Mutational analysis of the angiotensin II type 2 receptor: contribution of conserved extracellular amino acids

Regulatory Peptides 72 (1997) 97–103

Mutational analysis of the angiotensin II type 2 receptor: contribution of conserved extracellular amino acids a

b

c

Jennifer N. Heerding , Daniel K. Yee , Stacy L. Jacobs , Steven J. Fluharty

a,b,d,

*

a

b

Department of Pharmacology, School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA Department of Animal Biology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA c Biological Basis of Behavior Program, University of Pennsylvania, Philadelphia, PA 19104, USA d Institute of Neurological Sciences, School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA Received 30 June 1997; received in revised form 8 August 1997; accepted 11 August 1997

Abstract While much work has been done examining the ligand-binding characteristics of the AT 1 receptor, very little attention has been focused on the AT 2 receptor. Both receptors bind angiotensin II (AngII) with identical affinities, but share only 34% homology. Although it is tempting to assume that conserved residues between the two subtypes are responsible for the binding of AngII, there is little data to support this view. To determine the commonalities in ligand binding of the AT 1 and AT 2 receptors, we have chosen several conserved extracellular amino acids which have been shown to be important in AngII binding [1,2] to the AT 1 receptor for mutational studies of the AT 2 receptor. Specifically, we have mutated tyrosine 108 in extracellular loop 1 (ECL1), arginine 182 in ECL2, and aspartate 297 in ECL3 of the AT 2 receptor in order to determine their contribution to AngII binding. In the AT 2 receptor, mutation of tyrosine 108 to an alanine resulted in a receptor with wild-type binding for AngII, while mutation of either arginine 182 or aspartate 297 drastically impaired AngII binding ( . 100 nM). These results demonstrate both similarities as well as clear differences between receptor subtypes in the contributions to AngII binding of several conserved extracellular amino acid residues.  1997 Elsevier Science B.V. Keywords: Angiotensin; Ligand binding; Site-directed mutagenesis

1. Introduction Angiotensin II is an octapeptide hormone involved in body fluid homeostasis which exerts its numerous physiological effects by binding to cell surface receptors [3]. Two main subtypes of AngII receptor have been identified, AT 1 and AT 2 . While both subtypes bind AngII with identical affinities (3–4 nM), they may be distinguished by highaffinity binding of subtype-selective ligands such as losartan (AT 1 ) and PD 122319 (AT 2 ). The AT 1 receptor was cloned initially from bovine glomerulose cells and rat vascular smooth muscle [4,5], and has subsequently been isolated from other mammalian [6–8] and nonmammalian species [9,10]. The cDNAs encode a 359-amino acid *Corresponding author. Tel.: 1 1 215 898 9148; fax: 1 1 215 898 0899. 0167-0115 / 97 / $17.00  1997 Elsevier Science B.V. All rights reserved. PII S0167-0115( 97 )01042-2

protein that corresponds to the seven-transmembrane motif of a G protein-coupled receptor (GPCR). In addition, other isoforms of the AT 1 receptor have been cloned which have slightly modified structural properties [6,11,12]. The AT 1 receptor exhibits high affinity for both AngII and the nonpeptidic subtype-selective antagonist losartan, but not AT 2 -specific ligands. The AT 2 receptor has been cloned from a rat fetal cDNA library, PC12W cells [13,14], and from mouse [15,16]. These cDNAs encode a 363-amino acid protein that also conforms to the predicted seven-transmembrane structure of a GPCR. Expression of the cloned AT 2 receptor yields a protein with high affinity for AngII and the peptidic and nonpeptidic subtype-selective ligands CGP42112A and PD122319. It is surprising that the AT 1 and AT 2 receptors have similar affinities for AngII as they share only 34%

98

J.N. Heerding et al. / Regulatory Peptides 72 (1997) 97 – 103

homology, with the highest levels of homology occurring within the transmembrane domains (Fig. 1a). Mutational analysis of several GPCRs with peptidic ligands [17–21], including the AT 1 receptor [22], has shown that unlike nonpeptidic ligands which bind deep within the transmembrane domains [9,10,23], peptidic ligands are larger and contact residues closer to the extracellular surface of the receptors. Since there are few residues in the extracellular domains which are conserved between the AT 1 and AT 2 receptors, one might expect that those residues would

be involved in AngII binding for both subtypes. However, of the amino acids found in the AT 1 receptor to be important in AngII binding, only a very few are conserved in the AT 2 subtype. While much work has centered on mutational analysis of the AT 1 receptor, almost nothing is known about the structural features necessary for highaffinity ligand binding to the AT 2 receptor. In order to determine the amino acid residues involved in AT 1 ligand binding, several groups have identified residues conserved among various isoforms of AT 1 receptors and employed

Fig. 1. Schematic diagram of the angiotensin II type 2 receptor. (a) Amino acids conserved in the AT 1 receptor are indicated by darkened circles; (b) Residues subjected to mutational analysis are highlighted.

J.N. Heerding et al. / Regulatory Peptides 72 (1997) 97 – 103

mutagenesis techniques to determine their contribution to ligand binding [1,2]. We have extended this approach to the AT 2 receptor by identifying conserved extracellular residues shown to be important for AngII binding to the AT 1 receptor and subsequently mutating these residues to determine their involvement in ligand binding for the AT 2 receptor. Specifically, we have chosen three residues for mutation to alanine in the AT 2 receptor: tyrosine 108 , in ECL1, arginine 182 , in ECL2, and aspartate 297 , in ECL3 (Fig. 1b).

99

Following purification using GeneClean II (Bio 101), the two fragments were combined in the overlap extension reaction using the same PCR conditions as described above. Following production of the full-length mutant receptor using SOE, the mutant receptors were subcloned into the expression vector, PCR3 (Invitrogen). After complete dideoxynucleotide sequencing [29] of the mutant construct using Sequenase (US Biochemicals, following the manufacturer’s protocol), wild-type and mutant AT 2 receptor cDNAs were later introduced into COS-1 cells using lipofectamine from Gibco-BRL, following the manufacturer’s protocol.

2. Methods

2.3. Cell culture techniques 2.1. Materials Monoiodinated 125 I-AngII was obtained from NEN / Dupont (Boston, MA, USA). Unlabeled AngII and related peptides, Hepes, aprotinin, 1,10-o-phenanthroline, and polyethylenimine (PEI) were from Sigma Chemical Co. (St. Louis, MO, USA). All other chemicals and reagents were purchased from Fisher Scientific (Pittsburgh, PA, USA) and were of the highest obtainable grade.

2.2. Mutagenesis techniques Substitutions of tyrosine 108 , arginine 182 , and aspartate 297 to alanine in the AT 2 receptor were achieved by a modified version of the splicing by overlap extension (SOE) technique [24–26]. This procedure involved two steps: generation of individual fragments followed by splicing of the fragments using the polymerase chain reaction (PCR). As a refinement to enhance the fidelity of SOE, a small amount of Pfu DNA polymerase (1:100 Pfu:Taq) was added in our PCRs. Briefly, the two fragments were first amplified by PCR using specially designed complementary and overlapping primers that introduced the desired mutation. The two fragments were then used along with distal primers in a PCR reaction to produce the final product. The following primers were used. AT 2 Y108A: 59-CTCTTATAGAGCTGATTGGCTTTTTGGACCTGTG (forward sense primer); 59-GCCAATCAGCTCTATAAGAGTAATAGGTTGCCC (reverse antisense primer). AT 2 R182A: 59GCCAACATTTTATTTCGCGGATGTCAGAACC (forward sense primer); 59-GGTTCTGACATCCGCGAAATAAAATGTTGGC (reverse antisense primer). AT 2 D297A: 59-GCAGTCATTGCCCTGGCACTTCCTTTTGCC (forward sense primer); 59-GTGCCAGGGCAATGACTGCTATAACTTCAC (reverse antisense primer). Fragment 1 was generated using the primer T7 and the forward sense primer, while fragment 2 was generated using the reverse antisense primer and SP6. Wild-type AT 2 cDNA, which we have previously isolated from the murine neuroblastoma N1E-115 cell line [27,28], served as the template in these PCRs. Reaction conditions were 25 cycles of 948C (1 min), 558C (1 min), and 728C (1 min).

COS-1 cells were grown on T150 plastic plates in DMEM (high glucose) supplemented with 10% fetal calf serum and 2 mM glutamine, 50 U / ml penicillin, and 50 m g / ml streptomycin in a humidified atmosphere of 5% CO 2 and 95% O 2 at 378C.

2.4. Cell membrane preparation Two days after transfection, cell membranes were prepared from the COS-1 cells as previously described [30]. Briefly, medium was removed from culture dishes, and cells were rinsed three times in ice-cold 20 mM Tris–HCl (pH 7.4) and 150 mM NaCl. Cells were then incubated for 10–15 min at 48C in 20 mM Tris–HCl (pH 7.4), removed with a rubber policeman, and homogenized with a Dounce homogenizer. Following centrifugation at 48 000 3 g for 20 min, the membrane pellet was washed once in assay buffer, a solution of 50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 5 mM MgCl 2 , 0.2% heat-inactivated BSA, 0.3 TIU / ml aprotinin, and 100 m g / ml 1,10-phenanthroline. Following a second centrifugation at 48 000 3 g for 20 min, the final membrane pellet was resuspended in assay buffer at a protein concentration of 1 mg / ml as determined by the BCA protein assay (Pierce).

2.5. Radioligand binding assays Radioligand binding assays were performed as described previously [30]. In brief, the binding assays were initiated by the addition of 100 m l of membrane protein (100 m g) to 150 m l of assay buffer containing various concentrations of radioligand ( 125 I-AngII) and unlabelled AT 2 receptor agonists and antagonists. Saturation isotherms used at least six concentrations of 125 I-AngII, ranging from 0.2 to 6.0 nM. The incubations continued for 60 min at 258C and were terminated by rapid dilution with 5 mM Tris–HCl (pH 7.4), 150 mM NaCl, and vacuum filtration on glassfiber filters presoaked with 0.3% PEI. The glass fiber filters were then counted in an LKB gamma counter (counting efficiency of 65%). Specific binding was defined by 1 m M of either AngII, PD123319 or CGP42112A.

J.N. Heerding et al. / Regulatory Peptides 72 (1997) 97 – 103

100

3. Results

3.1. Mutation of tyrosine 108 to alanine Sequence analysis of the isoforms of AT 1 receptors reveals a number of residues which are conserved. It has been hypothesized that the conserved residues among the receptors contribute to AngII binding. Mutational analysis of the contributions of various residues has been reported for the AT 1 receptor [1,2,31–36], but no such work has been reported on the AT 2 receptor. We have constructed and analyzed several AT 2 receptor point mutations to further understand the interaction between the receptor and its ligand upon binding. Prior analysis has shown that mutation of tyrosine 92 in the first extracellular loop of the AT 1 receptor to an alanine yielded a receptor markedly impaired with respect to ligand binding, decreasing affinity for AngII by . 3000-fold [1], while maintaining high affinity for nonpeptide ligand binding. We have produced the analogous mutation of tyrosine to alanine in the AT 2 receptor, AT 2 Y108A. Saturation isotherm binding of the mutant demonstrated an 11 nM affinity for 125 I-AngII (Table 1), indicating very little contribution of this residue to AngII binding in the AT 2 receptor. In addition, the mutated receptor retained wild-type affinities for the peptide and nonpeptide subtype-selective ligands, CGP42112A and PD123319 (Fig. 2). Thus, our results are strikingly different from the AT 1 mutant and demonstrate a clear difference between AT 1 and AT 2 in the interaction of AngII with the conserved tyrosine in ECL1.

3.2. Mutation of arginine 167 to alanine Molecular modeling of the AT 1 receptor based on the b -adrenergic receptor has provided clues as to the mechanism for AngII binding [2,37]. Based on this work, Yamano and colleagues [31] have suggested that arginine 167 interacts with tyrosine 4 of AngII. Tyrosine 4 has been shown to be crucial for ligand binding [38,39], and

Table 1 Binding affinity (nM) of angiotensin II and peptide and nonpeptide antagonists for wild-type and mutated angiotensin II type 2 receptors Receptor

Kd AngII

Ki CGP42112A

Ki PD123319

AT 2 wild type AT 2 Y108A AT 2 R182A AT 2 D297A

5.261.2 (n 5 3) 11.062.0 (n 5 4) . 100 nM (n 5 4) . 100 nM (n 5 4)

2.060.2 (n 5 3) 1.560.3 (n 5 3)

8.062.7 (n 5 6) 4.662.1 (n 5 3)

Radioligand binding was measured as described in Section 2 with 100 m g mutant or 40 m g wild-type membrane protein and 125 I-AngII (ranging from 0.2 to 6 nM). Nonspecific binding was determined in the presence of 1 m M unlabelled AngII. Data is presented as nM6standard error.

Fig. 2. Competition curves for the binding of CGP42112A and PD123319 to AT 2 Y108A. Binding of 125 I-AngII to cell membranes was determined in the presence of increasing concentrations of peptide (CGP42112A) and nonpeptide (PD123319) antagonists as described in Section 2.

therefore one would expect any perturbation of its normal interaction with the receptor to impair AngII binding. Consistent with this, Yamano et al. have shown that mutation of arginine 167 in the AT 1 receptor drastically reduces binding of both peptidic and nonpeptidic ligands [2]. In order to determine the potential use of this conserved residue by the AT 2 receptor in binding AngII, we mutated the analogous aspartate in ECL2 of the AT 2 receptor to an alanine. Radioligand binding analysis of AT 2 R182A demonstrated that, while the mutated receptor was able to bind AngII in a specific manner, the affinity had been dramatically decreased to . 100 nM (Fig. 3b). Our results are consistent with AT 1 R167A and in support of the model suggesting an interaction between the conserved arginine in ECL2 and tyrosine 4 of AngII.

3.3. Mutation of aspartate 281 to alanine The role of aspartate 281 in extracellular loop 3 has also been investigated in the AT 1 receptor. Feng and colleagues have reported that an ionic bridge is formed between this aspartate and arginine 2 of AngII [32]. This aspartate is conserved among AT 1 receptor isoforms, and is also found in the AT 2 receptor at position 297. Mutation of aspartate 281 in the AT 1 receptor to an alanine resulted in a 17-fold decrease in affinity of the receptor for AngII [1]. We constructed the analogous mutation in the AT 2 receptor, changing AT 2 D297 to an alanine. Binding of AngII to the mutated receptor was drastically decreased to . 100 nM, although specific binding was maintained (Fig. 3c). These data indicate that the conserved aspartate in ECL3 of the AT 2 receptor is importantly involved in ligand binding. In fact, substitution of aspartate 297 in the AT 2 receptor is more detrimental to AngII binding than substitution of AT 1 D281.

J.N. Heerding et al. / Regulatory Peptides 72 (1997) 97 – 103

Fig. 3. Comparison of 125 I-AngII binding between AT 2 wild-type and AT 2 R182A and AT 2 D297A mutants. Radioligand binding was measured as described in Section 2 with 100 m g membrane protein with 125 I-AngII (ranging from 0.3 to 6 nM). Nonspecific binding was determined in the presence of 1 m M unlabelled AngII. Representative saturation isotherms are depicted for (a) AT 2 wild type (n 5 3); (b) AT 2 R182A (n 5 4); (c) AT 2 D297A (n 5 4).

4. Discussion AngII is a large peptidic ligand which presumably has many points of contact with its receptor in the bound state.

101

In fact, many individual mutations have been shown to impair AngII binding to the AT 1 receptor [1,2,31–36]. However, it is also known that certain portions of AngII are more important for high-affinity ligand binding, such as tyrosine 4 [38,39]. The ability of a single amino acid substitution in the receptor to have a dramatic effect on the affinity for its ligand is striking. It is possible that a few important points of contact may be most important for high-affinity ligand binding and that, within the binding pocket of AngII, other residues may contribute to a lesser degree. Contact with these residues may affect the binding of AngII and its related compounds in a small way compared to the interaction with a few crucial residues. The results of AT 1 Y92A and AT 2 Y108A suggest that while tyrosine 92 is a crucial point of AngII contact in the AT 1 receptor, tyrosine 108 plays a lesser role in the AT 2 receptor, interacting with AngII in a more indirect manner. Conversely, mutation of aspartate 281 in the AT 1 receptor may play a secondary role in AngII binding, while in the AT 2 receptor it is an critical residue for ligand binding. Finally, we have shown that AT 2 arginine 182 plays an important role in AngII binding as in the AT 1 receptor, perhaps through an interaction with tyrosine 4 of AngII. Taken together, our data indicate that while there are some similarities between the two subtypes in their binding of AngII, there are also clear differences in the relative contributions of conserved residues. This suggests that although there are a number of residues which are conserved in the extracellular domains of the AT 1 and AT 2 receptors, not all of those which are important in AT 1 AngII binding may be contributing to a similar extent in AngII binding to the AT 2 receptor. These differences, along with the large number of nonconserved residues, may additionally contribute to the binding of subtype selective ligands. This and other work from our laboratory on the contribution of the N-terminus to AngII binding [40] support the hypothesis that AngII binds in a similar orientation in both the AT 1 and AT 2 receptors. However, this work suggests that, within each binding pocket, the receptor subtypes have evolved divergent mechanisms for maintaining high affinity for AngII. It has been argued that the relatively low level of homology between the receptors implies that the two subtypes are vastly dissimilar, especially since of the several key residues in the AT 1 receptor shown to be important for AngII binding, only a few are conserved in the AT 2 receptor. Our work demonstrates that these few conserved residues do indeed play a role in AngII binding in the AT 2 receptor, although to differing degrees compared to the AT 1 receptor. This work suggests that, despite the relatively low level of homology between the two subtypes, some essential commonalities of AngII binding exist, while additional divergent mechanisms within each subtype have developed to complement the basic AngII binding mechanism. Additional experiments from this

102

J.N. Heerding et al. / Regulatory Peptides 72 (1997) 97 – 103

laboratory on the contribution of the amino terminus, a region which is quite dissimilar between the AT 1 and AT 2 receptors, suggests that the two amino termini may compensate for one another in chimeric swaps between the receptors. Thus, our work supports the suggestion that AngII binds in a similar orientation in both the AT 1 and AT 2 receptors. Our data also suggests that, within each binding pocket, the receptor subtypes have evolved divergent mechanisms for maintaining high affinity for AngII.

[13]

[14]

[15]

[16]

Acknowledgements

[17]

This work was supported by the American Heart Association (National and SE Pennsylvania affiliates) and NIH grant MH43787. [18]

References [1] Hjorth SA, Schambye HT, Greenlee WJ, Schwartz TW. Identification of peptide binding residues in the extracellular domains of the AT 1 receptor. J Biol Chem 1994;269:30953–9. [2] Yamano Y, Ohyama K, Kikyo M, Sano T, Nakagomi Y, Inoue Y, Nakamura N, Morishima I, Guo D-F, Hamakubo T, Inagami T. Mutagenesis and the molecular modeling of the rat angiotensin II receptor (AT 1 ). J Biol Chem 1995;270:14024–30. [3] Peach MJ. Renin-angiotensin system: Biochemistry and mechanism of action. Physiol Rev 1977;57:313–70. [4] Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE. Isolation of a cDNA encoding the vascular type-1 angiotensin receptor. Nature 1991;351:233–6. [5] Sasaki K, Yamano Y, Bardhan S, Iwai N, Murray JJ, Hasegawa M, Matsuda Y, Inagami T. Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature 1991;351:230–3. [6] Sandberg K, Ji H, Clark AJL, Shapira H, Catt KJ. Cloning and expression of a novel angiotensin II receptor subtype. J Biol Chem 1992;267:9455–8. [7] Sasamura H, Hein L, Krieger JE, Pratt RE, Kobilka BK, Dzau VJ. Cloning, characterization, and expression of two angiotensin receptor (AT 1 ) isoforms from the mouse genome. Biochem Biophys Res Commun 1992;185:253–9. [8] Konishi H, Kuroda S, Inada Y, Fujisawa Y. Novel subtype of human angiotensin II type 1 receptor: Analysis of signal transduction mechanism in transfected Chinese hamster ovary cells. Biochem Biophys Res Commun 1994;199:467–74. [9] Ji H, Sandberg K, Zhang Y, Catt KJ. Molecular cloning, sequencing and functional expression of an amphibian angiotensin II receptor. Biochem Biophys Res Commun 1993;194:756–62. [10] Bersgma DJ, Ellis C, Nuthulaganti PR, Nambe P, Scaife K, Kumar C, Aiyar N. Isolation and expression of a novel angiotensin II receptor from Xenopus laevis heart. Mol Pharmacol 1993;44:277– 84. [11] Kakar SS, Sellers JC, Devor DC, Musgrove LC, Neill JD. Angiotensin II type-1 receptor subtype cDNAs: Differential tissue expression and hormonal regulation. Biochem Biophys Res Commun 1992;183:1090–6. [12] Kambayashi Y, Bardhan S, Takahashi K, Tsuzuki S, Inui H, Hamakubo T, Inagami T. Molecular cloning of a novel angiotensin

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26] [27]

[28]

[29] [30]

[31]

[32]

II receptor isoform involved in phosphotyrosine phosphatase inhibition. J Biol Chem 1993;268:24543–6. Mauzy CA, Hwang O, Egloff AM, Wu L-H, Chung F-Z. Cloning, expression, and characterization of a gene encoding the human angiotensin II type 1a receptor. Biochem Biophys Res Commun 1992;186:277–84. Mukoyama M, Nakajima M, Horiuchi M, Sasamura H, Pratt RE, Dzau VJ. Expression cloning of type 2 angiotensin receptor reveals a unique class of seven-transmembrane receptors. J Biol Chem 1993;268:24539–42. Nakajima M, Mukoyama M, Pratt RE, Horiuchi M, Dzau VJ. Cloning of cDNA and analysis of the gene for mouse angiotensin-II type-2 receptor. Biochem Biophys Res Commun 1994;197:393–9. Ichiki T, Herold CL, Kambayashi Y, Bardhan S, Inagami T. Cloning of the cDNA and the genomic DNA of the mouse angiotensin II type 2 receptor. Biochim Biophys Acta 1994;1189:247–50. Schambye HT, Wijk BV, Hjorth SA, Wienen W, Entzeroth M, Bergsma DJ, Schwartz TW. Mutations in transmembrane segment VII of the AT 1 receptor differentiate between closely related insurmountable and competitve angiotensin antagonists. Br J Pharmacol 1994;113:331–3. Ohyama K, Yamano Y, Chaki S, Kondo T, Inagami T. Domains for G-protein coupleing in angiotensin II receptor type I: Studies by site-directed mutagenesis. Biochem Biophys Res Commun 1992;189:677–83. Balmforth AJ, Lee AJ, Bajaj BPS, Dichinson CJ, Warburton P, Ball SG. Functional domain sof the C-terminus of the rat angiotensin AT 1A receptor. Eur J Pharmacol 1995;291:135–41. Wang CL, Jayadev S, Escobedo JA. Identification of a domain of the angiotensin-II type-1 receptor determining Gq coupling by the use of receptor chimeras. J Biol Chem 1995;270:16677–82. Bihoreau C, Monnot C, Davies E, Teutsch B, Bernstein KE, Corvol P, Clauser E. Mutation of Asp 74 of the rat angiotensin II receptor confers changes in antagonist affinities and abolishes G-protein coupling. Proc Natl Acad Sci USA 1993;90:5133–7. Itazaki K, Shigeri Y, Fujimoto M. Molecular cloning and characterization of the angiotensin receptor subtype in porcine aortic smooth muscle. Eur J Pharmacol Mol Pharmacol 1993;245:147–56. Burns L, Clark KL, Bradlet J, Robertson MJ, Clark AJL. Molecular cloning of the canine angiotensin II receptor: An AT 1 -like receptor with reduced affinity for DuP753. FEBS Lett 1994;343:146–50. Horton RM, Hunt GD, Ho SN, Pullen JK, Pease LR. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 1989;77:61–8. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989;77:51–9. Horton RM, Ho SN, Pullen JK, Hunt HD, Cai Z, Pease LR. Gene splicing by overlap extension. Methods Enzymol 1993;217:270–9. Yee DK, He P, Yang X-D, Reagan LP, Hines J, Siemens IR, Fluharty SJ. Cloning and expression of angiotensin II type 2 (AT 2 ) receptor from murine neuroblastoma N1E-115 cells: Evidence for AT 2 receptor heterogeneity. Mol Brain Res 1997;45:108–16. He PF, Yang X-D, Guo YF, Reagan LP, Yee DK, Fluharty SJ. Molecular cloning and expression of an angiotensin II type 1 receptor from murine neuroblastoma N1E-115 cells. Soc Neurosci Abstr 1994;20:220.10. Sanger FA. A simplified method for sequencing DNA. Proc Natl Acad Sci USA 1977;74:5463–7. Fluharty SJ, Reagan LP. Characterization of binding sites for the angiotensin II antagonist 125 I-[Sarc1,Ile8]-angiotensin II on murine neuroblastoma N1E115 cells. J Neurochem 1989;52:1393–400. Yamano Y, Ohyama K, Chaki S, Guo D-F, Inagami T. Identificatino of amino acid resiudes of rat angiotensin II receptor for ligand binding by site directed mutagenesis. Biochem Biophys Res Commun 1992;187:1426–31. Feng Y-H, Noda K, Saad Y, Liu X, Husain A, Karnik SS. The

J.N. Heerding et al. / Regulatory Peptides 72 (1997) 97 – 103

[33]

[34] [35]

[36]

docking of Arg 2 of angiotesin II with Asp 281 of AT 1 receptor is essential for full agonism. J Biol Chem 1995;270:12846–50. Groblewski T, Maigret B, Nouet S, Larguier R, Lombard C, Bonnafous J-C, Marie J. Amino acids of the third transmembrane domain of the AT 1A angiotensin II receptor are involved in the differential recognition of peptide and nonpeptide ligands. Biochem Biophys Res Commun 1995;209:153–60. Hunyady L, Balla T, Catt KJ. The ligand binding site of the angiotensin AT 1 receptor. Trends Pharmacol Sci 1996;17:135–40. Ji H, Leung M, Zhang Y, Catt KJ, Sandberg K. Differential structural requirements for specific binding of nonpeptide and peptide antagonists to the AT 1 angiotensin receptor: Identification of amino acid residues that determine binding of the antihypertensive drug Losartan. J Biol Chem 1994;269:16533–6. Schambye HT, Hjorth SA, Bergsma DJ, Sather G, Schwartz TW.

[37]

[38]

[39]

[40]

103

Differentiation between binding sites for angiotensin II and nonpeptide antagonists on the angiotensin II type 1 receptors. Proc Natl Acad Sci USA 1994;91:7046–50. Joseph MP, Maigret B, Bonnafous JC, Marie J, Scheraga HA. A computer modeling postulated mechanism for angiotensin-II receptor activation. J Protein Chem 1995;14:381–98. Khosla MC, Hall MM, Smeby RR, Bumpus FM. Factors that influence the antagonistic properties of angiotensin II antagonists. J Med Chem 1973;16:829–32. Khosla MC, Leese RA, Maloy WL, Ferreira AT, Smeby RR, Bumpus FM. Synthesis of some analogs of angiotensin II as specific antagonists of the parent hormone. J Med Chem 1972;15:792–5. Yee DK, Heerding JN, Krichavsky MZ, Fluharty SJ. The role of the amino terminus in ligand binding for the angiotensin receptor family. Soc Neurosci Abstr 1996;22:516.14.