- Email: [email protected]
Nrf2 induced cisplatin resistance in ovarian cancer by promoting CD99 expression
Biochemical and Biophysical Research Communications 518 (2019) 698e705
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Nrf2 induced cisplatin resistance in ovarian cancer by promoting CD99 expression Jianfa Wu, Li Zhang, Huixin Li, Suqin Wu**, Zhou Liu* Department of Gynecology, Shanghai University of Medicine & Health Sciences Affiliated Zhoupu Hospital, Shanghai, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 August 2019 Received in revised form 22 August 2019 Accepted 22 August 2019 Available online 28 August 2019
Cisplatin resistance is a vital obstacle for the prognosis of ovarian cancer. However, the mechanism of cisplatin resistance is still unknown. This research was performed to explore the role of Nrf2 (nuclear factor, erythroid 2 like 2) and CD99 (CD99 molecule) in cisplatin resistance in ovarian cancer. QRT-PCR and Western blot were used to detect the expression of CD99 in ovarian cancer cells and tissues with different cisplatin sensitivities. Cell viability was analyzed by the Cell Counting Kit-8 (CCK8). The relationship of Nrf2 and CD99 was assessed by dual-luciferase reporter gene assay and chromatin immunoprecipitation (ChIP). Bioinformatics analysis was performed to search for the downstream gene of CD99. In this study, it was revealed that CD99 was highly expressed in cisplatin-resistant ovarian cancer cells and tissues, while lower CD99 expression was found in cisplatin-sensitive ovarian cancer cells and tissues. In addition, the overexpression of CD99 resulted in cisplatin resistance; on the other hand, knockdown of CD99 sensitized ovarian cancer to cisplatin. Furthermore, survival analysis indicated that overall survival (OS) and progression-free survival (PFS) of patients with higher CD99 expression were shorter than those with lower CD99 expression. It was also found that when Nrf2 was upregulated in cisplatin-sensitive ovarian cells, CD99 expression and cell viability increased after cisplatin treatment. Knockdown of CD99 could reverse cisplatin resistance induced by Nrf2. Conversely, when Nrf2 was knocked down in cisplatin-resistant ovarian cancer cells, CD99 expression and cell viability with cisplatin treatment decreased, while simultaneously upregulating CD99 reactivated cisplatin resistance in ovarian cancer cells. The dual-luciferase reporter gene assay and ChIP analysis suggested CD99 was a downstream gene of Nrf2, and Nrf2 positively regulated the expression of CD99 at the transcriptional level. In conclusion, Nrf2 induced cisplatin resistance in ovarian cancer cells by promoting CD99 expression. Targeted CD99 might be an effective way to reverse cisplatin resistance in ovarian cancer. © 2019 Elsevier Inc. All rights reserved.
Keywords: Ovarian neoplasms Cisplatin Nrf2 CD99 Chemoresistance
1. Introduction Ovarian cancer is one of the most common gynecological malignancies. In 2019, 22,530 new cancer cases and 13,980 cancer deaths are projected to occur in the United States [1]. Five-year relative survival rate for ovarian cancer was 47% from 2008 to 2014 [2]. Cisplatin resistance is considered to be an important reason for poor prognosis of women with ovarian cancer [3]. However, the mechanism of cisplatin resistance is still unknown. Our previous research revealed that the Nrf2-signaling pathway activation led to cisplatin resistance through autophagy activation
* Corresponding author. 1500 Zhouyuan Road, Shanghai, 201318, China. ** Corresponding author. 1500 Zhouyuan Road, Shanghai, 201318, China. E-mail addresses: [email protected] (S. Wu), [email protected] (Z. Liu). https://doi.org/10.1016/j.bbrc.2019.08.113 0006-291X/© 2019 Elsevier Inc. All rights reserved.
in ovarian cancer [4]. To study the mechanism of Nrf2, gene microarray analysis was performed. Interestingly, CD99 was considered to be a potential downstream gene of Nrf2 [5]. CD99 is coded by MIC2 (MHC class I related antigen 2) and located in the pseudoautosomal region 1 (PAR1) of X and Y chromosome as a single-pass type I membrane protein, which is involved in apoptosis, adhesion, differentiation, and protein trafficking [6]. In addition, the encoded protein may rearrange the actin cytoskeleton of many immune cells including leukocytes, monocytes, and CD34 þ cells to induce transendothelial migration [7]. CD99 has been considered to be an essential marker for Ewing sarcoma [8]. Furthermore, previous studies revealed that CD99 marked malignant myeloid stem cells, a potential therapeutic target in acute myeloid leukemia and the myelodysplastic syndromes [9,10]. Moreover, CD99 has been reported to affect the migration, invasion, and metastasis of tumor cells, while targeting
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
murine CD99 by a conjugate vaccine resulted in inhibition of tumor growth in a tumor model both with high CD99 and low CD99 expression [11]. However, there is still controversy about the relationship between CD99 and different cancers. In most tumors such as lymphoblastic lymphoma, myeloid malignancy, malignant glioma, synovial sarcoma, mesenchymal chondrosarcoma, rhabdomyosarcoma, thymic tumor, gastrointestinal and pulmonary neuroendocrine tumor, and breast carcinoma, CD99 has been considered to be oncogene [12,13]. However, in other tumors, including osteosarcoma, pancreatic endocrine neoplasms, and gastric adenocarcinoma, CD99, which has been considered to be tumor suppressor gene, was absent [14]. In ovarian cancer, CD99, as a biological marker, has been reported to play an important role in ovarian granulosa cell tumor diagnosis [15,16]. However, the role of CD99 in cisplatin resistance in ovarian cancer was still unknown. In this study, it was revealed that CD99, as a downstream gene of Nrf2, resulted in cisplatin resistance. Deletion of CD99 sensitized ovarian cancer to cisplatin. Furthermore, progression-free survival (PFS) and overall survival (OS) of ovarian cancer patients with higher CD99 expression were shorter than those of patients with lower CD99 expression. This study provided us with a better understanding of the role of CD99 in cisplatin resistance in ovarian cancer. 2. Materials and methods
699
2.3. Plasmid and small interfering RNA construction CD99 CDS was amplified using primer sequence as follows: Forward, AATTCCTCGAGACTAGTTATGGCCCGCGGGGCT; reverse, ATCCGCGGCCGCTCTAGTTTCTCTAAAAGAGTACGCTGAACAGC. The purified PCR products were cloned into the Plvx-IRES-ZsGreen1 vector. Sequencing analysis was performed to confirm the integrity of plasmid constructs. Human CD99 siRNA and its control siRNA were constructed by Riobobio (Guangzhou, China). CD99 siRNA sequence was as follows: sense strand 50 -GGCUGGCCAUUAUUAAGUCTT-30 and antisense strand 50 -GACUUAAUAAUGGCCAGCCTT-30 .
2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) QRT-PCR was performed on the ABI PRISM 7500 (ABI,USA) using FastQuant RT Super Mix (TIANGEN, Beijing, China). Primers for qRTPCR were as follows: CD99, forward, GCGAGTGACGACTTCAACCTGG, reverse, CGTCCTCCAGGTCGAAGCCTC, b-actin, forward, TTGTTACAGGAAGTCCCTTGCC, reverse, ATGCTATCACCTCCCCT GTGTG. QRT-PCR conditions were as follows: predenaturation, one cycle at 95 C for 10 s, 40 cycles at 95 C for 5 s, 60 C for 31 s, and one cycle for melting curve analysis (95 C for 15 s, 60 C for 30 s, 95 C for 15 s). b-Actin was used as the normalizing gene. All PCRs were performed in triplicate and the levels of gene expression were quantified by adopting 2eD D Ct value.
2.1. Cell lines and reagents 2.5. Western blot Two paired ovarian cancer cell lines were used to perform this experiment. Cisplatin-resistant A2780CP and its parent cisplatinsensitive A2780 were purchased from ATCC (http://www.atcc.org/ ), which were grown in Dulbecco's modified Eagle's medium (DMEM). Cisplatin-resistant COC1/DDP and its parent cisplatinsensitive COC1 were purchased from Peking Union Medical College (Beijing, China), which were grown in RPMI-1640 medium. Ten percent fetal bovine serum (GIBCO, Australia), penicillin (100 U/ mL), and streptomycin sulfate (100 mg/mL) were added to culture mediums. All cells were grown at 37 C in a humid incubator under 5% CO2. Cisplatin was purchased from Aladdin (Aladdin Industrial, Shanghai, China), which was dissolved in dimethyl sulfoxide with a concentration of 5 mg/ml and was stored at 80 C. 2.2. Collection and tumor specimens Fourteen ovarian cancer patients from August 2015 to July 2016 at Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) were enrolled in this study. All patients consented to this study. This study was approved by the ethics board of Obstetrics and Gynecology Hospital. Without any drug treatment before surgery, all specimens were collected under aseptic conditions and immediately snap frozen in liquid nitrogen within 10 min and then stored at 80 C. All patients’ information is shown in Table 1. Table 1 Patients’ basic information characteristics.
Age Stage Ie II III-IV Lymphatic metastasis Yes No CD99
High Nrf2 group
Low Nrf2 group
P value
57.43 ± 3.92
56.00 ± 4.14
0.81 0.56
1 6
3 4 0.46
0 7 0.24 ± 0.06
2 5 0.08 ± 0.01
0.01
Cells were incubated with CD99 overexpression plasmid or CD99 siRNA and lysed after 48 h. Subsequently, 30 mg proteins were separated by SDS-PAGE and transferred to nitrocellulose filter membranes (Millipore, Bedford, MA). The membranes were blocked with 5% non-fat milk and incubated with Anti-CD99 (1:500, ab108297, Abcam, Cambridge, MA, USA), Anti-Nrf2 (1:500, ab246229, Abcam, Cambridge, MA, USA), and b -actin (1:5000, Sigma, St. Louis, MO). The secondary antibodies were purified antirabbit IgG antibody and anti-mouse IgG antibody, which were conjugated to horseradish peroxidase (1:5000, Cell Signaling Technology, Boston, USA). The expression of relative proteins was visualized with SuperSignal West Femto Maximum Sensitivity Substrate (WBKLS0500, MERCK, German). All blots were performed in triplicate. Band intensity was quantified with ImageJ software (National Institute of Health, Bethesda, MD, USA).
2.6. Cell viability analysis Cells were seeded into 96-well plates. After 24 h, different concentrations of cisplatin were added to cells for 24 h. Cell proliferation was then analyzed by CCK8 assay according to the manufacturer's recommendations (Dojin Laboratory, Kumamoto, Japan). The microplate reader was used to measure the absorbance at a wavelength of 450 nm (Model 680, Bio-Rad Laboratories, Hercules, CA, USA). All data were performed in three independent experiments.
2.7. Chromatin immunoprecipitation (ChIP) assay ChIP experiment was carried out with EZChIP™ Kit (17e371, Millipore, Darmstadt, Germany). The process of ChIP was conducted according to our previous article described [17]. Primers sequence was as follows: forward, GTGCCACTACAGTTAAGGGC; reverse, CCTTCTCAGGAAACTGCCCAC.
700
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
2.8. Dual-luciferase reporter assay
3. Results
To certify the relationship of Nrf2 and CD99, dual-luciferase reporter assay was performed as previously described [17]. PGL3CD99 promoter, different pGL3-CD99 promoter truncated bodies, and pGL3-CD99 promoter mut were constructed by YUSEN biological company. pGL3-CD99 promoter, Plvx-IRES-ZsGreen1-NRF2, Plvx-IRES-ZsGreen1, and Renilla plasmid were co-transfected to HEK-293T. The experiment process and analysis of results were performed as previously described [17].
3.1. Expression of CD99 in ovarian cancer cells and tissues with different cisplatin sensitivity
2.9. Statistical analysis All statistical analyses were performed using SPSS software (version 22). According to the sample size, the counting data were analyzed by the chi-square test, chi-square test of continuous correction or Fisher's exact probability method. For measurement data, two independent-samples Student t-test, corrected t-test, or Wilcoxon rank-sum test was used to compare differences between the two groups. The differences were considered significant when a two-sided P value < 0.05.
It was revealed that CD99 was a potential targeted molecule of Nrf2 in our previous gene chip [5]. To assess the role of CD99 in cisplatin resistance induced by Nrf2, qRT-PCR and Western blot were used. Interestingly, as shown in Fig. 1A, CD99 expression level was higher in cisplatin-resistant ovarian cancer cells than in cisplatin-sensitive ovarian cancer cells. Furthermore, differences in CD99 expression were also compared in tissue level through bioinformatics analysis methods with another gene chip GDS4950 [18]. It was apparent that CD99 expression in cisplatin-resistant ovarian cancer tissue was also higher than that in cisplatinsensitive ovarian cancer tissue (Fig. 1B). These data suggests that CD99 is a potential targeted gene of cisplatin resistance. 3.2. Overexpression of CD99 resulted in cisplatin resistance To validate the impact of CD99 on cisplatin resistance in ovarian
Fig. 1. Relationship between CD99 and cisplatin resistance in ovarian cancer. (A) The expression of CD99 in cisplatin-sensitive ovarian cancer cells: A2780 and COC1 and their paired cisplatin-resistant ovarian cancer cells: A2780CP and COC1/DDP. (B) The expression of CD99 in different ovarian cancer tissues with different cisplatin sensitivity. (C) A2780 and COC1 were transfected with 2 mg Plvx-IRES-ZsGreen1-CD99 vector or its control for 6 h. A2780CP and COC1/DDP were transfected with 5 ml CD99 siRNA or its control for 6 h. After 48 h, with different concentrations of cisplatin for 24 h, cell viability was detected by CCK8 assay. (D) The 1,656 ovarian cancer patients were divided into two groups according to the expression of CD99 at cut value 1709: the Low group (N ¼ 940) and the High group (N ¼ 716). OS of patients were compared between two groups. The 1,435 ovarian cancer patients were divided into two groups according to the expression of CD99 at cut value 1710: the Low group (N ¼ 796) and the High group (N ¼ 639). PFS of patients were compared between two groups. *P ˂ 0.05, **P ˂ 0.01, ***P ˂ 0.001.
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
cancer cells, stimulation of CD99 expression was performed in A2780 and COC1 with CD99 overexpression vector. With different concentrations of cisplatin for 24 h, higher cell viability was observed in the CD99 overexpression group than in the control group (Fig. 1C, P ˂ 0.05). On the other hand, knockdown of CD99 in A2780CP and COC1/DDP cells with CD99 specific siRNA led to lower cell viability (Fig. 1C, P ˂ 0.05). Survival analysis was also performed through Kaplan-Meier plotter according to the previous article [19]. Of the 1,656 patients who had overall survival (OS) follow-up data and 1,435 patients who had progression-free survival (PFS) followup data, it was observed that patients with lower expression of CD99 had longer OS (Fig. 1D, HR ¼ 1.18 [1.03e1.34]) and PFS (Fig. 1D, HR ¼ 1.16 [1.02e1.32]). These data suggest that CD99 is associated with cisplatin resistance and prognosis of ovarian cancer.
701
3.3. Relationship between Nrf2 and CD99 The correlation between Nrf2 and CD99 was tested using T-tests. As Fig. 2A shows, when Nrf2 was upregulated by Plvx-IRESZsGreen1-NRF2 vector in A2780 and COC1 ovarian cancer cells, mRNA and protein expression of CD99 increased (P ˂ 0.001). Conversely, when Nrf2 was inhibited by Nrf2 specific siRNA in A2780CP and COC1/DDP ovarian cancer cells, CD99 expression reduced (Fig. 2B, P ˂ 0.05). Further analysis showed that CD99 expression was also higher in the Nrf2 high-expression ovarian cancer tissue group than in the Nrf2 lower-expression ovarian cancer tissue group (Fig. 2C, P ˂ 0.05). Furthermore, Pearson correlation analysis indicated that there was a significant positive correlation between Nrf2 and CD99 via GEPIA (http://gepia.cancer-
Fig. 2. Nrf2 induced cisplatin resistance through promoting CD99 expression. (A) After transfection with 2 mg Plvx-IRES-ZsGreen1-NRF2 vector and its control in A2780 and COC1 for 48 h, CD99 expression level was determined by Western blot and qRT-PCR. (B) CD99 expression was also determined by Western blot and qRT-PCR when A2780CP and COC1/DDP were transfected by 5 ml Nrf2 siRNA or its control for 48 h. (C) Fourteen ovarian cancer tissues were divided into two groups according Nrf2 mRNA expression: the high Nrf2 group and the low Nrf2 group. CD99 mRNA expression levels were compared between the two groups. (D) The relationship between Nrf2 and CD99 was determined by Pearson correlation analysis via GEPIA. (E) After transfection with 2 mg Plvx-IRES-ZsGreen1-NRF2 vector and 2 mg pGL3-basic-CD99 promoter vector, relative luciferase activity was analyzed compared to its control. (F) After transfection with 2 mg Plvx-IRES-ZsGreen1-NRF2 vector, or 2 mg Plvx-IRES-ZsGreen1-NRF2 vector and 5 ml CD99 siRNA, or their control (NC) in A2780 and COC1 for 48 h, cell viability was compared between the first two group. (G) After transfected with 5 ml Nrf2 siRNA, or 5 ml Nrf2 siRNA and 2 mg Plvx-IRESZsGreen1-CD99 vector, or their control (NC) in A2780CP and COC1/DDP for 48 h, cell viability was compared between the first two groups. *P ˂ 0.05, **P ˂ 0.01, ***P ˂ 0.001.
702
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
pku.cn/) according to a previous article [20] (Fig. 2D, R ¼ 0.69). To certify regulatory relationship of Nrf2 on CD99, dual-luciferase reporter gene assay was adopted. When Plvx-IRES-ZsGreen1NRF2 overexpression vector and pGL3-basic-CD99 promoter vector were co-transfected, relative luciferase activity analysis indicated that CD99 expression was higher than in its control group (Fig. 2E, P ˂ 0.001). All these data suggest that CD99 is a downstream gene of Nrf2, and Nrf2 plays an important role on CD99 expression. 3.4. CD99 reversed cisplatin resistance induced by Nrf2 To assess the effect of CD99 on cisplatin resistance induced by Nrf2, a recovery test was performed. Interestingly, when Nrf2 overexpression vector was transfected to A2780 or COC1, with different concentrations of cisplatin for 24 h, cell viability increased compared to its control. However, when CD99 siRNA was simultaneously transfected to A2780 or COC1, cell viability decreased significantly (Fig. 2F). Similarly, when Nrf2 siRNA was transfected to A2780CP or COC1/DDP, with different concentrations of cisplatin for 24 h, cell viability decreased, while cell viability increased when
CD99 overexpression vector was simultaneously transfected to A2780CP or COC1/DDP (Fig. 2G). These data suggest that Nrf2 induced cisplatin resistance through promoting CD99 expression. 3.5. Nrf2 promoted CD99 expression at the transcriptional level In order to search the binding site of Nrf2 on CD99, truncated CD99 promoter reporter gene sequences with different lengths were constructed. With relative luciferase activity analysis, it was found that only with a specific DNA sequence (0 and 500 bp upstream of the transcription initiation site), CD99 expression was higher than in its control group (Fig. 3A, P ˂ 0.001), which suggested that the binding site of Nrf2 on CD99 was between 0 and -500 bp upstream of the transcription initiation site. Furthermore, according to predicted DNA sequence with PROMO (http://alggen.lsi.upc. es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB) [21,22], PGL3basic-mut CD99 promoter vector was constructed. However, when Plvx-IRES-ZsGreen1-NRF2 overexpression vector and PGL3basic-mut CD99 promoter vector were co-transfected, there were no differences to be found between the two groups (Fig. 3B, P ˃
Fig. 3. Relationship between Nrf2 and CD99. (A) With different lengths of pGL3-basic-CD99 promoter truncated bodies and Plvx-IRES-ZsGreen1-NRF2 vector, relative luciferase activity was analyzed compared to control. (B) With Plvx-IRES-ZsGreen1-NRF2 vector and PGL3-basic-CD99 promoter mut vector (400 ACCTTGAGGGA -390), which was from a mutation of PGL3-basic-CD99 promoter (400 ACCGGGAGGGA -390), relative luciferase activity was compared to its control. (C) ChIP analysis was employed to determine the relationship between Nrf2 and CD99. Blank control: without DNA; Input: total DNA; Negative control: mouse IgG; Positive control: GAPDH antibody. ***P ˂ 0.001.
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
0.05). These data suggest that CD99 is a targeted gene of Nrf2. ChIP analysis was used to assess the relationship between Nrf2 and CD99. With designed primer for potential Nrf2 binding sequence, we found a direct relationship between Nrf2 and CD99 (Fig. 3C).
3.6. Interaction protein network of CD99 In this study, 18 interacting proteins of CD99 were detected through STRING (https://string-db.org/) and GPS-PLO (http:// gpsprot.org/index.php) (Fig. 4A and B) [23]. Then, to study the relationship between them, Pearson correlation analysis was employed via GEPIA. Surprisingly, CD99 molecule like 2 (CD99L2), serologically defined colon cancer antigen 3 (SDCCAG3), and small glutamine rich tetratricopeptide repeat containing alpha (SGTA) were found to be positively related to CD99 (Fig. 4C), whereas cadherin 1 (CDH1), peptidylprolyl isomerase A (PPIA), and thyroid hormone receptor interactor 13 (TRIP13) were revealed to be negatively associated with CD99 (Fig. 4D). These data suggest that they may be important components of CD99-signaling pathway networks.
703
4. Discussion CD99, as a transmembrane glycoprotein, has attracted increasing attention in recent years [24]. However, its role in tumor drug resistance was still unknown, especially with regard to ovarian cancer. The results of this study indicate that CD99 overexpression results in cisplatin resistance not only in ovarian cancer cells, but also in ovarian tissues. These findings might help us to understand the mechanism of cisplatin resistance in ovarian cancer. Prior studies have noted the importance of CD99 antibody targeted therapy [25e28]. The present study raises the possibility that ovarian cancer cells are sensitized by targeting CD99. This is an important issue for future research. Furthermore, previous studies revealed that (64)Cu-labeled anti-CD99 antibodies have been found to increase the sensitivity of tumor diagnosis, which was considered superior to fluoro-2-deoxy-D-glucose-positron emission tomography (FDG-PET) [29]. This finding suggests that CD99 may be regarded as a diagnostic marker, which could be used to predict cisplatin resistance in ovarian cancer. Certainly, more research is needed to determine the diagnostic effect of (64)Cu-labeled anti-
Fig. 4. Interaction protein network of CD99. (A)Interaction protein network of CD99 from STRING. (B) Interaction protein network of CD99 from GPS-PLO. (C) Correlation analysis between CD99 and CD99L2, SDCCAG3, and SGTA in ovarian cancer tissues via GEPIA. (D) Correlation analysis between CD99 and CDH1, PPIA, and TRIP13 in ovarian cancer tissues via GEPIA.
704
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
CD99 antibodies in cisplatin resistance of ovarian cancer. Regarding cancer development, aggressiveness, migration, and invasion, prior studies have noted that CD99 plays an important role [6]. For example, Manara MC et al. showed that CD99 induces methuosis of Ewing sarcoma cells through IGF-1R/RAS/Rac1 signaling [8]. Guerzoni C et al. reported that targeted CD99 induced rapid and massive EWS cell death through Mdm2 degradation and p53 reactivation [30]. Cerisano V et al. found that CD99 induced caspase-independent cell death and cell-cell adhesion in Ewing's sarcoma cells via actin and zyxin [26]. However, the role of CD99 in cancer was still under research, and CD99-signaling pathway networks was still unclear 6. In this study, CD99L2, SDCCAG3, and SGTA were found to be positively related to CD99, while CDH1, PPIA, and TRIP13 were revealed to be negatively associated with CD99. These results may support the hypothesis that CD99L2, SDCCAG3, SGTA, CDH1, PPIA, and TRIP13 are involved in cisplatin resistance induced by CD99. Certainly, further work is required to certify the relationship between them. Nrf2, as a key gene of anti-oxidative stress signaling, was revealed to impact the survival of ovarian cancer patients [31]. Furthermore, Nrf2 was also deemed to be associated with cisplatin resistance in ovarian cancer [4,5,17]. However, the specific regulatory mechanism of Nrf2 in cisplatin resistance of ovarian cancer was still under research. In this study, it was first suggested that CD99 was a crucial downstream gene of Nrf2. The present results are significant in at least two major respects. For one thing, this deepens our understanding of Nrf2-signaling pathway networks. For another, CD99 can now be considered to be a new targeted gene to reverse the resistance of ovarian cancer. However, several questions remain unanswered at present. For example, the mechanism of CD99-induced cisplatin resistance in ovarian cancer is still unknown. Functional verification of CD99 resistance in vivo has not been carried out. The effectiveness of CD99 antibody in reversing ovarian cancer resistance is still unclear. Further studies that take these variables into account will be undertaken to resolve these problems. Notwithstanding these limitations, the research has also suggested that CD99 is a crucial downstream gene of Nrf2, which is associated with cisplatin resistance. Targeted CD99 sensitizes ovarian cancer to cisplatin. This study contributes to our understanding of cisplatin resistance in ovarian cancer and enriched Nrf2-signaling pathway networks. Furthermore, the findings reported here shed new light on our future research. In future, more focus will be on functional verification of CD99 targeting in vivo. It is hoped that CD99 antibodies can improve the resistance of ovarian cancer patients. Funding The study was supported by grants from the seed fund program of Shanghai University of Medicine & Health Sciences (Grant No. SFP-18-21-17-001) and key disciplines of Pudong New Area Health and Family Planning Commission (Grant No. PWZxk2017-14). Authors’ contributions Jianfa Wu designed the project, accomplished the study, and wrote the manuscript; Li Zhang accomplished the study; Huixin Li provided data collection support; Suqin Wu performed statistical analysis; and Zhou Liu wrote and finalized the manuscript. Conflicts of interest The authors declare no conflict of interest.
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.08.113 References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, CA A Cancer J. Clin. 69 (1) (2019) 7e34 (2019). [2] K.D. Miller, R.L. Siegel, C.C. Lin, et al., Cancer treatment and survivorship statistics, CA A Cancer J. Clin. 66 (4) (2016) 271e289 (2016). [3] D. Holmes, Ovarian cancer: beyond resistance, Nature 527 (7579) (2015) S217. [4] L.J. Bao, M.C. Jaramillo, Z.B. Zhang, et al., Nrf2 induces cisplatin resistance through activation of autophagy in ovarian carcinoma, Int. J. Clin. Exp. Pathol. 7 (4) (2014) 1502e1513. [5] L. Bao, J. Wu, M. Dodson, et al., ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells, Mol. Carcinog. 56 (6) (2017) 1543e1553. [6] M. Pasello, M.C. Manara, K. Scotlandi, CD99 at the crossroads of physiology and pathology, J. Cell Commun.Signal 12 (1) (2018) 55e68. [7] R.L. Watson, J. Buck, L.R. Levin, et al., Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration, J. Exp. Med. 212 (2015) 1021e1041. [8] M.C. Manara, M. Terracciano, C. Mancarella, et al., CD99 triggering induces methuosis of Ewing sarcoma cells through IGF-1R/RAS/Rac1 signaling, Oncotarget 7 (48) (2016) 79925e79942. [9] K. Kingwell, Cancer: CD99 marks malignant myeloid stem cells, Nat. Rev. Drug Discov. 16 (3) (2017) 166. [10] M. Tavakkoli, S.S. Chung, C.Y. Park, Do preclinical studies suggest that CD99 is a potential therapeutic target in acute myeloid leukemia and the myelodysplastic syndromes? Expert Opin. Ther. Targets 22 (5) (2018) 381e383. [11] E.J.M. Huijbers, I.M. van der Werf, L.D. Faber, et al., Targeting tumor Vascular CD99 Inhibits tumor growth, Front. Immunol. 10 (2019) 651. [12] S.S. Chung, W.S. Eng, W. Hu, et al., CD99 is a therapeutic target on disease stem cells in myeloid malignancies, Sci. Transl. Med. 9 (374) (2017) pii: eaaj2025. [13] U. Urias, S.K. Marie, M. Uno, et al., CD99 is upregulated in placenta and astrocytomas with a differential subcellular distribution according to the malignancy stage, J. Neuro Oncol. 119 (2014) 59e70. [14] C. Zucchini, M.C. Manara, R.S. Pinca, et al., CD99 suppresses osteosarcoma cell migration through inhibition of ROCK2 activity, Oncogene 33 (15) (2014) 1912e1921. [15] E.A. Jarboe, S.L. Hirschowitz, K.B. Geiersbach, et al., Juvenile granulosa cell tumors: immunoreactivity for CD99 and Fli-1 and EWSR1 translocation status: a study of 11 cases, Int. J. Gynecol. Pathol. 33 (1) (2014) 11e15. [16] Y.L. Choi, H.S. Kim, G. Ahn, Immuno expression of inhibin alpha subunit, inhibin/activin betaA subunit and CD99 in ovarian tumors, Arch. Pathol. Lab Med. 124 (4) (2000) 563e569. [17] J. Wu, L. Bao, Z. Zhang, et al., Nrf2 induces cisplatin resistance via suppressing the iron export related gene SLC40A1 in ovarian cancer cells, Oncotarget 8 (55) (2017 Jul 25) 93502e93515. [18] M. Koti, R.J. Gooding, P. Nuin, et al., Identification of the IGF1/PI3K/NF kB/ERK gene signalling networks associated with chemotherapy resistance and treatment response in high-grade serous epithelial ovarian cancer, BMC Canc. 13 (2013) 549. [19] B. Gyorffy, A. Lanczky, Z. Szallasi, Implementing an online tool for genomewide validation of survival-associated biomarkers in ovarian-cancer using microarray data from 1287 patients, Endocr. Relat. Cancer 19 (2) (2012) 197e208. [20] Z. Tang, C. Li, B. Kang, et al., GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses, Nucleic Acids Res. 45 (W1) (2017) W98eW102. nec Farre , et al., PROMO: detection of [21] Xavier Messeguer, Ruth Escudero, Dome known transcription regulatory elements using species-tailored searches, Bioinformatics 18 (2) (2002) 333e334. nec Farre , Rom [22] Dome a Roset, Mario Huerta, et al., Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN, Nucleic Acids Res. 31 (13) (2003) 3651e3653. [23] M.E. Fahey, M.J. Bennett, C. Mahon, et al., GPS-Prot: a web-based visualization platform for integrating host-pathogen interaction data, BMC Bioinf. 12 (2011) 298. [24] M.C. Manara, M. Pasello, K. Scotlandi, CD99: a cell surface protein with an oncojanus role in tumors, Genes 9 (3) (2018) pii: E159. [25] Z. Husak, M.N. Dworzak, CD99 ligation upregulates HSP70 on acute lymphoblastic leukemia cells and concomitantly increases NK cytotoxicity, Cell Death Dis. 3 (2012) e425. [26] V. Cerisano, Y. Aalto, S. Perdichizzi, et al., Molecular mechanisms of CD99induced caspase-independent cell death and cell-cell adhesion in Ewi'g0 s sarcoma cells: actin and zyxin as key intracellular mediators, Oncogene 23 (2004) 5664e5674. [27] Z. Husak, D. Printz, A. Schumich, et al., Death induction by CD99 ligation in TEL/AML1-positive acute lymphoblastic leukemia and normal b cell precursors, J. Leukoc. Biol. 88 (2010) 405e412.
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705 [28] K. Scotlandi, N. Baldini, V. Cerisano, et al., CD99 engagement: an effective therapeutic strategy for Ewing tumors, Cancer Res. 60 (2000) 5134e5142. [29] A.F. O'Neill, J.L. Dearling, Y. Wang, et al., Targeted imaging of Ewing sarcoma in preclinical models using a 64Cu-labeled anti-CD99 antibody, Clin. Cancer Res. 20 (2014) 678e687.
705
[30] C. Guerzoni, V. Fiori, M. Terracciano, et al., CD99 triggering in Ewing sarcoma delivers a lethal signal through p53 pathway reactivation and cooperates with doxorubicin, Clin. Cancer Res. 21 (2015) 146e156. [31] B. Czogalla, M. Kahaly, D. Mayr, et al., Interaction of ERa and NRF2 impacts survival in ovarian cancer patients, Int. J. Mol. Sci. 20 (1) (2018) pii: E112.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Nrf2 induced cisplatin resistance in ovarian cancer by promoting CD99 expression Jianfa Wu, Li Zhang, Huixin Li, Suqin Wu**, Zhou Liu* Department of Gynecology, Shanghai University of Medicine & Health Sciences Affiliated Zhoupu Hospital, Shanghai, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 August 2019 Received in revised form 22 August 2019 Accepted 22 August 2019 Available online 28 August 2019
Cisplatin resistance is a vital obstacle for the prognosis of ovarian cancer. However, the mechanism of cisplatin resistance is still unknown. This research was performed to explore the role of Nrf2 (nuclear factor, erythroid 2 like 2) and CD99 (CD99 molecule) in cisplatin resistance in ovarian cancer. QRT-PCR and Western blot were used to detect the expression of CD99 in ovarian cancer cells and tissues with different cisplatin sensitivities. Cell viability was analyzed by the Cell Counting Kit-8 (CCK8). The relationship of Nrf2 and CD99 was assessed by dual-luciferase reporter gene assay and chromatin immunoprecipitation (ChIP). Bioinformatics analysis was performed to search for the downstream gene of CD99. In this study, it was revealed that CD99 was highly expressed in cisplatin-resistant ovarian cancer cells and tissues, while lower CD99 expression was found in cisplatin-sensitive ovarian cancer cells and tissues. In addition, the overexpression of CD99 resulted in cisplatin resistance; on the other hand, knockdown of CD99 sensitized ovarian cancer to cisplatin. Furthermore, survival analysis indicated that overall survival (OS) and progression-free survival (PFS) of patients with higher CD99 expression were shorter than those with lower CD99 expression. It was also found that when Nrf2 was upregulated in cisplatin-sensitive ovarian cells, CD99 expression and cell viability increased after cisplatin treatment. Knockdown of CD99 could reverse cisplatin resistance induced by Nrf2. Conversely, when Nrf2 was knocked down in cisplatin-resistant ovarian cancer cells, CD99 expression and cell viability with cisplatin treatment decreased, while simultaneously upregulating CD99 reactivated cisplatin resistance in ovarian cancer cells. The dual-luciferase reporter gene assay and ChIP analysis suggested CD99 was a downstream gene of Nrf2, and Nrf2 positively regulated the expression of CD99 at the transcriptional level. In conclusion, Nrf2 induced cisplatin resistance in ovarian cancer cells by promoting CD99 expression. Targeted CD99 might be an effective way to reverse cisplatin resistance in ovarian cancer. © 2019 Elsevier Inc. All rights reserved.
Keywords: Ovarian neoplasms Cisplatin Nrf2 CD99 Chemoresistance
1. Introduction Ovarian cancer is one of the most common gynecological malignancies. In 2019, 22,530 new cancer cases and 13,980 cancer deaths are projected to occur in the United States [1]. Five-year relative survival rate for ovarian cancer was 47% from 2008 to 2014 [2]. Cisplatin resistance is considered to be an important reason for poor prognosis of women with ovarian cancer [3]. However, the mechanism of cisplatin resistance is still unknown. Our previous research revealed that the Nrf2-signaling pathway activation led to cisplatin resistance through autophagy activation
* Corresponding author. 1500 Zhouyuan Road, Shanghai, 201318, China. ** Corresponding author. 1500 Zhouyuan Road, Shanghai, 201318, China. E-mail addresses: [email protected] (S. Wu), [email protected] (Z. Liu). https://doi.org/10.1016/j.bbrc.2019.08.113 0006-291X/© 2019 Elsevier Inc. All rights reserved.
in ovarian cancer [4]. To study the mechanism of Nrf2, gene microarray analysis was performed. Interestingly, CD99 was considered to be a potential downstream gene of Nrf2 [5]. CD99 is coded by MIC2 (MHC class I related antigen 2) and located in the pseudoautosomal region 1 (PAR1) of X and Y chromosome as a single-pass type I membrane protein, which is involved in apoptosis, adhesion, differentiation, and protein trafficking [6]. In addition, the encoded protein may rearrange the actin cytoskeleton of many immune cells including leukocytes, monocytes, and CD34 þ cells to induce transendothelial migration [7]. CD99 has been considered to be an essential marker for Ewing sarcoma [8]. Furthermore, previous studies revealed that CD99 marked malignant myeloid stem cells, a potential therapeutic target in acute myeloid leukemia and the myelodysplastic syndromes [9,10]. Moreover, CD99 has been reported to affect the migration, invasion, and metastasis of tumor cells, while targeting
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
murine CD99 by a conjugate vaccine resulted in inhibition of tumor growth in a tumor model both with high CD99 and low CD99 expression [11]. However, there is still controversy about the relationship between CD99 and different cancers. In most tumors such as lymphoblastic lymphoma, myeloid malignancy, malignant glioma, synovial sarcoma, mesenchymal chondrosarcoma, rhabdomyosarcoma, thymic tumor, gastrointestinal and pulmonary neuroendocrine tumor, and breast carcinoma, CD99 has been considered to be oncogene [12,13]. However, in other tumors, including osteosarcoma, pancreatic endocrine neoplasms, and gastric adenocarcinoma, CD99, which has been considered to be tumor suppressor gene, was absent [14]. In ovarian cancer, CD99, as a biological marker, has been reported to play an important role in ovarian granulosa cell tumor diagnosis [15,16]. However, the role of CD99 in cisplatin resistance in ovarian cancer was still unknown. In this study, it was revealed that CD99, as a downstream gene of Nrf2, resulted in cisplatin resistance. Deletion of CD99 sensitized ovarian cancer to cisplatin. Furthermore, progression-free survival (PFS) and overall survival (OS) of ovarian cancer patients with higher CD99 expression were shorter than those of patients with lower CD99 expression. This study provided us with a better understanding of the role of CD99 in cisplatin resistance in ovarian cancer. 2. Materials and methods
699
2.3. Plasmid and small interfering RNA construction CD99 CDS was amplified using primer sequence as follows: Forward, AATTCCTCGAGACTAGTTATGGCCCGCGGGGCT; reverse, ATCCGCGGCCGCTCTAGTTTCTCTAAAAGAGTACGCTGAACAGC. The purified PCR products were cloned into the Plvx-IRES-ZsGreen1 vector. Sequencing analysis was performed to confirm the integrity of plasmid constructs. Human CD99 siRNA and its control siRNA were constructed by Riobobio (Guangzhou, China). CD99 siRNA sequence was as follows: sense strand 50 -GGCUGGCCAUUAUUAAGUCTT-30 and antisense strand 50 -GACUUAAUAAUGGCCAGCCTT-30 .
2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) QRT-PCR was performed on the ABI PRISM 7500 (ABI,USA) using FastQuant RT Super Mix (TIANGEN, Beijing, China). Primers for qRTPCR were as follows: CD99, forward, GCGAGTGACGACTTCAACCTGG, reverse, CGTCCTCCAGGTCGAAGCCTC, b-actin, forward, TTGTTACAGGAAGTCCCTTGCC, reverse, ATGCTATCACCTCCCCT GTGTG. QRT-PCR conditions were as follows: predenaturation, one cycle at 95 C for 10 s, 40 cycles at 95 C for 5 s, 60 C for 31 s, and one cycle for melting curve analysis (95 C for 15 s, 60 C for 30 s, 95 C for 15 s). b-Actin was used as the normalizing gene. All PCRs were performed in triplicate and the levels of gene expression were quantified by adopting 2eD D Ct value.
2.1. Cell lines and reagents 2.5. Western blot Two paired ovarian cancer cell lines were used to perform this experiment. Cisplatin-resistant A2780CP and its parent cisplatinsensitive A2780 were purchased from ATCC (http://www.atcc.org/ ), which were grown in Dulbecco's modified Eagle's medium (DMEM). Cisplatin-resistant COC1/DDP and its parent cisplatinsensitive COC1 were purchased from Peking Union Medical College (Beijing, China), which were grown in RPMI-1640 medium. Ten percent fetal bovine serum (GIBCO, Australia), penicillin (100 U/ mL), and streptomycin sulfate (100 mg/mL) were added to culture mediums. All cells were grown at 37 C in a humid incubator under 5% CO2. Cisplatin was purchased from Aladdin (Aladdin Industrial, Shanghai, China), which was dissolved in dimethyl sulfoxide with a concentration of 5 mg/ml and was stored at 80 C. 2.2. Collection and tumor specimens Fourteen ovarian cancer patients from August 2015 to July 2016 at Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) were enrolled in this study. All patients consented to this study. This study was approved by the ethics board of Obstetrics and Gynecology Hospital. Without any drug treatment before surgery, all specimens were collected under aseptic conditions and immediately snap frozen in liquid nitrogen within 10 min and then stored at 80 C. All patients’ information is shown in Table 1. Table 1 Patients’ basic information characteristics.
Age Stage Ie II III-IV Lymphatic metastasis Yes No CD99
High Nrf2 group
Low Nrf2 group
P value
57.43 ± 3.92
56.00 ± 4.14
0.81 0.56
1 6
3 4 0.46
0 7 0.24 ± 0.06
2 5 0.08 ± 0.01
0.01
Cells were incubated with CD99 overexpression plasmid or CD99 siRNA and lysed after 48 h. Subsequently, 30 mg proteins were separated by SDS-PAGE and transferred to nitrocellulose filter membranes (Millipore, Bedford, MA). The membranes were blocked with 5% non-fat milk and incubated with Anti-CD99 (1:500, ab108297, Abcam, Cambridge, MA, USA), Anti-Nrf2 (1:500, ab246229, Abcam, Cambridge, MA, USA), and b -actin (1:5000, Sigma, St. Louis, MO). The secondary antibodies were purified antirabbit IgG antibody and anti-mouse IgG antibody, which were conjugated to horseradish peroxidase (1:5000, Cell Signaling Technology, Boston, USA). The expression of relative proteins was visualized with SuperSignal West Femto Maximum Sensitivity Substrate (WBKLS0500, MERCK, German). All blots were performed in triplicate. Band intensity was quantified with ImageJ software (National Institute of Health, Bethesda, MD, USA).
2.6. Cell viability analysis Cells were seeded into 96-well plates. After 24 h, different concentrations of cisplatin were added to cells for 24 h. Cell proliferation was then analyzed by CCK8 assay according to the manufacturer's recommendations (Dojin Laboratory, Kumamoto, Japan). The microplate reader was used to measure the absorbance at a wavelength of 450 nm (Model 680, Bio-Rad Laboratories, Hercules, CA, USA). All data were performed in three independent experiments.
2.7. Chromatin immunoprecipitation (ChIP) assay ChIP experiment was carried out with EZChIP™ Kit (17e371, Millipore, Darmstadt, Germany). The process of ChIP was conducted according to our previous article described [17]. Primers sequence was as follows: forward, GTGCCACTACAGTTAAGGGC; reverse, CCTTCTCAGGAAACTGCCCAC.
700
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
2.8. Dual-luciferase reporter assay
3. Results
To certify the relationship of Nrf2 and CD99, dual-luciferase reporter assay was performed as previously described [17]. PGL3CD99 promoter, different pGL3-CD99 promoter truncated bodies, and pGL3-CD99 promoter mut were constructed by YUSEN biological company. pGL3-CD99 promoter, Plvx-IRES-ZsGreen1-NRF2, Plvx-IRES-ZsGreen1, and Renilla plasmid were co-transfected to HEK-293T. The experiment process and analysis of results were performed as previously described [17].
3.1. Expression of CD99 in ovarian cancer cells and tissues with different cisplatin sensitivity
2.9. Statistical analysis All statistical analyses were performed using SPSS software (version 22). According to the sample size, the counting data were analyzed by the chi-square test, chi-square test of continuous correction or Fisher's exact probability method. For measurement data, two independent-samples Student t-test, corrected t-test, or Wilcoxon rank-sum test was used to compare differences between the two groups. The differences were considered significant when a two-sided P value < 0.05.
It was revealed that CD99 was a potential targeted molecule of Nrf2 in our previous gene chip [5]. To assess the role of CD99 in cisplatin resistance induced by Nrf2, qRT-PCR and Western blot were used. Interestingly, as shown in Fig. 1A, CD99 expression level was higher in cisplatin-resistant ovarian cancer cells than in cisplatin-sensitive ovarian cancer cells. Furthermore, differences in CD99 expression were also compared in tissue level through bioinformatics analysis methods with another gene chip GDS4950 [18]. It was apparent that CD99 expression in cisplatin-resistant ovarian cancer tissue was also higher than that in cisplatinsensitive ovarian cancer tissue (Fig. 1B). These data suggests that CD99 is a potential targeted gene of cisplatin resistance. 3.2. Overexpression of CD99 resulted in cisplatin resistance To validate the impact of CD99 on cisplatin resistance in ovarian
Fig. 1. Relationship between CD99 and cisplatin resistance in ovarian cancer. (A) The expression of CD99 in cisplatin-sensitive ovarian cancer cells: A2780 and COC1 and their paired cisplatin-resistant ovarian cancer cells: A2780CP and COC1/DDP. (B) The expression of CD99 in different ovarian cancer tissues with different cisplatin sensitivity. (C) A2780 and COC1 were transfected with 2 mg Plvx-IRES-ZsGreen1-CD99 vector or its control for 6 h. A2780CP and COC1/DDP were transfected with 5 ml CD99 siRNA or its control for 6 h. After 48 h, with different concentrations of cisplatin for 24 h, cell viability was detected by CCK8 assay. (D) The 1,656 ovarian cancer patients were divided into two groups according to the expression of CD99 at cut value 1709: the Low group (N ¼ 940) and the High group (N ¼ 716). OS of patients were compared between two groups. The 1,435 ovarian cancer patients were divided into two groups according to the expression of CD99 at cut value 1710: the Low group (N ¼ 796) and the High group (N ¼ 639). PFS of patients were compared between two groups. *P ˂ 0.05, **P ˂ 0.01, ***P ˂ 0.001.
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
cancer cells, stimulation of CD99 expression was performed in A2780 and COC1 with CD99 overexpression vector. With different concentrations of cisplatin for 24 h, higher cell viability was observed in the CD99 overexpression group than in the control group (Fig. 1C, P ˂ 0.05). On the other hand, knockdown of CD99 in A2780CP and COC1/DDP cells with CD99 specific siRNA led to lower cell viability (Fig. 1C, P ˂ 0.05). Survival analysis was also performed through Kaplan-Meier plotter according to the previous article [19]. Of the 1,656 patients who had overall survival (OS) follow-up data and 1,435 patients who had progression-free survival (PFS) followup data, it was observed that patients with lower expression of CD99 had longer OS (Fig. 1D, HR ¼ 1.18 [1.03e1.34]) and PFS (Fig. 1D, HR ¼ 1.16 [1.02e1.32]). These data suggest that CD99 is associated with cisplatin resistance and prognosis of ovarian cancer.
701
3.3. Relationship between Nrf2 and CD99 The correlation between Nrf2 and CD99 was tested using T-tests. As Fig. 2A shows, when Nrf2 was upregulated by Plvx-IRESZsGreen1-NRF2 vector in A2780 and COC1 ovarian cancer cells, mRNA and protein expression of CD99 increased (P ˂ 0.001). Conversely, when Nrf2 was inhibited by Nrf2 specific siRNA in A2780CP and COC1/DDP ovarian cancer cells, CD99 expression reduced (Fig. 2B, P ˂ 0.05). Further analysis showed that CD99 expression was also higher in the Nrf2 high-expression ovarian cancer tissue group than in the Nrf2 lower-expression ovarian cancer tissue group (Fig. 2C, P ˂ 0.05). Furthermore, Pearson correlation analysis indicated that there was a significant positive correlation between Nrf2 and CD99 via GEPIA (http://gepia.cancer-
Fig. 2. Nrf2 induced cisplatin resistance through promoting CD99 expression. (A) After transfection with 2 mg Plvx-IRES-ZsGreen1-NRF2 vector and its control in A2780 and COC1 for 48 h, CD99 expression level was determined by Western blot and qRT-PCR. (B) CD99 expression was also determined by Western blot and qRT-PCR when A2780CP and COC1/DDP were transfected by 5 ml Nrf2 siRNA or its control for 48 h. (C) Fourteen ovarian cancer tissues were divided into two groups according Nrf2 mRNA expression: the high Nrf2 group and the low Nrf2 group. CD99 mRNA expression levels were compared between the two groups. (D) The relationship between Nrf2 and CD99 was determined by Pearson correlation analysis via GEPIA. (E) After transfection with 2 mg Plvx-IRES-ZsGreen1-NRF2 vector and 2 mg pGL3-basic-CD99 promoter vector, relative luciferase activity was analyzed compared to its control. (F) After transfection with 2 mg Plvx-IRES-ZsGreen1-NRF2 vector, or 2 mg Plvx-IRES-ZsGreen1-NRF2 vector and 5 ml CD99 siRNA, or their control (NC) in A2780 and COC1 for 48 h, cell viability was compared between the first two group. (G) After transfected with 5 ml Nrf2 siRNA, or 5 ml Nrf2 siRNA and 2 mg Plvx-IRESZsGreen1-CD99 vector, or their control (NC) in A2780CP and COC1/DDP for 48 h, cell viability was compared between the first two groups. *P ˂ 0.05, **P ˂ 0.01, ***P ˂ 0.001.
702
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
pku.cn/) according to a previous article [20] (Fig. 2D, R ¼ 0.69). To certify regulatory relationship of Nrf2 on CD99, dual-luciferase reporter gene assay was adopted. When Plvx-IRES-ZsGreen1NRF2 overexpression vector and pGL3-basic-CD99 promoter vector were co-transfected, relative luciferase activity analysis indicated that CD99 expression was higher than in its control group (Fig. 2E, P ˂ 0.001). All these data suggest that CD99 is a downstream gene of Nrf2, and Nrf2 plays an important role on CD99 expression. 3.4. CD99 reversed cisplatin resistance induced by Nrf2 To assess the effect of CD99 on cisplatin resistance induced by Nrf2, a recovery test was performed. Interestingly, when Nrf2 overexpression vector was transfected to A2780 or COC1, with different concentrations of cisplatin for 24 h, cell viability increased compared to its control. However, when CD99 siRNA was simultaneously transfected to A2780 or COC1, cell viability decreased significantly (Fig. 2F). Similarly, when Nrf2 siRNA was transfected to A2780CP or COC1/DDP, with different concentrations of cisplatin for 24 h, cell viability decreased, while cell viability increased when
CD99 overexpression vector was simultaneously transfected to A2780CP or COC1/DDP (Fig. 2G). These data suggest that Nrf2 induced cisplatin resistance through promoting CD99 expression. 3.5. Nrf2 promoted CD99 expression at the transcriptional level In order to search the binding site of Nrf2 on CD99, truncated CD99 promoter reporter gene sequences with different lengths were constructed. With relative luciferase activity analysis, it was found that only with a specific DNA sequence (0 and 500 bp upstream of the transcription initiation site), CD99 expression was higher than in its control group (Fig. 3A, P ˂ 0.001), which suggested that the binding site of Nrf2 on CD99 was between 0 and -500 bp upstream of the transcription initiation site. Furthermore, according to predicted DNA sequence with PROMO (http://alggen.lsi.upc. es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB) [21,22], PGL3basic-mut CD99 promoter vector was constructed. However, when Plvx-IRES-ZsGreen1-NRF2 overexpression vector and PGL3basic-mut CD99 promoter vector were co-transfected, there were no differences to be found between the two groups (Fig. 3B, P ˃
Fig. 3. Relationship between Nrf2 and CD99. (A) With different lengths of pGL3-basic-CD99 promoter truncated bodies and Plvx-IRES-ZsGreen1-NRF2 vector, relative luciferase activity was analyzed compared to control. (B) With Plvx-IRES-ZsGreen1-NRF2 vector and PGL3-basic-CD99 promoter mut vector (400 ACCTTGAGGGA -390), which was from a mutation of PGL3-basic-CD99 promoter (400 ACCGGGAGGGA -390), relative luciferase activity was compared to its control. (C) ChIP analysis was employed to determine the relationship between Nrf2 and CD99. Blank control: without DNA; Input: total DNA; Negative control: mouse IgG; Positive control: GAPDH antibody. ***P ˂ 0.001.
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
0.05). These data suggest that CD99 is a targeted gene of Nrf2. ChIP analysis was used to assess the relationship between Nrf2 and CD99. With designed primer for potential Nrf2 binding sequence, we found a direct relationship between Nrf2 and CD99 (Fig. 3C).
3.6. Interaction protein network of CD99 In this study, 18 interacting proteins of CD99 were detected through STRING (https://string-db.org/) and GPS-PLO (http:// gpsprot.org/index.php) (Fig. 4A and B) [23]. Then, to study the relationship between them, Pearson correlation analysis was employed via GEPIA. Surprisingly, CD99 molecule like 2 (CD99L2), serologically defined colon cancer antigen 3 (SDCCAG3), and small glutamine rich tetratricopeptide repeat containing alpha (SGTA) were found to be positively related to CD99 (Fig. 4C), whereas cadherin 1 (CDH1), peptidylprolyl isomerase A (PPIA), and thyroid hormone receptor interactor 13 (TRIP13) were revealed to be negatively associated with CD99 (Fig. 4D). These data suggest that they may be important components of CD99-signaling pathway networks.
703
4. Discussion CD99, as a transmembrane glycoprotein, has attracted increasing attention in recent years [24]. However, its role in tumor drug resistance was still unknown, especially with regard to ovarian cancer. The results of this study indicate that CD99 overexpression results in cisplatin resistance not only in ovarian cancer cells, but also in ovarian tissues. These findings might help us to understand the mechanism of cisplatin resistance in ovarian cancer. Prior studies have noted the importance of CD99 antibody targeted therapy [25e28]. The present study raises the possibility that ovarian cancer cells are sensitized by targeting CD99. This is an important issue for future research. Furthermore, previous studies revealed that (64)Cu-labeled anti-CD99 antibodies have been found to increase the sensitivity of tumor diagnosis, which was considered superior to fluoro-2-deoxy-D-glucose-positron emission tomography (FDG-PET) [29]. This finding suggests that CD99 may be regarded as a diagnostic marker, which could be used to predict cisplatin resistance in ovarian cancer. Certainly, more research is needed to determine the diagnostic effect of (64)Cu-labeled anti-
Fig. 4. Interaction protein network of CD99. (A)Interaction protein network of CD99 from STRING. (B) Interaction protein network of CD99 from GPS-PLO. (C) Correlation analysis between CD99 and CD99L2, SDCCAG3, and SGTA in ovarian cancer tissues via GEPIA. (D) Correlation analysis between CD99 and CDH1, PPIA, and TRIP13 in ovarian cancer tissues via GEPIA.
704
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705
CD99 antibodies in cisplatin resistance of ovarian cancer. Regarding cancer development, aggressiveness, migration, and invasion, prior studies have noted that CD99 plays an important role [6]. For example, Manara MC et al. showed that CD99 induces methuosis of Ewing sarcoma cells through IGF-1R/RAS/Rac1 signaling [8]. Guerzoni C et al. reported that targeted CD99 induced rapid and massive EWS cell death through Mdm2 degradation and p53 reactivation [30]. Cerisano V et al. found that CD99 induced caspase-independent cell death and cell-cell adhesion in Ewing's sarcoma cells via actin and zyxin [26]. However, the role of CD99 in cancer was still under research, and CD99-signaling pathway networks was still unclear 6. In this study, CD99L2, SDCCAG3, and SGTA were found to be positively related to CD99, while CDH1, PPIA, and TRIP13 were revealed to be negatively associated with CD99. These results may support the hypothesis that CD99L2, SDCCAG3, SGTA, CDH1, PPIA, and TRIP13 are involved in cisplatin resistance induced by CD99. Certainly, further work is required to certify the relationship between them. Nrf2, as a key gene of anti-oxidative stress signaling, was revealed to impact the survival of ovarian cancer patients [31]. Furthermore, Nrf2 was also deemed to be associated with cisplatin resistance in ovarian cancer [4,5,17]. However, the specific regulatory mechanism of Nrf2 in cisplatin resistance of ovarian cancer was still under research. In this study, it was first suggested that CD99 was a crucial downstream gene of Nrf2. The present results are significant in at least two major respects. For one thing, this deepens our understanding of Nrf2-signaling pathway networks. For another, CD99 can now be considered to be a new targeted gene to reverse the resistance of ovarian cancer. However, several questions remain unanswered at present. For example, the mechanism of CD99-induced cisplatin resistance in ovarian cancer is still unknown. Functional verification of CD99 resistance in vivo has not been carried out. The effectiveness of CD99 antibody in reversing ovarian cancer resistance is still unclear. Further studies that take these variables into account will be undertaken to resolve these problems. Notwithstanding these limitations, the research has also suggested that CD99 is a crucial downstream gene of Nrf2, which is associated with cisplatin resistance. Targeted CD99 sensitizes ovarian cancer to cisplatin. This study contributes to our understanding of cisplatin resistance in ovarian cancer and enriched Nrf2-signaling pathway networks. Furthermore, the findings reported here shed new light on our future research. In future, more focus will be on functional verification of CD99 targeting in vivo. It is hoped that CD99 antibodies can improve the resistance of ovarian cancer patients. Funding The study was supported by grants from the seed fund program of Shanghai University of Medicine & Health Sciences (Grant No. SFP-18-21-17-001) and key disciplines of Pudong New Area Health and Family Planning Commission (Grant No. PWZxk2017-14). Authors’ contributions Jianfa Wu designed the project, accomplished the study, and wrote the manuscript; Li Zhang accomplished the study; Huixin Li provided data collection support; Suqin Wu performed statistical analysis; and Zhou Liu wrote and finalized the manuscript. Conflicts of interest The authors declare no conflict of interest.
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.08.113 References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, CA A Cancer J. Clin. 69 (1) (2019) 7e34 (2019). [2] K.D. Miller, R.L. Siegel, C.C. Lin, et al., Cancer treatment and survivorship statistics, CA A Cancer J. Clin. 66 (4) (2016) 271e289 (2016). [3] D. Holmes, Ovarian cancer: beyond resistance, Nature 527 (7579) (2015) S217. [4] L.J. Bao, M.C. Jaramillo, Z.B. Zhang, et al., Nrf2 induces cisplatin resistance through activation of autophagy in ovarian carcinoma, Int. J. Clin. Exp. Pathol. 7 (4) (2014) 1502e1513. [5] L. Bao, J. Wu, M. Dodson, et al., ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells, Mol. Carcinog. 56 (6) (2017) 1543e1553. [6] M. Pasello, M.C. Manara, K. Scotlandi, CD99 at the crossroads of physiology and pathology, J. Cell Commun.Signal 12 (1) (2018) 55e68. [7] R.L. Watson, J. Buck, L.R. Levin, et al., Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration, J. Exp. Med. 212 (2015) 1021e1041. [8] M.C. Manara, M. Terracciano, C. Mancarella, et al., CD99 triggering induces methuosis of Ewing sarcoma cells through IGF-1R/RAS/Rac1 signaling, Oncotarget 7 (48) (2016) 79925e79942. [9] K. Kingwell, Cancer: CD99 marks malignant myeloid stem cells, Nat. Rev. Drug Discov. 16 (3) (2017) 166. [10] M. Tavakkoli, S.S. Chung, C.Y. Park, Do preclinical studies suggest that CD99 is a potential therapeutic target in acute myeloid leukemia and the myelodysplastic syndromes? Expert Opin. Ther. Targets 22 (5) (2018) 381e383. [11] E.J.M. Huijbers, I.M. van der Werf, L.D. Faber, et al., Targeting tumor Vascular CD99 Inhibits tumor growth, Front. Immunol. 10 (2019) 651. [12] S.S. Chung, W.S. Eng, W. Hu, et al., CD99 is a therapeutic target on disease stem cells in myeloid malignancies, Sci. Transl. Med. 9 (374) (2017) pii: eaaj2025. [13] U. Urias, S.K. Marie, M. Uno, et al., CD99 is upregulated in placenta and astrocytomas with a differential subcellular distribution according to the malignancy stage, J. Neuro Oncol. 119 (2014) 59e70. [14] C. Zucchini, M.C. Manara, R.S. Pinca, et al., CD99 suppresses osteosarcoma cell migration through inhibition of ROCK2 activity, Oncogene 33 (15) (2014) 1912e1921. [15] E.A. Jarboe, S.L. Hirschowitz, K.B. Geiersbach, et al., Juvenile granulosa cell tumors: immunoreactivity for CD99 and Fli-1 and EWSR1 translocation status: a study of 11 cases, Int. J. Gynecol. Pathol. 33 (1) (2014) 11e15. [16] Y.L. Choi, H.S. Kim, G. Ahn, Immuno expression of inhibin alpha subunit, inhibin/activin betaA subunit and CD99 in ovarian tumors, Arch. Pathol. Lab Med. 124 (4) (2000) 563e569. [17] J. Wu, L. Bao, Z. Zhang, et al., Nrf2 induces cisplatin resistance via suppressing the iron export related gene SLC40A1 in ovarian cancer cells, Oncotarget 8 (55) (2017 Jul 25) 93502e93515. [18] M. Koti, R.J. Gooding, P. Nuin, et al., Identification of the IGF1/PI3K/NF kB/ERK gene signalling networks associated with chemotherapy resistance and treatment response in high-grade serous epithelial ovarian cancer, BMC Canc. 13 (2013) 549. [19] B. Gyorffy, A. Lanczky, Z. Szallasi, Implementing an online tool for genomewide validation of survival-associated biomarkers in ovarian-cancer using microarray data from 1287 patients, Endocr. Relat. Cancer 19 (2) (2012) 197e208. [20] Z. Tang, C. Li, B. Kang, et al., GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses, Nucleic Acids Res. 45 (W1) (2017) W98eW102. nec Farre , et al., PROMO: detection of [21] Xavier Messeguer, Ruth Escudero, Dome known transcription regulatory elements using species-tailored searches, Bioinformatics 18 (2) (2002) 333e334. nec Farre , Rom [22] Dome a Roset, Mario Huerta, et al., Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN, Nucleic Acids Res. 31 (13) (2003) 3651e3653. [23] M.E. Fahey, M.J. Bennett, C. Mahon, et al., GPS-Prot: a web-based visualization platform for integrating host-pathogen interaction data, BMC Bioinf. 12 (2011) 298. [24] M.C. Manara, M. Pasello, K. Scotlandi, CD99: a cell surface protein with an oncojanus role in tumors, Genes 9 (3) (2018) pii: E159. [25] Z. Husak, M.N. Dworzak, CD99 ligation upregulates HSP70 on acute lymphoblastic leukemia cells and concomitantly increases NK cytotoxicity, Cell Death Dis. 3 (2012) e425. [26] V. Cerisano, Y. Aalto, S. Perdichizzi, et al., Molecular mechanisms of CD99induced caspase-independent cell death and cell-cell adhesion in Ewi'g0 s sarcoma cells: actin and zyxin as key intracellular mediators, Oncogene 23 (2004) 5664e5674. [27] Z. Husak, D. Printz, A. Schumich, et al., Death induction by CD99 ligation in TEL/AML1-positive acute lymphoblastic leukemia and normal b cell precursors, J. Leukoc. Biol. 88 (2010) 405e412.
J. Wu et al. / Biochemical and Biophysical Research Communications 518 (2019) 698e705 [28] K. Scotlandi, N. Baldini, V. Cerisano, et al., CD99 engagement: an effective therapeutic strategy for Ewing tumors, Cancer Res. 60 (2000) 5134e5142. [29] A.F. O'Neill, J.L. Dearling, Y. Wang, et al., Targeted imaging of Ewing sarcoma in preclinical models using a 64Cu-labeled anti-CD99 antibody, Clin. Cancer Res. 20 (2014) 678e687.
705
[30] C. Guerzoni, V. Fiori, M. Terracciano, et al., CD99 triggering in Ewing sarcoma delivers a lethal signal through p53 pathway reactivation and cooperates with doxorubicin, Clin. Cancer Res. 21 (2015) 146e156. [31] B. Czogalla, M. Kahaly, D. Mayr, et al., Interaction of ERa and NRF2 impacts survival in ovarian cancer patients, Int. J. Mol. Sci. 20 (1) (2018) pii: E112.