- Email: [email protected]
Multiple- locus variable-number tandem-repeat analysis (MLVA) of Shigella sonnei isolates of 2012 outbreak I. R. Iran
Microbial Pathogenesis 102 (2017) 69e73
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Multiple- locus variable-number tandem-repeat analysis (MLVA) of Shigella sonnei isolates of 2012 outbreak I. R. Iran Bita Bakhshi a, *, Bahareh Bayat b, Abdolaziz Rastegar Lari b a b
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran Department of Microbiology, Iran University of Medical Sciences, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 October 2016 Received in revised form 28 October 2016 Accepted 31 October 2016 Available online 30 November 2016
Shigella sonnei is a major cause of diarrhea especially in children. Molecular study can help to determine the outbreak of this bacterium. Multiple-Locus Variable number tandem repeat Analysis (MLVA) will largely influence the public health field by introducing newer, faster, safer, and effective procedure for typing of microorganisms. A total of fifty shigella isolates were collected between November 2012 to October 2013 in Tehran, Iran. The strains were identified base on biochemical and molecular tests. Subsequently, all shigella species were confirmed by species-specific polymerase chain reaction (PCR). Virulence factors were detected using PCR for ial, set1A, and set1B genes. The strains were genotyped by MLVA typing method. All of the isolates were identified as S. sonnei by biochemical and molecular (PCR) methods. Virulence genes identified among all isolates included ial, and set1A genes in 20% and 5% of all isolates, respectively. On the other hand, none of isolates were positive for set1B gene. Using MLVA method 22 MLVA types were identified. MLVA type 11 accounted for 32% of isolates. Moreover, all virulence factors were only detected in MLVA type 11, 9, 5, 4. The results of this study indicate that the Iranian 2012e2013 S. sonnei outbreak isolates were virulent and clonaly related. Furthermore, this study showed that MLVA can be used as useful method for S. sonnei genotyping in epidemiological investigations. © 2016 Published by Elsevier Ltd.
Keywords: S. sonnei MLVA Virulence factors
1. Introduction Diarrhea is a major cause of death in developing countries especially in children under 5 years [1,2]. Among the pathogens causing diarrhea, Shigella sonnei, as well as S. dysenteriae, S. boydii, and S. flexneri, are the contributing agents of shigellosis [3]. It has been estimate that annually approximately 164.7 million people are infected by shigella spp and 163 million of them are in developing countries [3,4]. Historically, S. sonnei is the major Shigella spp. in developed countries. However, lately, a variation in trend has been described from developing countries, where S. flexneri serotypes have been substituted by S. sonnei in extents undergoing economic growth and progresses in hygiene [1,5]. In Shigella spp. different virulence factors that caused invasion and colonization in the intestine have been identified. These genes may be located in chromosomal sequence or on the inv plasmid responsible for invasion/
* Corresponding author. Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Jalal-Ale-Ahmad Ave. Tehran 14117-13116, Iran. E-mail address: [email protected] (B. Bakhshi). http://dx.doi.org/10.1016/j.micpath.2016.10.021 0882-4010/© 2016 Published by Elsevier Ltd.
penetration like the invasion - associated locus (ial) [6e8]. Two enterotoxins in Shigella named Shigella enterotoxin 1 (ShET-1) (set1A and set1B), and 2 can also change electrolyte and water transport in the small intestine [9]. The shigella enterotoxin 1 is a 55 KD protein, encoded by chromosomal genes set1A and set1B [9]. The analysis of bacterial isolates by numerous genotyping methods offers valuable information for creating the genetic relatedness between isolates for the purposes of epidemiological investigation and phylogenetic report [10]. Among these genotyping methods, pulsed-field gel electrophoresis (PFGE) has been established to be a powerful device for discerning Shigella strains and has become a standardized technique for universal molecularsubtyping network for food-borne-disease surveillance [11]. However, PFGE is too discriminatory for investigating clonal relationships among Shigella strains that have changed over centuries or decades [10]. Among the next generation of subtyping methods, MLVA has been established for subtyping of many organisms [12e14]. Researchers have revealed that MLVA has a parallel discriminatory power to or greater discriminatory power than PFGE [10,11]. Even
70
B. Bakhshi et al. / Microbial Pathogenesis 102 (2017) 69e73
72 C for 10 min [19].
Table 1 Primers used for PCR to detect S. sonnei isolates and virulence genes. Gene
Primer sequence (50 /300 )
PCR product size (bp)
wbgZ
TCTGAATATGCCCTCTACGCT GACAGAGCCCGAAGAACCG CTGGATGGTATGGTGAGG GGAGGCCAACAATTATTTCC TCACGCTACCATCAAAGA TATCCCCCTTTGGTGGTA GTGAACCTGCTGCCGATATC ATTTGTGGATAAAAATGACG
430
ial Set1A Set1B
2.3. Virulence genes detection
320 309 147
though MLVA is very organism-specific, at the level of serovars or even clones within a species [15]. MLVA are used for subtyping of infectious isolates for disease surveillance and outbreak study [12]. The current study objects to develop an MLVA method and assess its usefulness in typing of S. sonnei isolates for the purpose of epidemiological study. 2. Materials and methods 2.1. Sampling, isolation and identification The specimens were collected between November 2012 to October 2013 from children under 5 years of age with diarrhea characterized by 3 episode of loose or watery stools with or without blood, mucus and stomach cramps from 3 major hospitals in Tehran, Iran. For bacterial isolation the specimens were cultured on selective agar plates including Salmonella-Shigella agar (Merck Co., Darmstadt, Germany) [8]. Shigella species were detected based on biochemical tests including oxidase, urease, Triple sugar iron agar (TSI), motility, and carbohydrate fermentation [16]. All isolates were serotyped using standard slide agglutination method (Mast Diagnostic, Merseyside, UK). S. sonnei ATCC 9290, and S. flexneri ATCC 12022 were used as control throughout the study [17]. 2.2. DNA extraction and molecular identification DNA was extracted using boiling method in which two or three bacterial colonies were dissolved in 200 ml in 2 ml sterile microtubes, and was placed in boiling water for 10 min and then centrifuged at 10,000 rpm for 10 min [18]. Then, 2 ml of the supernatant was used for PCR amplification. Specific identification was performed by PCR assay with specific primer for wbgZ genes as described before [19] (Table 1). The PCR cycles for isolates identification were as follow: an initial denaturation at 95 C for 5 min, with 30 cycles of denaturation at 94 C for 1 min, annealing at 56 C for 1 min and elongation at 72 C for 1 min and final extension at
For PCR of virulence genes (ial, set1A, set1B), each 25 ml PCR mixture consisted of 0.5 ml of each of the primers (F and R) (ial, set1A, set1B); 12 ml PCR- Master Mix (Ampliqon, Denmark), 2 ml DNA template, and 10 ml distilled water. Direct sequencing of one representative of each PCR amplified product was carried out using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea). The primer sequences were selected according to previous study as showed in Table 1 [20]. The PCR cycles were as follow: an initial denaturation at 95 C for 5 min, with 30 cycles of denaturation at 94 C for 1 min, annealing at 55 C for 45 s and elongation at 72 C for 1 min and final extension at 72 C for 7 min [21]. 2.4. MLVA typing Five VNTR loci (SS1, SS3, SS6, SS12 and SS23) were selected as described before [11]. Accordingly, pure and fresh culture of S. sonnei isolates on trypticase soy agar plates was prepared and the genome of isolates was extracted by boiling method as descried above. PCR reactions were performed in a total volume of 25 ml with 0.5 ml of each of the primers (F and R) 15 ml PCR- Master Mix (Ampliqon, Denmark), 3 ml DNA template, and 6 ml distilled water. The PCR cycles for SS1, SS3, SS6, SS12 and SS23 were performed with a denaturing step at 94 C for 5 min, followed by 30 cycles of amplification at 94 C for 45 s, 55 C for 50 s, and 72 C for 1 min [11]. The primer sequences of the selected VNTR loci are showed in Table 2. After PCR, the size of each locus was determined on a 1.5% agarose gel and the number of repeats was designed by the criteria of Ranjbar et al. [18]. Any difference in one or more VNTR loci was regarded as a distinct type. Sequencing of PCR products was performed when needed. The PCR products were subjected to sequencing using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea) after purification with QIAquick Gel Extraction Kit (Qiagen). After visualization and sequencing, the MLVA patterns were analyzed by using the BioNumerics (version 7.6) software (Applied Maths, Belgium). Dendrogram was generated and compared by using the Categorical values, followed by UPGMA (unweighted pair-group method with arithmetic averages) clustering. The spanning tree was also generated based on virulence genes distribution and MLVA types of isolates. 3. Result 3.1. Bacterial isolates and serogrouping A total number of 50 isolates were obtained from fecal samples. All of them were S. sonnei based on biochemical tests and PCR
Table 2 List of primers used in MLVA analysis. Primer
VNTR Locus
Sequence of primer
Length of repeat unit (bp)
1
SS1
7
2
SS3
3
SS6
4
SS12
5
SS23
TTGCCAGTACACCTCACTCG GCGTCGGCGTTAATATCACT CTGGGAGATGAACAGGAGGA ATGCCAGCGACAAGTTTCTT GAGTCGCTAAACGCTTGCTT GGGAAATAGAGCGGACCTTT GCTGTAGGCACGGAAAAGAA TGGATATTGTGCAGGGTTCA CTGGCTTAATGGCTACATAC CGCATGAGCGTGTTGTAATG
7 7 9 16
B. Bakhshi et al. / Microbial Pathogenesis 102 (2017) 69e73
Fig. 1. UPGMA dendrogram based on MLVA type of isolates in regard to their virulence gene content.
71
Fig. 2. Spanning tree of virulence genes distribution among different MLVA patterns.
amplification. Accuracy of PCR was confirmed by sequencing of one representative of corresponding 460 bp bands. Serogrouping of all isolates revealed that all isolates were belonged to S. sonnei serogroup. 3.2. Presence of virulence genes Attempt to detect virulence associated genes revealed the presence of ial and set1A genes in 20% (n ¼ 10) and 6% (n ¼ 3) of isolates, respectively. On the other hand, none of the isolates harbored the set1B gene. Sequencing confirmed the PCR results. 3.3. MLVA analysis In this study, 50 S. sonnei strains were studied in terms of identifying VNTRs. MLVA performed for all isolates by determining the differences in five genes. MLVA type were defined as isolates which their PCR bands were related to each other and they had same PCR patterns for their five genes. Five and four different PCR patterns were identified for SS1-SS3, and SS6 genes, respectively. While for SS12 and SS23 there was only one pattern. We found 22 different MLVA types among 50 strains studied. The most prevalent MLVA type among our isolates were MLVA type 9 (34%), 11 (8%), 12, 4, 5 (each with 6%). MLVA clusters were defined on the basis of four out of five identical MLVA allelic profiles. With this definition, UPGMA clustering of the MLVA profile revealed the presence of seven clusters (Fig. 1). The most prevalent clusters among our isolates were C5 (23/50, 46%), and C6 (7/50, 14%) (Fig. 1). In cluster 5, seventeen isolates (17/23, 74%) shared the same MLVA profile (MLVA 9: 3-6-
11-15-16). There were also two isolates that were distinct to other genotypes which differed at two or more loci from others (Fig. 1). Fig. 2 shows the spanning tree of virulence genes distribution among different MLVA patterns. There were four virulence patterns in our isolates. The four virulence pattern were showed in relation with their MLVA pattern in Fig. 1. Most our isolates were negative for virulence factors, however, in MLVA type 9 with 17 isolates 5 isolates had same virulence pattern (Fig. 2). Moreover, in MLLVA type 11 with four isolates we had 4 virulence factor patterns. 4. Discussion In the present study, we assessed the incidence of virulence genes and genetic relatedness of fifty S. sonnei isolates collected from children under 5 years of age in outbreaks during 2012e2013 from three major hospitals in Tehran, Iran. To comprehend basic information about the characteristics and diversity of strains triggering shigellosis in Iran we have analyzed S. sonnei isolates by MLVA typing, a valuable method for bacterial following and determining diversity of populations of clinical isolate [15]. As mentioned above, MLVA has clear advantages, donating fast typing, high resolution, and reduced handling times of pathogenic organisms [18]. S. sonnei is the main Shigella species isolated in developed countries, while S. flexneri prevails in unindustrialized countries [5]. Generally, the state in Iran agreed with this report. Additionally, in certain parts of Iran, such as Tehran, where the municipal hygiene and cleanness were good, an important reduction in occurrence of S. flexneri compared with S. sonnei was detected [1,5]. In this study, S. sonnei strains were isolated from children under 5 years of age.
B. Bakhshi et al. / Microbial Pathogenesis 102 (2017) 69e73
Earlier studies have displayed that children are at higher risk of receiving the infection [22,5]. The harshness of the bacterial diseases depends on the virulence of the bacterial strains [23]. Numerous virulence factors have been concomitant with Shigella spp. Several virulence factors are involved in the invasion of intestinal cells such as ial gene [8]. Showing the presence of virulence-associated genes in Shigella would be beneficial to better recognize its pathogenicity [21]. In this study we explored the distribution and incidence of ial, set1A, set1B virulence genes in Shigella isolates. The detection of the virulence genes from 50 isolates revealed that 20% and 5% of isolates were positive for ial and set1A gene, respectively, while set1B gene was detected in 0% of our isolates. However, Hosseini Nave et al., in 2015 reported that 80% of their isolates were positive for ial, and all of their S. sonnei isolates were negative for set1A and set1B [21]. Ial gene is located only on the plasmid and thus is likely to lose or deletion [24]. Zhang et al. [25] reported that 17.1% of their S. sonnei strains had set1A or set1B genes separately or simultaneously. Nevertheless, in several other reports these genes were totally detected in S. flexneri strains [20,21,26]. MLVA is an unpretentious method, with high - throughput and low cost [18]. In this study, 50 isolates were divided into 22 MLVA types. Even though, our selected loci were only five locus other studies have showed that selection of four, eight, fifteen or even twenty-six loci had almost closely similar discriminatory powers especially for S. sonnei isolates [3,10,11]. Liang et al. developed and evaluated MLVA assay based on 26 VNTR loci for disease surveillance and outbreak investigations. They demonstrated that MLVA was able to discriminate PFGE-indistinguishable isolates [11]. In our MLVA method, we used VNTR loci which can produce the most discriminatory power for shigella isolates. Therefore, this method can be done for epidemiological purposes in many laboratories with simple molecular biology tools. In this study some isolates with the same MLVA type had different virulence gene patterns. It might be as a result of virulence factors which are located on plasmid and subsequently these elements are prone to loss or deletions during growth at in-vitro conditions [8]. 5. Conclusion In all, an MLVA method with 5 VNTR loci has been established for typing of S. sonnei strains. Heterogeneity was observed in the frequency of virulence genes as well as MLVA types. MLVA can offer valuable data in epidemiological study of S. sonnei outbreaks. However, study of a larger sample size from different geographical locations can be beneficial for further and more accurate assessments. Competing interests The authors declare that they have no competing interests. Acknowledgment This study was supported by a grant (M/T 93-02-30-24648) from Iran University of Medical Sciences, Tehran, Iran. References [1] R. Ranjbar, M.M. Soltan Dallal, M. Talebi, M.R. Pourshafie, Increased isolation and characterization of Shigella sonnei obtained from hospitalized children in Tehran, Iran, J. Health.Popul. Nutr. 26 (2008) 426e430.
73
[2] S.K. Niyogi, Shigellosis, J. Microbiol. 43 (2005) 133e143. [3] Y.W. Wang, H. Watanabe, D.C. Phung, S.K. Tung, Y.S. Lee, J. Terajima, et al., Multilocus variable-number tandem repeat analysis for molecular typing and phylogenetic analysis of Shigella flexneri, BMC Microbiol. 9 (2009) 278. [4] S. Li, J. Wang, X. Wei, Y. Liu, L. You, X. Luo, et al., Molecular characterization of Shigella sonnei: an increasingly prevalent etiologic agent of shigellosis in guizhou province, southwest of China, PloS One 11 (2016) e0156020. [5] M. Tajbakhsh, L. Garcia Migura, M. Rahbar, C.A. Svendsen, M. Mohammadzadeh, M.R. Zali, et al., Antimicrobial-resistant Shigella infections from Iran: an overlooked problem? J. Antimicrob. Chemother. 67 (2012) 1128e1133. [6] L.Y. Ye, F.H. Lan, Z.Y. Zhu, X.M. Chen, X.L. Ye, Detection of Shigella and enteroinvasive Escherichia coli using polymerase chain reaction, J. Diarrhoeal Dis. Res. 11 (1993) 38e40. [7] G. Frankel, J.A. Giron, J. Valmassoi, G.K. Schoolnik, Multi-gene amplification: simultaneous detection of three virulence genes in diarrhoeal stool, Mol. Microbiol. 3 (1989) 1729e1734. [8] K.L. Thong, S.L. Hoe, S.D. Puthucheary, R. Yasin, Detection of virulence genes in Malaysian Shigella species by multiplex PCR assay, BMC Infect. Dis. 5 (2005) 8. [9] S. Roy, K. Thanasekaran, A.R. Dutta Roy, S.C. Sehgal, Distribution of Shigella enterotoxin genes and secreted autotransporter toxin gene among diverse species and serotypes of shigella isolated from Andaman Islands, India, Trop. Med. Int. Health 11 (2006) 1694e1698. [10] C.S. Chiou, H. Watanabe, Y.W. Wang, W.L. Wang, J. Terajima, K.L. Thong, et al., Utility of multilocus variable-number tandem-repeat analysis as a molecular tool for phylogenetic analysis of Shigella sonnei, J. Clin. Microbiol. 47 (2009) 1149e1154. [11] S.Y. Liang, H. Watanabe, J. Terajima, C.C. Li, J.C. Liao, S.K. Tung, et al., Multilocus variable-number tandem-repeat analysis for molecular typing of Shigella sonnei, J. Clin. Microbiol. 45 (2007) 3574e3580. [12] B.A. Lindstedt, M. Torpdahl, G. Vergnaud, S. Le Hello, F.X. Weill, E. Tietze, et al., Use of multilocus variable-number tandem repeat analysis (MLVA) in eight European countries, 2012, Euro. Surveill. 18 (2013) 20385. [13] B.A. Lindstedt, T. Vardund, L. Aas, G. Kapperud, Multiple-locus variablenumber tandem-repeats analysis of Salmonella enterica subsp. enterica serovar Typhimurium using PCR multiplexing and multicolor capillary electrophoresis, J. Microbiol. Methods 59 (2004) 163e172. [14] D. Sobral, P. Mariani-Kurkdjian, E. Bingen, H. Vu-Thien, K. Hormigos, B. Lebeau, et al., A new highly discriminatory multiplex capillary-based MLVA assay as a tool for the epidemiological survey of Pseudomonas aeruginosa in cystic fibrosis patients, Eur. J. Clin. Microbiol. Infect. Dis. 31 (2012) 2247e2256. [15] C.S. Chiou, H. Izumiya, K.L. Thong, J.T. Larsson, S.Y. Liang, J. Kim, et al., A simple approach to obtain comparable Shigella sonnei MLVA results across laboratories, Int. J. Med. Microbiol. 303 (2013) 678e684. [16] W.C. Winn, E.W. Koneman, Koneman's Color Atlas and Textbook of Diagnostic Microbiology, the Enterobacteriaceae, Lippincott Williams & Wilkins, 2006, pp. 249e250. [17] M. Radhika, M. Saugata, H.S. Murali, H.V. Batra, A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species, Braz. J. Microbiol. 45 (2014) 667e676. [18] R. Ranjbar, M. Memariani, Multilocus variable-number tandem-repeat analysis for genotyping of Shigella sonnei strains isolated from pediatric patients, Gastroenterol Hepatol. Bed Bench 8 (2015) 225e232. [19] S.S. Ojha, C.Y. Yean, A. Ismail, K.K.B. Singh, A pentaplex PCR assay for the detection and differentiation of Shigella species, Biomed. Res. Int. 2013 (2013) 1e9. [20] M.A. Sousa, E.N. Mendes, G.B. Collares, L.A. Peret-Filho, F.J. Penna, P.P. Magalhaes, Shigella in Brazilian children with acute diarrhoea: prevalence, antimicrobial resistance and virulence genes, Mem. Inst. Oswaldo Cruz 108 (2013) 30e35. [21] H. Hosseini Nave, S. Mansouri, M. Emaneini, M. Moradi, Distribution of genes encoding virulence factors and molecular analysis of Shigella spp. isolated from patients with diarrhea in Kerman, Iran, Microb. Pathog. 92 (2016) 68e71. [22] S. Farshad, R. Sheikhi, A. Japoni, E. Basiri, A. Alborzi, Characterization of Shigella strains in Iran by plasmid profile analysis and PCR amplification of ipa genes, J. Clin. Microbiol. 44 (2006) 2879e2883. [23] J. Zhang, L. Qian, Y. Wu, X. Cai, X. Li, X. Cheng, et al., Deletion of pic results in decreased virulence for a clinical isolate of Shigella flexneri 2a from China, BMC Microbiol. 13 (2013) 31. [24] M. Vargas, J. Gascon, M.T. Jimenez De Anta, J. Vila, Prevalence of Shigella enterotoxins 1 and 2 among Shigella strains isolated from patients with traveler's diarrhea, J. Clin. Microbiol. 37 (1999) 3608e3611. [25] C.L. Zhang, Q.Z. Liu, J. Wang, X. Chu, L.M. Shen, Y.Y. Guo, Epidemic and virulence characteristic of Shigella spp. with extended-spectrum cephalosporin resistance in Xiaoshan District, Hangzhou, China, BMC Infect. Dis. 14 (2014) 260. [26] F.R. Noriega, F.M. Liao, S.B. Formal, A. Fasano, M.M. Levine, Prevalence of Shigella enterotoxin 1 among Shigella clinical isolates of diverse serotypes, J. Infect. Dis. 172 (1995) 1408e1410.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Multiple- locus variable-number tandem-repeat analysis (MLVA) of Shigella sonnei isolates of 2012 outbreak I. R. Iran Bita Bakhshi a, *, Bahareh Bayat b, Abdolaziz Rastegar Lari b a b
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran Department of Microbiology, Iran University of Medical Sciences, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 October 2016 Received in revised form 28 October 2016 Accepted 31 October 2016 Available online 30 November 2016
Shigella sonnei is a major cause of diarrhea especially in children. Molecular study can help to determine the outbreak of this bacterium. Multiple-Locus Variable number tandem repeat Analysis (MLVA) will largely influence the public health field by introducing newer, faster, safer, and effective procedure for typing of microorganisms. A total of fifty shigella isolates were collected between November 2012 to October 2013 in Tehran, Iran. The strains were identified base on biochemical and molecular tests. Subsequently, all shigella species were confirmed by species-specific polymerase chain reaction (PCR). Virulence factors were detected using PCR for ial, set1A, and set1B genes. The strains were genotyped by MLVA typing method. All of the isolates were identified as S. sonnei by biochemical and molecular (PCR) methods. Virulence genes identified among all isolates included ial, and set1A genes in 20% and 5% of all isolates, respectively. On the other hand, none of isolates were positive for set1B gene. Using MLVA method 22 MLVA types were identified. MLVA type 11 accounted for 32% of isolates. Moreover, all virulence factors were only detected in MLVA type 11, 9, 5, 4. The results of this study indicate that the Iranian 2012e2013 S. sonnei outbreak isolates were virulent and clonaly related. Furthermore, this study showed that MLVA can be used as useful method for S. sonnei genotyping in epidemiological investigations. © 2016 Published by Elsevier Ltd.
Keywords: S. sonnei MLVA Virulence factors
1. Introduction Diarrhea is a major cause of death in developing countries especially in children under 5 years [1,2]. Among the pathogens causing diarrhea, Shigella sonnei, as well as S. dysenteriae, S. boydii, and S. flexneri, are the contributing agents of shigellosis [3]. It has been estimate that annually approximately 164.7 million people are infected by shigella spp and 163 million of them are in developing countries [3,4]. Historically, S. sonnei is the major Shigella spp. in developed countries. However, lately, a variation in trend has been described from developing countries, where S. flexneri serotypes have been substituted by S. sonnei in extents undergoing economic growth and progresses in hygiene [1,5]. In Shigella spp. different virulence factors that caused invasion and colonization in the intestine have been identified. These genes may be located in chromosomal sequence or on the inv plasmid responsible for invasion/
* Corresponding author. Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Jalal-Ale-Ahmad Ave. Tehran 14117-13116, Iran. E-mail address: [email protected] (B. Bakhshi). http://dx.doi.org/10.1016/j.micpath.2016.10.021 0882-4010/© 2016 Published by Elsevier Ltd.
penetration like the invasion - associated locus (ial) [6e8]. Two enterotoxins in Shigella named Shigella enterotoxin 1 (ShET-1) (set1A and set1B), and 2 can also change electrolyte and water transport in the small intestine [9]. The shigella enterotoxin 1 is a 55 KD protein, encoded by chromosomal genes set1A and set1B [9]. The analysis of bacterial isolates by numerous genotyping methods offers valuable information for creating the genetic relatedness between isolates for the purposes of epidemiological investigation and phylogenetic report [10]. Among these genotyping methods, pulsed-field gel electrophoresis (PFGE) has been established to be a powerful device for discerning Shigella strains and has become a standardized technique for universal molecularsubtyping network for food-borne-disease surveillance [11]. However, PFGE is too discriminatory for investigating clonal relationships among Shigella strains that have changed over centuries or decades [10]. Among the next generation of subtyping methods, MLVA has been established for subtyping of many organisms [12e14]. Researchers have revealed that MLVA has a parallel discriminatory power to or greater discriminatory power than PFGE [10,11]. Even
70
B. Bakhshi et al. / Microbial Pathogenesis 102 (2017) 69e73
72 C for 10 min [19].
Table 1 Primers used for PCR to detect S. sonnei isolates and virulence genes. Gene
Primer sequence (50 /300 )
PCR product size (bp)
wbgZ
TCTGAATATGCCCTCTACGCT GACAGAGCCCGAAGAACCG CTGGATGGTATGGTGAGG GGAGGCCAACAATTATTTCC TCACGCTACCATCAAAGA TATCCCCCTTTGGTGGTA GTGAACCTGCTGCCGATATC ATTTGTGGATAAAAATGACG
430
ial Set1A Set1B
2.3. Virulence genes detection
320 309 147
though MLVA is very organism-specific, at the level of serovars or even clones within a species [15]. MLVA are used for subtyping of infectious isolates for disease surveillance and outbreak study [12]. The current study objects to develop an MLVA method and assess its usefulness in typing of S. sonnei isolates for the purpose of epidemiological study. 2. Materials and methods 2.1. Sampling, isolation and identification The specimens were collected between November 2012 to October 2013 from children under 5 years of age with diarrhea characterized by 3 episode of loose or watery stools with or without blood, mucus and stomach cramps from 3 major hospitals in Tehran, Iran. For bacterial isolation the specimens were cultured on selective agar plates including Salmonella-Shigella agar (Merck Co., Darmstadt, Germany) [8]. Shigella species were detected based on biochemical tests including oxidase, urease, Triple sugar iron agar (TSI), motility, and carbohydrate fermentation [16]. All isolates were serotyped using standard slide agglutination method (Mast Diagnostic, Merseyside, UK). S. sonnei ATCC 9290, and S. flexneri ATCC 12022 were used as control throughout the study [17]. 2.2. DNA extraction and molecular identification DNA was extracted using boiling method in which two or three bacterial colonies were dissolved in 200 ml in 2 ml sterile microtubes, and was placed in boiling water for 10 min and then centrifuged at 10,000 rpm for 10 min [18]. Then, 2 ml of the supernatant was used for PCR amplification. Specific identification was performed by PCR assay with specific primer for wbgZ genes as described before [19] (Table 1). The PCR cycles for isolates identification were as follow: an initial denaturation at 95 C for 5 min, with 30 cycles of denaturation at 94 C for 1 min, annealing at 56 C for 1 min and elongation at 72 C for 1 min and final extension at
For PCR of virulence genes (ial, set1A, set1B), each 25 ml PCR mixture consisted of 0.5 ml of each of the primers (F and R) (ial, set1A, set1B); 12 ml PCR- Master Mix (Ampliqon, Denmark), 2 ml DNA template, and 10 ml distilled water. Direct sequencing of one representative of each PCR amplified product was carried out using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea). The primer sequences were selected according to previous study as showed in Table 1 [20]. The PCR cycles were as follow: an initial denaturation at 95 C for 5 min, with 30 cycles of denaturation at 94 C for 1 min, annealing at 55 C for 45 s and elongation at 72 C for 1 min and final extension at 72 C for 7 min [21]. 2.4. MLVA typing Five VNTR loci (SS1, SS3, SS6, SS12 and SS23) were selected as described before [11]. Accordingly, pure and fresh culture of S. sonnei isolates on trypticase soy agar plates was prepared and the genome of isolates was extracted by boiling method as descried above. PCR reactions were performed in a total volume of 25 ml with 0.5 ml of each of the primers (F and R) 15 ml PCR- Master Mix (Ampliqon, Denmark), 3 ml DNA template, and 6 ml distilled water. The PCR cycles for SS1, SS3, SS6, SS12 and SS23 were performed with a denaturing step at 94 C for 5 min, followed by 30 cycles of amplification at 94 C for 45 s, 55 C for 50 s, and 72 C for 1 min [11]. The primer sequences of the selected VNTR loci are showed in Table 2. After PCR, the size of each locus was determined on a 1.5% agarose gel and the number of repeats was designed by the criteria of Ranjbar et al. [18]. Any difference in one or more VNTR loci was regarded as a distinct type. Sequencing of PCR products was performed when needed. The PCR products were subjected to sequencing using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea) after purification with QIAquick Gel Extraction Kit (Qiagen). After visualization and sequencing, the MLVA patterns were analyzed by using the BioNumerics (version 7.6) software (Applied Maths, Belgium). Dendrogram was generated and compared by using the Categorical values, followed by UPGMA (unweighted pair-group method with arithmetic averages) clustering. The spanning tree was also generated based on virulence genes distribution and MLVA types of isolates. 3. Result 3.1. Bacterial isolates and serogrouping A total number of 50 isolates were obtained from fecal samples. All of them were S. sonnei based on biochemical tests and PCR
Table 2 List of primers used in MLVA analysis. Primer
VNTR Locus
Sequence of primer
Length of repeat unit (bp)
1
SS1
7
2
SS3
3
SS6
4
SS12
5
SS23
TTGCCAGTACACCTCACTCG GCGTCGGCGTTAATATCACT CTGGGAGATGAACAGGAGGA ATGCCAGCGACAAGTTTCTT GAGTCGCTAAACGCTTGCTT GGGAAATAGAGCGGACCTTT GCTGTAGGCACGGAAAAGAA TGGATATTGTGCAGGGTTCA CTGGCTTAATGGCTACATAC CGCATGAGCGTGTTGTAATG
7 7 9 16
B. Bakhshi et al. / Microbial Pathogenesis 102 (2017) 69e73
Fig. 1. UPGMA dendrogram based on MLVA type of isolates in regard to their virulence gene content.
71
Fig. 2. Spanning tree of virulence genes distribution among different MLVA patterns.
amplification. Accuracy of PCR was confirmed by sequencing of one representative of corresponding 460 bp bands. Serogrouping of all isolates revealed that all isolates were belonged to S. sonnei serogroup. 3.2. Presence of virulence genes Attempt to detect virulence associated genes revealed the presence of ial and set1A genes in 20% (n ¼ 10) and 6% (n ¼ 3) of isolates, respectively. On the other hand, none of the isolates harbored the set1B gene. Sequencing confirmed the PCR results. 3.3. MLVA analysis In this study, 50 S. sonnei strains were studied in terms of identifying VNTRs. MLVA performed for all isolates by determining the differences in five genes. MLVA type were defined as isolates which their PCR bands were related to each other and they had same PCR patterns for their five genes. Five and four different PCR patterns were identified for SS1-SS3, and SS6 genes, respectively. While for SS12 and SS23 there was only one pattern. We found 22 different MLVA types among 50 strains studied. The most prevalent MLVA type among our isolates were MLVA type 9 (34%), 11 (8%), 12, 4, 5 (each with 6%). MLVA clusters were defined on the basis of four out of five identical MLVA allelic profiles. With this definition, UPGMA clustering of the MLVA profile revealed the presence of seven clusters (Fig. 1). The most prevalent clusters among our isolates were C5 (23/50, 46%), and C6 (7/50, 14%) (Fig. 1). In cluster 5, seventeen isolates (17/23, 74%) shared the same MLVA profile (MLVA 9: 3-6-
11-15-16). There were also two isolates that were distinct to other genotypes which differed at two or more loci from others (Fig. 1). Fig. 2 shows the spanning tree of virulence genes distribution among different MLVA patterns. There were four virulence patterns in our isolates. The four virulence pattern were showed in relation with their MLVA pattern in Fig. 1. Most our isolates were negative for virulence factors, however, in MLVA type 9 with 17 isolates 5 isolates had same virulence pattern (Fig. 2). Moreover, in MLLVA type 11 with four isolates we had 4 virulence factor patterns. 4. Discussion In the present study, we assessed the incidence of virulence genes and genetic relatedness of fifty S. sonnei isolates collected from children under 5 years of age in outbreaks during 2012e2013 from three major hospitals in Tehran, Iran. To comprehend basic information about the characteristics and diversity of strains triggering shigellosis in Iran we have analyzed S. sonnei isolates by MLVA typing, a valuable method for bacterial following and determining diversity of populations of clinical isolate [15]. As mentioned above, MLVA has clear advantages, donating fast typing, high resolution, and reduced handling times of pathogenic organisms [18]. S. sonnei is the main Shigella species isolated in developed countries, while S. flexneri prevails in unindustrialized countries [5]. Generally, the state in Iran agreed with this report. Additionally, in certain parts of Iran, such as Tehran, where the municipal hygiene and cleanness were good, an important reduction in occurrence of S. flexneri compared with S. sonnei was detected [1,5]. In this study, S. sonnei strains were isolated from children under 5 years of age.
B. Bakhshi et al. / Microbial Pathogenesis 102 (2017) 69e73
Earlier studies have displayed that children are at higher risk of receiving the infection [22,5]. The harshness of the bacterial diseases depends on the virulence of the bacterial strains [23]. Numerous virulence factors have been concomitant with Shigella spp. Several virulence factors are involved in the invasion of intestinal cells such as ial gene [8]. Showing the presence of virulence-associated genes in Shigella would be beneficial to better recognize its pathogenicity [21]. In this study we explored the distribution and incidence of ial, set1A, set1B virulence genes in Shigella isolates. The detection of the virulence genes from 50 isolates revealed that 20% and 5% of isolates were positive for ial and set1A gene, respectively, while set1B gene was detected in 0% of our isolates. However, Hosseini Nave et al., in 2015 reported that 80% of their isolates were positive for ial, and all of their S. sonnei isolates were negative for set1A and set1B [21]. Ial gene is located only on the plasmid and thus is likely to lose or deletion [24]. Zhang et al. [25] reported that 17.1% of their S. sonnei strains had set1A or set1B genes separately or simultaneously. Nevertheless, in several other reports these genes were totally detected in S. flexneri strains [20,21,26]. MLVA is an unpretentious method, with high - throughput and low cost [18]. In this study, 50 isolates were divided into 22 MLVA types. Even though, our selected loci were only five locus other studies have showed that selection of four, eight, fifteen or even twenty-six loci had almost closely similar discriminatory powers especially for S. sonnei isolates [3,10,11]. Liang et al. developed and evaluated MLVA assay based on 26 VNTR loci for disease surveillance and outbreak investigations. They demonstrated that MLVA was able to discriminate PFGE-indistinguishable isolates [11]. In our MLVA method, we used VNTR loci which can produce the most discriminatory power for shigella isolates. Therefore, this method can be done for epidemiological purposes in many laboratories with simple molecular biology tools. In this study some isolates with the same MLVA type had different virulence gene patterns. It might be as a result of virulence factors which are located on plasmid and subsequently these elements are prone to loss or deletions during growth at in-vitro conditions [8]. 5. Conclusion In all, an MLVA method with 5 VNTR loci has been established for typing of S. sonnei strains. Heterogeneity was observed in the frequency of virulence genes as well as MLVA types. MLVA can offer valuable data in epidemiological study of S. sonnei outbreaks. However, study of a larger sample size from different geographical locations can be beneficial for further and more accurate assessments. Competing interests The authors declare that they have no competing interests. Acknowledgment This study was supported by a grant (M/T 93-02-30-24648) from Iran University of Medical Sciences, Tehran, Iran. References [1] R. Ranjbar, M.M. Soltan Dallal, M. Talebi, M.R. Pourshafie, Increased isolation and characterization of Shigella sonnei obtained from hospitalized children in Tehran, Iran, J. Health.Popul. Nutr. 26 (2008) 426e430.
73
[2] S.K. Niyogi, Shigellosis, J. Microbiol. 43 (2005) 133e143. [3] Y.W. Wang, H. Watanabe, D.C. Phung, S.K. Tung, Y.S. Lee, J. Terajima, et al., Multilocus variable-number tandem repeat analysis for molecular typing and phylogenetic analysis of Shigella flexneri, BMC Microbiol. 9 (2009) 278. [4] S. Li, J. Wang, X. Wei, Y. Liu, L. You, X. Luo, et al., Molecular characterization of Shigella sonnei: an increasingly prevalent etiologic agent of shigellosis in guizhou province, southwest of China, PloS One 11 (2016) e0156020. [5] M. Tajbakhsh, L. Garcia Migura, M. Rahbar, C.A. Svendsen, M. Mohammadzadeh, M.R. Zali, et al., Antimicrobial-resistant Shigella infections from Iran: an overlooked problem? J. Antimicrob. Chemother. 67 (2012) 1128e1133. [6] L.Y. Ye, F.H. Lan, Z.Y. Zhu, X.M. Chen, X.L. Ye, Detection of Shigella and enteroinvasive Escherichia coli using polymerase chain reaction, J. Diarrhoeal Dis. Res. 11 (1993) 38e40. [7] G. Frankel, J.A. Giron, J. Valmassoi, G.K. Schoolnik, Multi-gene amplification: simultaneous detection of three virulence genes in diarrhoeal stool, Mol. Microbiol. 3 (1989) 1729e1734. [8] K.L. Thong, S.L. Hoe, S.D. Puthucheary, R. Yasin, Detection of virulence genes in Malaysian Shigella species by multiplex PCR assay, BMC Infect. Dis. 5 (2005) 8. [9] S. Roy, K. Thanasekaran, A.R. Dutta Roy, S.C. Sehgal, Distribution of Shigella enterotoxin genes and secreted autotransporter toxin gene among diverse species and serotypes of shigella isolated from Andaman Islands, India, Trop. Med. Int. Health 11 (2006) 1694e1698. [10] C.S. Chiou, H. Watanabe, Y.W. Wang, W.L. Wang, J. Terajima, K.L. Thong, et al., Utility of multilocus variable-number tandem-repeat analysis as a molecular tool for phylogenetic analysis of Shigella sonnei, J. Clin. Microbiol. 47 (2009) 1149e1154. [11] S.Y. Liang, H. Watanabe, J. Terajima, C.C. Li, J.C. Liao, S.K. Tung, et al., Multilocus variable-number tandem-repeat analysis for molecular typing of Shigella sonnei, J. Clin. Microbiol. 45 (2007) 3574e3580. [12] B.A. Lindstedt, M. Torpdahl, G. Vergnaud, S. Le Hello, F.X. Weill, E. Tietze, et al., Use of multilocus variable-number tandem repeat analysis (MLVA) in eight European countries, 2012, Euro. Surveill. 18 (2013) 20385. [13] B.A. Lindstedt, T. Vardund, L. Aas, G. Kapperud, Multiple-locus variablenumber tandem-repeats analysis of Salmonella enterica subsp. enterica serovar Typhimurium using PCR multiplexing and multicolor capillary electrophoresis, J. Microbiol. Methods 59 (2004) 163e172. [14] D. Sobral, P. Mariani-Kurkdjian, E. Bingen, H. Vu-Thien, K. Hormigos, B. Lebeau, et al., A new highly discriminatory multiplex capillary-based MLVA assay as a tool for the epidemiological survey of Pseudomonas aeruginosa in cystic fibrosis patients, Eur. J. Clin. Microbiol. Infect. Dis. 31 (2012) 2247e2256. [15] C.S. Chiou, H. Izumiya, K.L. Thong, J.T. Larsson, S.Y. Liang, J. Kim, et al., A simple approach to obtain comparable Shigella sonnei MLVA results across laboratories, Int. J. Med. Microbiol. 303 (2013) 678e684. [16] W.C. Winn, E.W. Koneman, Koneman's Color Atlas and Textbook of Diagnostic Microbiology, the Enterobacteriaceae, Lippincott Williams & Wilkins, 2006, pp. 249e250. [17] M. Radhika, M. Saugata, H.S. Murali, H.V. Batra, A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species, Braz. J. Microbiol. 45 (2014) 667e676. [18] R. Ranjbar, M. Memariani, Multilocus variable-number tandem-repeat analysis for genotyping of Shigella sonnei strains isolated from pediatric patients, Gastroenterol Hepatol. Bed Bench 8 (2015) 225e232. [19] S.S. Ojha, C.Y. Yean, A. Ismail, K.K.B. Singh, A pentaplex PCR assay for the detection and differentiation of Shigella species, Biomed. Res. Int. 2013 (2013) 1e9. [20] M.A. Sousa, E.N. Mendes, G.B. Collares, L.A. Peret-Filho, F.J. Penna, P.P. Magalhaes, Shigella in Brazilian children with acute diarrhoea: prevalence, antimicrobial resistance and virulence genes, Mem. Inst. Oswaldo Cruz 108 (2013) 30e35. [21] H. Hosseini Nave, S. Mansouri, M. Emaneini, M. Moradi, Distribution of genes encoding virulence factors and molecular analysis of Shigella spp. isolated from patients with diarrhea in Kerman, Iran, Microb. Pathog. 92 (2016) 68e71. [22] S. Farshad, R. Sheikhi, A. Japoni, E. Basiri, A. Alborzi, Characterization of Shigella strains in Iran by plasmid profile analysis and PCR amplification of ipa genes, J. Clin. Microbiol. 44 (2006) 2879e2883. [23] J. Zhang, L. Qian, Y. Wu, X. Cai, X. Li, X. Cheng, et al., Deletion of pic results in decreased virulence for a clinical isolate of Shigella flexneri 2a from China, BMC Microbiol. 13 (2013) 31. [24] M. Vargas, J. Gascon, M.T. Jimenez De Anta, J. Vila, Prevalence of Shigella enterotoxins 1 and 2 among Shigella strains isolated from patients with traveler's diarrhea, J. Clin. Microbiol. 37 (1999) 3608e3611. [25] C.L. Zhang, Q.Z. Liu, J. Wang, X. Chu, L.M. Shen, Y.Y. Guo, Epidemic and virulence characteristic of Shigella spp. with extended-spectrum cephalosporin resistance in Xiaoshan District, Hangzhou, China, BMC Infect. Dis. 14 (2014) 260. [26] F.R. Noriega, F.M. Liao, S.B. Formal, A. Fasano, M.M. Levine, Prevalence of Shigella enterotoxin 1 among Shigella clinical isolates of diverse serotypes, J. Infect. Dis. 172 (1995) 1408e1410.