerón, J.A., Cowan, M., Aliaga-Guerrero, M., Morano, F., Zanuy, S., MuñozCueto, J.A., 2016b. Gonadotropin inhibitory hormone down-regulates the brain-pituitary reproductive Axis of male European sea bass (Dicentrarchus labrax)1. Biol. Reprod. 94, 1–11. https://doi.org/10.1095/biolreprod.116.139022. Peng, C., Chang, J.P., Yu, K.L., Wong, A.O.L., Van Goor, F., Peter, R.E., Rivier, J.E., 1993. Neuropeptide-y stimulates growth hormone and gonadotropin-ii secretion in the goldfish pituitary: involvement of both presynaptic and pituitary cell actions. Endocrinology 132, 1820–1829. https://doi.org/10.1210/endo.132.4.8462479. Peng, C., Huang, Y.P., Peter, R.E., 1990. Neuropeptide Y stimulates growth hormone and gonadotropin release from the goldfish pituitary in vitro. Neuroendocrinology 52, 28–34. https://doi.org/10.1159/000125534. Pérez, L., Bosco Ortiz-Delgado, J., Manchado, M., 2016. Molecular characterization and transcriptional regulation by GH and GnRH of insulin-like growth factors I and II in white seabream (Diplodus sargus). Gene 578, 251–262. https://doi.org/10.1016/j. gene.2015.12.030. Perrot, V., Funkenstein, B., 1999. Cellular distribution of insulin-like growth factor II (IGF-II) mRNA and hormonal regulation of IGF-I and IGF-II mRNA expression in rainbow trout testis (Oncorhynchus mykiss). Fish Physiol. Biochem. 20, 219–229. https://doi.org/10.1023/A:1007735314871. Peter, R.E., Habibi, H.R., Chang, J.P., Nahorniak, C.S., Yu, K.L., Huang, Y.P., Marchant,

17

Molecular and Cellular Endocrinology 500 (2020) 110629

Y. Ma, et al.

reproductive male tract of non mammalian vertebrates. Steroids 134, 1–8. https:// doi.org/10.1016/j.steroids.2018.04.001. Wang, B., Liu, Q., Liu, X., Xu, Y., Shi, B., 2018. Molecular characterization and expression profiles of LPXRFa at the brain-pituitary-gonad axis of half-smooth tongue sole (Cynoglossus semilaevis) during ovarian maturation. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 216, 59–68. https://doi.org/10.1016/j.cbpb.2017.11.016. Wong, A.O.L., Chang, J.P., Peter, R.E., 1992. Dopamine stimulates growth hormone release from the pituitary of goldfish, crassius auratus, through the dopamine Dl receptors. Endocrinology 130, 1201–1210. https://doi.org/10.1210/endo.130.3. 1347006. Wong, A.O., Chang, J.P., Peter, R.E., 1993. In vitro and in vivo evidence that dopamine exerts growth hormone-releasing activity in goldfish. Am. J. Physiol. Metab. 264, E925–E932. https://doi.org/10.1152/ajpendo.1993.264.6.e925. Wong, A.O., Li, W.S., Lee, E.K., Leung, M.Y., Tse, L.Y., Chow, B.K., Lin, H.R., Chang, J.P., 2000. Pituitary adenylate cyclase activating polypeptide as a novel hypophysiotropic factor in fish. Biochem. Cell Biol. 78, 329–343. https://doi.org/10.1139/o00-055. Wong, A.O.L., Zhou, H., Jiang, Y., Ko, W.K.W., 2006. Feedback regulation of growth hormone synthesis and secretion in fish and the emerging concept of intrapituitary feedback loop. Comp. Biochem. Physiol. Mol. Integr. Physiol. 144, 284–305. https:// doi.org/10.1016/j.cbpa.2005.11.021. Wuertz, S., Nitsche, A., Jastroch, M., Gessner, J., Klingenspor, M., Kirschbaum, F., Kloas, W., 2007. The role of the IGF-I system for vitellogenesis in maturing female sterlet, Acipenser ruthenus Linnaeus, 1758. Gen. Comp. Endocrinol. 150, 140–150. https:// doi.org/10.1016/j.ygcen.2006.07.005. Xia, W., Smith, O., Zmora, N., Xu, S., Zohar, Y., 2014. Comprehensive analysis of GnRH2 neuronal projections in zebrafish. Sci. Rep. 4, 3676. https://doi.org/10.1038/ srep03676. Yu, K.L., Nahorniak, C.S., Peter, R.E., Corrigan, A., Rivier, J.E., Vale, W.W., 1987. Brain distribution of radioimmunoassayable gonadotropin-releasing hormone in female goldfish: seasonal variation and periovulatory changes. Gen. Comp. Endocrinol. 67, 234–246. https://doi.org/10.1016/0016-6480(87)90153-5. Yu, K.L., Peter, R.E., 1990. Dopaminergic regulation of brain gonadotropin-releasing hormone in male goldfish during spawning behavior. Neuroendocrinology 52, 276–283. https://doi.org/10.1159/000125598. Yu, K.L., Rosenblum, P.M., Peter, R.E., 1991. In vitro release of gonadotropin-releasing hormone from the brain preoptic-anterior hypothalamic region and pituitary of female goldfish. Gen. Comp. Endocrinol. 81, 256–267. https://doi.org/10.1016/00166480(91)90010-4. Zhao, S., Zhu, E., Yang, C., Bentley, G.E., Tsutsui, K., Kriegsfeld, L.J., 2010. RFamiderelated peptide and messenger ribonucleic acid expression in mammalian testis: association with the spermatogenic cycle. Endocrinology 151, 617–627. https://doi. org/10.1210/en.2009-0978. Zohar, Y., Muñoz-Cueto, J.A., Elizur, A., Kah, O., 2010. Neuroendocrinology of reproduction in teleost fish. Gen. Comp. Endocrinol. 165, 438–455. https://doi.org/10. 1016/j.ygcen.2009.04.017.

Colocalization of GnRH binding sites with gonadotropin-, somatotropin-, somatolactin-, and prolactin-expressing pituitary cells of the pejerrey, Odontesthes bonariensis, in vitro. Gen. Comp. Endocrinol. 116, 133–139. https://doi.org/10.1006/ gcen.1999.7354. Storey, N.M., O’Bryan, J.P., Armstrong, D.L., 2002. Rac and Rho mediate opposing hormonal regulation of the ether-a-go-go-related potassium channel. Curr. Biol. 12, 27–33. https://doi.org/10.1016/S0960-9822(01)00625-X. Tovo-Neto, A., da Silva Rodrigues, M., Habibi, H.R., Nóbrega, R.H., 2018. Thyroid hormone actions on male reproductive system of teleost fish. Gen. Comp. Endocrinol. 1, 230–236. https://doi.org/10.1016/j.ygcen.2018.04.023. Trudeau, V.L., 1997. Neuroendocrine regulation of gonadotrophin II release and gonadal growth in the goldfish, Carassius auratus. Rev. Reprod. 2, 55–68. Tsukahara, T., Gorbman, A., Kobayashi, H., 1986. Median eminence equivalence of the neurohypophysis of the hagfish, Eptatretus burgeri. Gen. Comp. Endocrinol. 61, 348–354. https://doi.org/10.1016/0016-6480(86)90220-0. Tsutsui, K., Bentley, G.E., Bedecarrats, G., Osugi, T., Ubuka, T., Kriegsfeld, L.J., 2010. Gonadotropin-inhibitory hormone (GnIH) and its control of central and peripheral reproductive function. Front. Neuroendocrinol. 31, 284–295. https://doi.org/10. 1016/j.yfrne.2010.03.001. Tsutsui, K., Saigoh, E., Ukena, K., Teranishi, H., Fujisawa, Y., Kikuchi, M., Ishii, S., Sharp, P.J., 2000. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochem. Biophys. Res. Commun. 275, 661–667. https://doi.org/10.1006/bbrc. 2000.3350. Tsutsui, K., Ubuka, T., 2018. How to contribute to the progress of neuroendocrinology: Discovery of GnIH and progress of GnIH Research. Front. Endocrinol. 9, 662. https:// doi.org/10.3389/fendo.2018.00662. Ubuka, T., Inoue, K., Fukuda, Y., Mizuno, T., Ukena, K., Kriegsfeld, L.J., Tsutsui, K., 2012. Identification, expression, and physiological functions of Siberian hamster gonadotropin-inhibitory hormone. Endocrinology 153, 373–385. https://doi.org/10.1210/ en.2011-1110. Ubuka, T., Parhar, I., 2018. Dual actions of mammalian and piscine gonadotropin-inhibitory hormones, RFamide-related peptides and LPXRFamide peptides, in the hypothalamic-pituitary-gonadal axis. Front. Endocrinol. 8, 377. https://doi.org/10. 3389/fendo.2017.00377. Ubuka, T., Son, Y.L., Tobari, Y., Narihiro, M., Bentley, G.E., Kriegsfeld, L.J., Tsutsui, K., 2014. Central and direct regulation of testicular activity by gonadotropin-inhibitory hormone and its receptor. Front. Endocrinol. 5, 8. Ullah, R., Shen, Y., Zhou, Y.D., Huang, K., Fu, J.F., Wahab, F., Shahab, M., 2016. Expression and actions of GnIH and its orthologs in vertebrates: current status and advanced knowledge. Neuropeptides 59, 9–20. https://doi.org/10.1016/j.npep. 2016.05.004. Unniappan, S., Peter, R.E., 2004. In vitro and in vivo effects of ghrelin on luteinizing hormone and growth hormone release in goldfish. Am. J. Physiol. Integr. Comp. Physiol. 286, R1093–R1101. https://doi.org/10.1152/ajpregu.00669.2003. Verderame, M., Scudiero, R., 2018. A comparative review on estrogen receptors in the

18