- Email: [email protected]
Mylodon darwinii DNA sequences from ancient fecal hair shafts
Annals of Anatomy 194 (2012) 26–30
Contents lists available at ScienceDirect
Annals of Anatomy journal homepage: www.elsevier.de/aanat
Mylodon darwinii DNA sequences from ancient fecal hair shafts Andrew A. Clack a,∗ , Ross D.E. MacPhee d , Hendrik N. Poinar a,b,c a
McMaster Ancient DNA Center, McMaster University, 1280 Main Street West, Hamilton, ON L8S 4L9, Canada Department of Anthropology, McMaster University, 1280 Main Street West, Hamilton, ON L8S 4L9, Canada c Department of Pathology and Molecular Medicine, McMaster University, 1280 Main Street West, Hamilton, ON L8S 4L9, Canada d American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024, United States b
a r t i c l e
i n f o
Article history: Received 16 February 2011 Received in revised form 4 May 2011 Accepted 5 May 2011
Keywords: Ancient DNA Coprolites Fecal hair Mylodon darwinii
s u m m a r y Preserved hair has been increasingly used as an ancient DNA source in high throughput sequencing endeavors, and it may actually offer several advantages compared to more traditional ancient DNA substrates like bone. However, cold environments have yielded the most informative ancient hair specimens, while its preservation, and thus utility, in temperate regions is not well documented. Coprolites could represent a previously underutilized preservation substrate for hairs, which, if present therein, represent macroscopic packages of specific cells that are relatively simple to separate, clean and process. In this pilot study, we report amplicons 147–152 base pairs in length (w/primers) from hair shafts preserved in a south Chilean coprolite attributed to Darwin’s extinct ground sloth, Mylodon darwinii. Our results suggest that hairs preserved in coprolites from temperate cave environments can serve as an effective source of ancient DNA. This bodes well for potential molecular-based population and phylogeographic studies on sloths, several species of which have been understudied despite leaving numerous coprolites in caves across of the Americas. © 2011 Published by Elsevier GmbH.
1. Introduction Ancient hair tissue has proven to be an exceptional source of mitochondrial (mt) DNA (Gilbert et al., 2004, 2008a,b), and in addition to complete mitogenomes, significant amounts of nuclear DNA have been generated for the woolly mammoth (Mammuthus primigenius) and a Palaeo-Eskimo from Greenland, using permafrost-preserved ancient hair shafts (Miller et al., 2008; Rasmussen et al., 2010). Preserved ancient fecal matter, or coprolites, can also be a rich source of molecular data (Poinar et al., 1998, 2001, 2003; Hofreiter et al., 2003), and particularly notable ancient DNA (aDNA) sequence has been retrieved from coprolites preserved in desert caves and rodent burrows (Küch et al., 2002; Poinar et al., 2003), where characteristically dry conditions are thought to be conducive to the molecule’s long term survival (Lindahl, 1993). Hair shafts are an intriguing constituent of some modern feces and coprolites (Zhang et al., 2009; Backwell et al., 2009). The fact that many mammals orally groom themselves, their offspring, and conspecifics using the tongue and teeth, makes it unsurprising that hair is often ingested. Carnivores may also intake large amounts of
∗ Corresponding author. Current address: Department of Biology, Pennsylvania State University, 326 Mueller Laboratory, University Park, PA 16802, United States. Tel.: +1 412 334 6599. E-mail address: [email protected] (A.A. Clack). 0940-9602/$ – see front matter © 2011 Published by Elsevier GmbH. doi:10.1016/j.aanat.2011.05.001
hair from mammalian prey items. Consumed hair can eventually be excreted in an organism’s feces, and a keratinous casing seems to make it exceptionally durable and resilient on a macroscopic and molecular level (Gilbert et al., 2004). A recent study evaluated modern feces and fecal hairs as a source of mt and microsatellite DNA for South China tigers and found that hairs sampled from feces are actually a more reliable source of DNA than the bulk fecal matter itself (Zhang et al., 2009). Here we examine a coprolite attributed to Darwin’s ground sloth, Mylodon darwinii, a bear-sized terrestrial species that went extinct toward the end of the Pleistocene, ∼10,000 yrs ago. This taxon was examined in the seminal aDNA investigation on extinct sloths (Höss et al., 1996), which used subfossil bone extract to target portions of the mt genome for phylogenetic analysis. Specific fragments of mt sequence for this taxon are thus available to compare against other ancient specimens. A native of southern South America, M. darwinii was possibly unique among sloths in having become adapted to a grazing lifestyle (McDonald and de Iuliis, 2008). Not surprisingly, the coprolite forming the basis for this investigation is filled with processed grass fragments; in addition, it contains wiry hair shafts, which fostered curiosity (Fig. 1). Given the presumed vegetarian diet of the species, the fecal hairs are considered at least species specific to the coprolite’s producer. To investigate this, we separated and extracted hair shafts from the coprolite and tested them for mtDNA of M. darwinii, using targeted PCR and primers based on the species’ published sequence (Höss et al., 1996).
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
27
Fig. 1. Subsample of a coprolite attributed to M. darwinii, collected from Cueva del Milodón. Arrows indicate several hair shafts used in the analysis.
2. Materials and methods (adapted from Clack et al., 2011) We sampled a coprolite, attributed to M. darwinii, collected by R.D.E. MacPhee in 2001 from Cueva del Milodón in southern Chile, and stored thereafter at the American Museum of Natural History (New York, NY). The specimen is estimated to be ∼13,000 yrs old, which is in line with other specimens from this locality (Höss et al., 1996). DNA extraction took place in the fall of 2009 at the McMaster Ancient DNA Centre (Hamilton, Ontario) where modern and ancient processing facilities are geographically separated, and sterile conditions are maintained to prevent modern contamination. Using bleach and oven sterilized tweezers, six hair shafts, ∼1–2 cm in length, were removed from the coprolite (Fig. 1). The hairs were washed in sterile H2 0 three times to remove dust and debris clinging to them. Using fresh scalpel blades, the hairs were cut into equal lengths of ∼0.5 cm and placed in a
fresh 2 mL tube. We added 1.5 mL of digestion buffer (Tris–Cl (1 M stock at pH8.0; 10 mM final); sarcosy (10% stock; 0.5% final); ProK (20 mg/mL stock; 250 g/mL final); CaCl2 (2.5 M; 5 mM final); DTT (50 mM final)) to the tube and incubated it along with a blank at 55 ◦ C, with slow rotation. The hairs were digested after 10 h. We performed a phenol chloroform extraction. To the digested solution we added 500 L of PCI (phenol/chloroform/isoamyl alcohol (25:24:1)) and mixed gently for several minutes. The mixture was then centrifuged at maximum speed for 5 min, and the aqueous phase transferred to a new 2 mL tube. Those steps were repeated using 500 L of chloroform to remove residual phenol. The aqueous extract layer (∼1000 L) was concentrated. We primed Microcons 30YM with 100 L of 0.1× TE, then applied to the same cartridge the sample stepwise (500 L each time) and centrifuged to dryness. The membrane was washed three times with 300 L of 0.1× TE, and each time centrifuged to dryness. We
28
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
added 100 L of 0.1× TE in each column and put it in a new collection tube. This was shaken upward for 5 min at 1000 rpm on a Thermoblock at room temperature. The Microcon columns were then inverted and centrifuged at 1000G speed for 3 min to collect the concentrated DNA. PCR reactions were carried out in 20 L reaction volume with 1× PCR-buffer, 2.5 mM MgCl2 , 250 M of each dNTP, 300 nM of each primer, 1 unit of taq polymerase (AmpliTaq Gold; Applied Biosystems, Foster City, California), and 3 L of template. Cycling conditions were as follows: initial denaturation at 95 ◦ C for 5 , 45 cycles of denaturation 30 at 95 ◦ C, annealing 30 at 55 ◦ C, extension at 72 ◦ C for 45 and a final extension at 72 ◦ C for 10 . Amplification products were visualized under UV light on 2.5% agarose gels stained with ethidium bromide. Primers were designed by eye using the M. darwinii sequence published by Höss et al. (1996) (GenBank #s Z48943 = 12S, Z48944 = 16S): Md16SF 5 TAGGGATAACAGCGCAATCC3 ; Md16SR 5 CGTAGGACTTTAATCGTT-GA3 ; Md12SF 5 CTGGGATTAGATACCCCA-CTAT3 ; Md12SR 5 GTCGATTATAGGACAGGTTCCTCTA3 . With the primers edited out, the target fragments were 100 and 112 bp long for the 12S and 16S fragments, respectively. To ensure accuracy, each position in a given final consensus sequence was covered by three independent amplifications (Tables 1 and 2). Each PCR product was cloned using the TOPO-TA cloning kit with TOP-10 chemically competent cells (Invitrogen, Canada). Insert-carrying clones were identified via blue/white selection and amplified. Colony PCR products were purified using AcroPrep 96 Filter Plates (Pall, USA). Three to four positive clones per independent PCR were sequenced using the M13F primer on an ABI 3130, as per manufacturer’s suggestions for DNA concentration of 1 in 7 L reactions using 0.3 L of BigDye ver3.1 (Applied Biosystems, Foster City, California). We aligned 12S and 16S GeneBank sequences from living the Xenarthra (armadillo, anteater, and three- and two-toed sloth) and M. darwinii from Höss et al. (1996). To this we added the “unknown” fecal hair shaft consensus sequences, along with additional extinct sloth species’ 16S and 12S sequence isolated at the McMaster Ancient DNA Centre: Acratoncus ye, Neocnus dousman, Parocnus serus, Shasta nothrotheriops (awaiting publication). We inferred evolutionary history using the maximum likelihood method based on the Data specific model (Nei and Kumar, 2000). The tree with the highest log likelihood (−434.0290) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically as follows: when the number of common sites is <100 or less than one fourth of the total number of sites, the maximum parsimony method was used; otherwise BIONJ method with MCL distance matrix was used. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories; +G, parameter = 0.3835). The analysis involved 12 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 95 positions in the final dataset. Evolutionary analyses were conducted in MEGA4 (Tamura et al., 2007).
3. Results This pilot study set out to investigate hair preserved in a 13,000yr-old sloth coprolite as a potential source of aDNA. We obtained three independent PCR amplicons for fragments of the 12S (147 bp w/primers) and 16S (152 bp w/primers) rDNA genes, cloned the products and sequenced a total of 4 clones for each 16S PCR and 3 clones for each 12S PCR. From these aligned PCRs/clones we derived consensus sequences, both of
which differ from living sloths, while matching the sequence for M. darwinii published by Höss et al. (1996) (Tables 1 and 2). The clone sequences display 22 C to T transitions, as well as 3 G to A transitions. Most likely the result of hydrolytic deamination, sequence damage like this is expected, and regarded as confirmation of endogenous DNA age in ancient specimens (Gilbert et al., 2007); it should be addressed via repeat amplification, cloning and consensus sequences (Lindahl, 1993). One sequence in particular (Table 1, 12S PCR2 clone 2) displays 5 of the C to T transitions, 2 of the G to A transitions, 2 A to T transversions, and one apparent deletion. However, this fragment does not precisely match any known taxa accessible on NCBI, and given the nature of the damage and the geographical distance to taxa with even close sequence affinity, we do not feel it represents exogenous contaminant, merely a heavily damaged starting template, and possible PCR error. Phylogenetic maximum likelihood analysis (Fig. 2) suggests the “unknown” sequence from the coprolite hair shafts groups with sloths broadly and with M. darwinii specifically. And although support for the tree’s nodes is largely inconclusive (likely due to the limited amount of sequence data) the tree’s overall structure, along with consensus base composition, effectively identifies the “unknown” sequence as that of an M. darwinii ground sloth.
4. Discussion The relatively easy accession of M. darwinii sequences from ancient fecal hair suggests that aDNA extractions from coprolites can likely be divided and streamlined. While potentially rich troves of aDNA, coprolites are also a genetically heterogeneous set of materials, and a fecal mass can contain a diversity of processed food matter, along with the defecator’s own sloughed tissue (Poinar et al., 1998, 2001). Without initial sorting of visually identifiable constituents, a final extract is likely to be an ad hoc mixture of various sequence templates. In order to minimize potentially unwanted sequence from a bulk extract, one should perhaps attempt species-specific shotgun sequencing, it would behoove researchers to isolate and extract from hair separately. In addition, coprolite extraction protocols are arguably more complicated than those used on other aDNA sources, like bone and hair, requiring additional reagents (e.g. N-phenacylthiazolium bromide, PTB) to (theoretically) overcome sequence cross-links that can block PCR (Poinar et al., 1998, 2001; Küch et al., 2002; Hofreiter et al., 2003). Hair shafts, if present in a coprolite, represent macroscopic packages of specific cells, potentially enriched with mtDNA (Gilbert et al., 2008b), which are relatively simple to separate, clean and process. In addition, the gross structure of hair may actually limit exogenous DNA contamination (Gilbert et al., 2006), including that from a coprolite matrix. And although further investigation would be necessary to evaluate this, the relatively clear-cut manner in which hairs can be separated and cleaned of fecal debris, suggests the probability of amplifying certain contaminants can at least be decreased. This could be very important if fecal hairs are not those of the defecator, as might be the case in carnivore coprolites (Backwell et al., 2009), or if conspecific oral grooming is/was a common behavior. This investigation did not address the issue, but future studies might be able to examine potential taxonomic and intraspecific cross contamination in fecal hairs. No species of extinct ground sloth has ever been the subject of a (published) intraspecific/population level investigation, and significant sample numbers of this species have never been collectively available for such analyses. However, the amplification of M. darwinii sequence from bone and fecal hair collected at Cueva del Milodón increases the possibility that enough samples could be collected for this species, from this particular location, to do meaningful investigations on its genetic dynamics therein.
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
29
Table 1 Alignment of 3 PCRs, with 4 clones per PCR, of an mtDNA 12S fragment from M. darwinii fecal hair extract (Clack et al., 2011).
For good reason, curators are often hesitant to provide ancient source tissue for DNA extraction, as this procedure virtually always results in the destruction of at least a portion of the specimen. Coprolites may provide a slight resolution, for while they are not the most glamorous source for ancient tissue and DNA, they can be treasure troves of genetic information. Curators and collectors may be willing to subject aesthetically less pleasing coprolites and
their constituent materials to destructive sampling before bone and other tissues. However, one must appreciate that coprolites are themselves extremely rare and should always be treated with care and temperance. Our results suggest that significant portions of M. darwinii’s mt, and perhaps even nuclear genome could be generated using hairs collected from this species’ coprolites. They also point to the option
Table 2 Alignment of 3 PCRs, with 2–4 clones per PCR, of an mtDNA 16S fragment from M. darwinii fecal hair extract (Clack et al., 2011).
30
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
Fig. 2. Phylogenetic analysis of the xenarthran using maximum likelihood methods, with extinct (*) and extant sloths, anteater, armadillo, and “unknown” sequence obtained from hairs in a coprolite attributed to M. darwinii.
of using fecal hair, if available, from temperate and arid environment preserved coprolites to investigate species and population level genetics of sloths. Acknowledgements We are grateful to Ben Evans and members of the Evans Lab (Biology Dept, McMaster University) for use of space and equipment in post PCR processing of aDNA amplifications. This work was supported by NSERC and a Canada Research Chair to HNP. References Backwell, L., Pickering, R., Brothwell, D., Berger, L., Witcomb, M., Martill, D., Penkman, K., Wilson, A., 2009. Probable human hair found in a fossil hyaena coprolite from Gladysvale cave, South Africa. Journal of Archaeological Science 36, 1269–1276. Clack, A.A., MacPhee, R.D.E., Poinar, H., 2011. Extinct Sloth DNA from Ancient Fecal Hair. In: Shapiro, B., Hofreiter, M. (Eds.), Ancient DNA: Methods and Protocols. Humana Press, New York, NY (in press). Gilbert, M.T.P., Wilson, A.S., Bunce, M., Hansen, A.J., Willerslev, E., Shapiro, B., Higham, T.F.G., Richards, M.P., O’Connell, T.C., Tobin, D.J., Janaway, R.C., Cooper, A., 2004. Ancient mitochondrial DNA from hair. Current Biology 14, R463–464. Gilbert, M.T.P., Menez, L., Janaway, R.C., Tobin, D.J., Cooper, A., Wilson, A.S., 2006. Resistance of degraded hair shafts to contaminant DNA. Forensic Science International 156, 208–212. Gilbert, M.T.P., et al., 2007. Recharacterization of ancient DNA miscoding lesions: insights in the era of sequencing-by-synthesis. Nucleic Acids Research 35, 1–10. Gilbert, M.T.P., et al., 2008a. Intraspecific phylogenetic analysis of Siberian woolly mammoths using complete mitochondrial genomes. Proceedings of the National Academy of Sciences of United States of America 105, 8327–8332. Gilbert, M.T.P., et al., 2008b. Paleo-Eskimo mtDNA genome reveals matrilineal discontinuity in Greenland. Science 320, 1787–1789. Hofreiter, M., Betancourt, J.L., de Sbriller, A.P., Markgraf, V., McDonald, H.G., 2003. Phylogeny, diet and habitat of an extinct ground sloth from Cuchillo
Curá, Neuquén Province, southwest Argentina. Quaternary Research 59, 364– 378. Höss, M., Dilling, A., Currant, A., Päabo, S., 1996. Molecular phylogeny of the extinct ground sloth Mylodon darwinii. Proceedings of the National Academy of Sciences of United States of America 93, 181–185. Küch, M., Rohland, N., Betancourt, J.L., Latorre, C., Steppan, S., Poinar, H.N., 2002. Molecular analysis of an 11 700-year-old rodent midden from the Atacama Desert, Chile. Molecular Ecology 11, 913–924. Lindahl, T., 1993. Instability and decay of the primary structure of DNA. Nature 36, 709–715. McDonald, H.G., de Iuliis, G., 2008. Fossil history of the sloths. In: Vizcaíno, S.F., Loughry, W.J. (Eds.), The Biology of the Xenarthra. University Press of Florida, Gainesville, FL, pp. 39–55. Miller, W., et al., 2008. Sequencing the nuclear genome of the extinct woolly mammoth. Nature 456, 387–451. Nei, M., Kumar, S., 2000. Molecular Evolution and Phylogenetics. Oxford University Press, New York. Poinar, H., Hofreiter, M., Spaulding, G., Martin, P., Stankiewicz, A., Bland, H., Evershed, R., Possnert, G., Pääbo, S., 1998. Molecular coproscopy: dung and diet of the extinct ground sloth Nothrotheriops shastensis. Science 281, 402–406. Poinar, H.N., Küch, M., Sobolik, K.D., Barnes, I., Stankiewicz, A.B., Kuder, T., Spaulding, W.G., Bryant, V.M., Cooper, A., Pääbo, S., 2001. A molecular analysis of dietary diversity for three archaic Native Americans. Proceedings of the National Academy of Sciences of United States of America 98, 4317–4322. Poinar, H.N., Küch, M., McDonald, G., Martin, P., Pääbo, S., 2003. Nuclear gene sequences from a late Pleistocene Sloth coprolite. Current Biology 13, 1150–1152. Rasmussen, M., et al., 2010. Ancient human genome sequence of an extinct PalaeoEskimo. Nature 463, 757–762. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Zhang, W., Zhang, Z., Xu, X., Wei, K., Wang, X., Liang, X., Zhang, L., Shen, F., Hou, R., Yue, B., 2009. A new method for DNA extraction from feces and hair shafts of the South China Tiger (Panthera tigris amoyensis). Zoo Biology 28, 49–58.
Contents lists available at ScienceDirect
Annals of Anatomy journal homepage: www.elsevier.de/aanat
Mylodon darwinii DNA sequences from ancient fecal hair shafts Andrew A. Clack a,∗ , Ross D.E. MacPhee d , Hendrik N. Poinar a,b,c a
McMaster Ancient DNA Center, McMaster University, 1280 Main Street West, Hamilton, ON L8S 4L9, Canada Department of Anthropology, McMaster University, 1280 Main Street West, Hamilton, ON L8S 4L9, Canada c Department of Pathology and Molecular Medicine, McMaster University, 1280 Main Street West, Hamilton, ON L8S 4L9, Canada d American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024, United States b
a r t i c l e
i n f o
Article history: Received 16 February 2011 Received in revised form 4 May 2011 Accepted 5 May 2011
Keywords: Ancient DNA Coprolites Fecal hair Mylodon darwinii
s u m m a r y Preserved hair has been increasingly used as an ancient DNA source in high throughput sequencing endeavors, and it may actually offer several advantages compared to more traditional ancient DNA substrates like bone. However, cold environments have yielded the most informative ancient hair specimens, while its preservation, and thus utility, in temperate regions is not well documented. Coprolites could represent a previously underutilized preservation substrate for hairs, which, if present therein, represent macroscopic packages of specific cells that are relatively simple to separate, clean and process. In this pilot study, we report amplicons 147–152 base pairs in length (w/primers) from hair shafts preserved in a south Chilean coprolite attributed to Darwin’s extinct ground sloth, Mylodon darwinii. Our results suggest that hairs preserved in coprolites from temperate cave environments can serve as an effective source of ancient DNA. This bodes well for potential molecular-based population and phylogeographic studies on sloths, several species of which have been understudied despite leaving numerous coprolites in caves across of the Americas. © 2011 Published by Elsevier GmbH.
1. Introduction Ancient hair tissue has proven to be an exceptional source of mitochondrial (mt) DNA (Gilbert et al., 2004, 2008a,b), and in addition to complete mitogenomes, significant amounts of nuclear DNA have been generated for the woolly mammoth (Mammuthus primigenius) and a Palaeo-Eskimo from Greenland, using permafrost-preserved ancient hair shafts (Miller et al., 2008; Rasmussen et al., 2010). Preserved ancient fecal matter, or coprolites, can also be a rich source of molecular data (Poinar et al., 1998, 2001, 2003; Hofreiter et al., 2003), and particularly notable ancient DNA (aDNA) sequence has been retrieved from coprolites preserved in desert caves and rodent burrows (Küch et al., 2002; Poinar et al., 2003), where characteristically dry conditions are thought to be conducive to the molecule’s long term survival (Lindahl, 1993). Hair shafts are an intriguing constituent of some modern feces and coprolites (Zhang et al., 2009; Backwell et al., 2009). The fact that many mammals orally groom themselves, their offspring, and conspecifics using the tongue and teeth, makes it unsurprising that hair is often ingested. Carnivores may also intake large amounts of
∗ Corresponding author. Current address: Department of Biology, Pennsylvania State University, 326 Mueller Laboratory, University Park, PA 16802, United States. Tel.: +1 412 334 6599. E-mail address: [email protected] (A.A. Clack). 0940-9602/$ – see front matter © 2011 Published by Elsevier GmbH. doi:10.1016/j.aanat.2011.05.001
hair from mammalian prey items. Consumed hair can eventually be excreted in an organism’s feces, and a keratinous casing seems to make it exceptionally durable and resilient on a macroscopic and molecular level (Gilbert et al., 2004). A recent study evaluated modern feces and fecal hairs as a source of mt and microsatellite DNA for South China tigers and found that hairs sampled from feces are actually a more reliable source of DNA than the bulk fecal matter itself (Zhang et al., 2009). Here we examine a coprolite attributed to Darwin’s ground sloth, Mylodon darwinii, a bear-sized terrestrial species that went extinct toward the end of the Pleistocene, ∼10,000 yrs ago. This taxon was examined in the seminal aDNA investigation on extinct sloths (Höss et al., 1996), which used subfossil bone extract to target portions of the mt genome for phylogenetic analysis. Specific fragments of mt sequence for this taxon are thus available to compare against other ancient specimens. A native of southern South America, M. darwinii was possibly unique among sloths in having become adapted to a grazing lifestyle (McDonald and de Iuliis, 2008). Not surprisingly, the coprolite forming the basis for this investigation is filled with processed grass fragments; in addition, it contains wiry hair shafts, which fostered curiosity (Fig. 1). Given the presumed vegetarian diet of the species, the fecal hairs are considered at least species specific to the coprolite’s producer. To investigate this, we separated and extracted hair shafts from the coprolite and tested them for mtDNA of M. darwinii, using targeted PCR and primers based on the species’ published sequence (Höss et al., 1996).
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
27
Fig. 1. Subsample of a coprolite attributed to M. darwinii, collected from Cueva del Milodón. Arrows indicate several hair shafts used in the analysis.
2. Materials and methods (adapted from Clack et al., 2011) We sampled a coprolite, attributed to M. darwinii, collected by R.D.E. MacPhee in 2001 from Cueva del Milodón in southern Chile, and stored thereafter at the American Museum of Natural History (New York, NY). The specimen is estimated to be ∼13,000 yrs old, which is in line with other specimens from this locality (Höss et al., 1996). DNA extraction took place in the fall of 2009 at the McMaster Ancient DNA Centre (Hamilton, Ontario) where modern and ancient processing facilities are geographically separated, and sterile conditions are maintained to prevent modern contamination. Using bleach and oven sterilized tweezers, six hair shafts, ∼1–2 cm in length, were removed from the coprolite (Fig. 1). The hairs were washed in sterile H2 0 three times to remove dust and debris clinging to them. Using fresh scalpel blades, the hairs were cut into equal lengths of ∼0.5 cm and placed in a
fresh 2 mL tube. We added 1.5 mL of digestion buffer (Tris–Cl (1 M stock at pH8.0; 10 mM final); sarcosy (10% stock; 0.5% final); ProK (20 mg/mL stock; 250 g/mL final); CaCl2 (2.5 M; 5 mM final); DTT (50 mM final)) to the tube and incubated it along with a blank at 55 ◦ C, with slow rotation. The hairs were digested after 10 h. We performed a phenol chloroform extraction. To the digested solution we added 500 L of PCI (phenol/chloroform/isoamyl alcohol (25:24:1)) and mixed gently for several minutes. The mixture was then centrifuged at maximum speed for 5 min, and the aqueous phase transferred to a new 2 mL tube. Those steps were repeated using 500 L of chloroform to remove residual phenol. The aqueous extract layer (∼1000 L) was concentrated. We primed Microcons 30YM with 100 L of 0.1× TE, then applied to the same cartridge the sample stepwise (500 L each time) and centrifuged to dryness. The membrane was washed three times with 300 L of 0.1× TE, and each time centrifuged to dryness. We
28
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
added 100 L of 0.1× TE in each column and put it in a new collection tube. This was shaken upward for 5 min at 1000 rpm on a Thermoblock at room temperature. The Microcon columns were then inverted and centrifuged at 1000G speed for 3 min to collect the concentrated DNA. PCR reactions were carried out in 20 L reaction volume with 1× PCR-buffer, 2.5 mM MgCl2 , 250 M of each dNTP, 300 nM of each primer, 1 unit of taq polymerase (AmpliTaq Gold; Applied Biosystems, Foster City, California), and 3 L of template. Cycling conditions were as follows: initial denaturation at 95 ◦ C for 5 , 45 cycles of denaturation 30 at 95 ◦ C, annealing 30 at 55 ◦ C, extension at 72 ◦ C for 45 and a final extension at 72 ◦ C for 10 . Amplification products were visualized under UV light on 2.5% agarose gels stained with ethidium bromide. Primers were designed by eye using the M. darwinii sequence published by Höss et al. (1996) (GenBank #s Z48943 = 12S, Z48944 = 16S): Md16SF 5 TAGGGATAACAGCGCAATCC3 ; Md16SR 5 CGTAGGACTTTAATCGTT-GA3 ; Md12SF 5 CTGGGATTAGATACCCCA-CTAT3 ; Md12SR 5 GTCGATTATAGGACAGGTTCCTCTA3 . With the primers edited out, the target fragments were 100 and 112 bp long for the 12S and 16S fragments, respectively. To ensure accuracy, each position in a given final consensus sequence was covered by three independent amplifications (Tables 1 and 2). Each PCR product was cloned using the TOPO-TA cloning kit with TOP-10 chemically competent cells (Invitrogen, Canada). Insert-carrying clones were identified via blue/white selection and amplified. Colony PCR products were purified using AcroPrep 96 Filter Plates (Pall, USA). Three to four positive clones per independent PCR were sequenced using the M13F primer on an ABI 3130, as per manufacturer’s suggestions for DNA concentration of 1 in 7 L reactions using 0.3 L of BigDye ver3.1 (Applied Biosystems, Foster City, California). We aligned 12S and 16S GeneBank sequences from living the Xenarthra (armadillo, anteater, and three- and two-toed sloth) and M. darwinii from Höss et al. (1996). To this we added the “unknown” fecal hair shaft consensus sequences, along with additional extinct sloth species’ 16S and 12S sequence isolated at the McMaster Ancient DNA Centre: Acratoncus ye, Neocnus dousman, Parocnus serus, Shasta nothrotheriops (awaiting publication). We inferred evolutionary history using the maximum likelihood method based on the Data specific model (Nei and Kumar, 2000). The tree with the highest log likelihood (−434.0290) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically as follows: when the number of common sites is <100 or less than one fourth of the total number of sites, the maximum parsimony method was used; otherwise BIONJ method with MCL distance matrix was used. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories; +G, parameter = 0.3835). The analysis involved 12 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 95 positions in the final dataset. Evolutionary analyses were conducted in MEGA4 (Tamura et al., 2007).
3. Results This pilot study set out to investigate hair preserved in a 13,000yr-old sloth coprolite as a potential source of aDNA. We obtained three independent PCR amplicons for fragments of the 12S (147 bp w/primers) and 16S (152 bp w/primers) rDNA genes, cloned the products and sequenced a total of 4 clones for each 16S PCR and 3 clones for each 12S PCR. From these aligned PCRs/clones we derived consensus sequences, both of
which differ from living sloths, while matching the sequence for M. darwinii published by Höss et al. (1996) (Tables 1 and 2). The clone sequences display 22 C to T transitions, as well as 3 G to A transitions. Most likely the result of hydrolytic deamination, sequence damage like this is expected, and regarded as confirmation of endogenous DNA age in ancient specimens (Gilbert et al., 2007); it should be addressed via repeat amplification, cloning and consensus sequences (Lindahl, 1993). One sequence in particular (Table 1, 12S PCR2 clone 2) displays 5 of the C to T transitions, 2 of the G to A transitions, 2 A to T transversions, and one apparent deletion. However, this fragment does not precisely match any known taxa accessible on NCBI, and given the nature of the damage and the geographical distance to taxa with even close sequence affinity, we do not feel it represents exogenous contaminant, merely a heavily damaged starting template, and possible PCR error. Phylogenetic maximum likelihood analysis (Fig. 2) suggests the “unknown” sequence from the coprolite hair shafts groups with sloths broadly and with M. darwinii specifically. And although support for the tree’s nodes is largely inconclusive (likely due to the limited amount of sequence data) the tree’s overall structure, along with consensus base composition, effectively identifies the “unknown” sequence as that of an M. darwinii ground sloth.
4. Discussion The relatively easy accession of M. darwinii sequences from ancient fecal hair suggests that aDNA extractions from coprolites can likely be divided and streamlined. While potentially rich troves of aDNA, coprolites are also a genetically heterogeneous set of materials, and a fecal mass can contain a diversity of processed food matter, along with the defecator’s own sloughed tissue (Poinar et al., 1998, 2001). Without initial sorting of visually identifiable constituents, a final extract is likely to be an ad hoc mixture of various sequence templates. In order to minimize potentially unwanted sequence from a bulk extract, one should perhaps attempt species-specific shotgun sequencing, it would behoove researchers to isolate and extract from hair separately. In addition, coprolite extraction protocols are arguably more complicated than those used on other aDNA sources, like bone and hair, requiring additional reagents (e.g. N-phenacylthiazolium bromide, PTB) to (theoretically) overcome sequence cross-links that can block PCR (Poinar et al., 1998, 2001; Küch et al., 2002; Hofreiter et al., 2003). Hair shafts, if present in a coprolite, represent macroscopic packages of specific cells, potentially enriched with mtDNA (Gilbert et al., 2008b), which are relatively simple to separate, clean and process. In addition, the gross structure of hair may actually limit exogenous DNA contamination (Gilbert et al., 2006), including that from a coprolite matrix. And although further investigation would be necessary to evaluate this, the relatively clear-cut manner in which hairs can be separated and cleaned of fecal debris, suggests the probability of amplifying certain contaminants can at least be decreased. This could be very important if fecal hairs are not those of the defecator, as might be the case in carnivore coprolites (Backwell et al., 2009), or if conspecific oral grooming is/was a common behavior. This investigation did not address the issue, but future studies might be able to examine potential taxonomic and intraspecific cross contamination in fecal hairs. No species of extinct ground sloth has ever been the subject of a (published) intraspecific/population level investigation, and significant sample numbers of this species have never been collectively available for such analyses. However, the amplification of M. darwinii sequence from bone and fecal hair collected at Cueva del Milodón increases the possibility that enough samples could be collected for this species, from this particular location, to do meaningful investigations on its genetic dynamics therein.
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
29
Table 1 Alignment of 3 PCRs, with 4 clones per PCR, of an mtDNA 12S fragment from M. darwinii fecal hair extract (Clack et al., 2011).
For good reason, curators are often hesitant to provide ancient source tissue for DNA extraction, as this procedure virtually always results in the destruction of at least a portion of the specimen. Coprolites may provide a slight resolution, for while they are not the most glamorous source for ancient tissue and DNA, they can be treasure troves of genetic information. Curators and collectors may be willing to subject aesthetically less pleasing coprolites and
their constituent materials to destructive sampling before bone and other tissues. However, one must appreciate that coprolites are themselves extremely rare and should always be treated with care and temperance. Our results suggest that significant portions of M. darwinii’s mt, and perhaps even nuclear genome could be generated using hairs collected from this species’ coprolites. They also point to the option
Table 2 Alignment of 3 PCRs, with 2–4 clones per PCR, of an mtDNA 16S fragment from M. darwinii fecal hair extract (Clack et al., 2011).
30
A.A. Clack et al. / Annals of Anatomy 194 (2012) 26–30
Fig. 2. Phylogenetic analysis of the xenarthran using maximum likelihood methods, with extinct (*) and extant sloths, anteater, armadillo, and “unknown” sequence obtained from hairs in a coprolite attributed to M. darwinii.
of using fecal hair, if available, from temperate and arid environment preserved coprolites to investigate species and population level genetics of sloths. Acknowledgements We are grateful to Ben Evans and members of the Evans Lab (Biology Dept, McMaster University) for use of space and equipment in post PCR processing of aDNA amplifications. This work was supported by NSERC and a Canada Research Chair to HNP. References Backwell, L., Pickering, R., Brothwell, D., Berger, L., Witcomb, M., Martill, D., Penkman, K., Wilson, A., 2009. Probable human hair found in a fossil hyaena coprolite from Gladysvale cave, South Africa. Journal of Archaeological Science 36, 1269–1276. Clack, A.A., MacPhee, R.D.E., Poinar, H., 2011. Extinct Sloth DNA from Ancient Fecal Hair. In: Shapiro, B., Hofreiter, M. (Eds.), Ancient DNA: Methods and Protocols. Humana Press, New York, NY (in press). Gilbert, M.T.P., Wilson, A.S., Bunce, M., Hansen, A.J., Willerslev, E., Shapiro, B., Higham, T.F.G., Richards, M.P., O’Connell, T.C., Tobin, D.J., Janaway, R.C., Cooper, A., 2004. Ancient mitochondrial DNA from hair. Current Biology 14, R463–464. Gilbert, M.T.P., Menez, L., Janaway, R.C., Tobin, D.J., Cooper, A., Wilson, A.S., 2006. Resistance of degraded hair shafts to contaminant DNA. Forensic Science International 156, 208–212. Gilbert, M.T.P., et al., 2007. Recharacterization of ancient DNA miscoding lesions: insights in the era of sequencing-by-synthesis. Nucleic Acids Research 35, 1–10. Gilbert, M.T.P., et al., 2008a. Intraspecific phylogenetic analysis of Siberian woolly mammoths using complete mitochondrial genomes. Proceedings of the National Academy of Sciences of United States of America 105, 8327–8332. Gilbert, M.T.P., et al., 2008b. Paleo-Eskimo mtDNA genome reveals matrilineal discontinuity in Greenland. Science 320, 1787–1789. Hofreiter, M., Betancourt, J.L., de Sbriller, A.P., Markgraf, V., McDonald, H.G., 2003. Phylogeny, diet and habitat of an extinct ground sloth from Cuchillo
Curá, Neuquén Province, southwest Argentina. Quaternary Research 59, 364– 378. Höss, M., Dilling, A., Currant, A., Päabo, S., 1996. Molecular phylogeny of the extinct ground sloth Mylodon darwinii. Proceedings of the National Academy of Sciences of United States of America 93, 181–185. Küch, M., Rohland, N., Betancourt, J.L., Latorre, C., Steppan, S., Poinar, H.N., 2002. Molecular analysis of an 11 700-year-old rodent midden from the Atacama Desert, Chile. Molecular Ecology 11, 913–924. Lindahl, T., 1993. Instability and decay of the primary structure of DNA. Nature 36, 709–715. McDonald, H.G., de Iuliis, G., 2008. Fossil history of the sloths. In: Vizcaíno, S.F., Loughry, W.J. (Eds.), The Biology of the Xenarthra. University Press of Florida, Gainesville, FL, pp. 39–55. Miller, W., et al., 2008. Sequencing the nuclear genome of the extinct woolly mammoth. Nature 456, 387–451. Nei, M., Kumar, S., 2000. Molecular Evolution and Phylogenetics. Oxford University Press, New York. Poinar, H., Hofreiter, M., Spaulding, G., Martin, P., Stankiewicz, A., Bland, H., Evershed, R., Possnert, G., Pääbo, S., 1998. Molecular coproscopy: dung and diet of the extinct ground sloth Nothrotheriops shastensis. Science 281, 402–406. Poinar, H.N., Küch, M., Sobolik, K.D., Barnes, I., Stankiewicz, A.B., Kuder, T., Spaulding, W.G., Bryant, V.M., Cooper, A., Pääbo, S., 2001. A molecular analysis of dietary diversity for three archaic Native Americans. Proceedings of the National Academy of Sciences of United States of America 98, 4317–4322. Poinar, H.N., Küch, M., McDonald, G., Martin, P., Pääbo, S., 2003. Nuclear gene sequences from a late Pleistocene Sloth coprolite. Current Biology 13, 1150–1152. Rasmussen, M., et al., 2010. Ancient human genome sequence of an extinct PalaeoEskimo. Nature 463, 757–762. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Zhang, W., Zhang, Z., Xu, X., Wei, K., Wang, X., Liang, X., Zhang, L., Shen, F., Hou, R., Yue, B., 2009. A new method for DNA extraction from feces and hair shafts of the South China Tiger (Panthera tigris amoyensis). Zoo Biology 28, 49–58.