p48 and cell proliferation

GASTROENTEROLOGY 2004;127:937–949

PTF1␣/p48 and Cell Proliferation ANNIE RODOLOSSE,*,‡ ELISABET CHALAUX,*,‡ TERESA ADELL,* HÉLÈNE HAGÈGE,* ANOUCHKA SKOUDY,*,‡ and FRANCISCO X. REAL*,‡ *Unitat de Biologia Cellular i Molecular, Institut Municipal d’Investigació Mèdica, Barcelona, and ‡Departament de Ciències Experimentals i de la Salut, Facultat de Ciències de la Salut i de la Vida, Universitat Pompeu Fabra, Barcelona, Spain

Background & Aims: The basic helix-loop-helix transcription factor pancreas-specific transcription factor 1␣ (PTF1␣)/p48 is critical for committing cells to a pancreatic fate and for the maintenance of the differentiated state in acinar cells. The aim was to analyze the ability of p48 to modulate cell proliferation, its relationship with cell differentiation, and the mechanisms involved therein. Methods: Pancreatic and nonpancreatic cells were transfected with p48 cDNA, and the effects on cell proliferation were examined. The effects on cell cycle regulators were analyzed by Western blotting and RTPCR; transient transfection assays were used to analyze promoter regulation. Results: p48 Inhibited proliferation of acinar and nonacinar cells by inducing a delay in G1-S progression through the up-regulation of p21CIP1/WAF1 and p27KIP1 and the down-regulation of cyclin D2. A 2-fold increase in p21CIP1/WAF1 mRNA and in the activity of the p21CIP1/WAF1 promoter was observed. The growth inhibition action of p48 was not associated with exocrine differentiation or with apoptosis. The antiproliferative effects were dependent on the COOH-terminal region of p48 and did not require the bHLH domain. Loss of p48 expression occurring during acinar-to-ductal transitions, characteristic of chronic pancreatitis, was associated with an increase of cell proliferation in ductal complexes. Conclusions: The results indicate that p48 couples cell proliferation and cell differentiation in the exocrine pancreas, thus contributing to tissue homeostasis. These effects may play a role in the increased risk for pancreatic cancer associated with chronic pancreatitis.

ancreas-specific transcription factor 1␣ (PTF1␣)/p48 is a pancreas-specific member of the basic helix-loophelix (bHLH) family of transcriptional regulatory proteins that are required for a wide range of developmental and differentiation processes in nervous tissue, muscle, hematopoietic cells, and pancreas (reviewed in Massari and Murre1). Mammalian bHLH transcription factors have been classified in 2 groups. Class A bHLH molecules (also referred as the “E” proteins) include the ubiquitously expressed proteins E12 and E47 (encoded by E2A), HEB, and E2-2 that are capable of forming either

P

homo- or heterodimers.2 Class B bHLH proteins display a tissue-restricted pattern of expression, preferentially heterodimerize with class A proteins, and include the muscle-specific factors MyoD and myogenin, neurogenins, NeuroD, and PTF1␣/p48.1 The current paradigm for their mechanism of action is that bHLH heterodimers bind to the DNA consensus sequence CANNTG— known as E box—present in a wide variety of promoter and enhancer elements that regulate tissuespecific gene expression.3– 6 In the pancreas, acinar-specific gene expression is under control of the pancreas tissue-specific transcription factor PTF1, a hetero-oligomeric protein complex that binds to transcriptional enhancers of genes encoding the products of the exocrine pancreas.7 The PTF1 complex is constituted by 3 distinct bHLH proteins. p75 Is a product of the E2A gene, does not contact the DNA directly, and has been proposed to be required for the import of the complex into the nucleus.8 The 2 DNA-binding subunits are p64 —reported to be an isoform of the HEB gene resulting from alternative use of exon 1 (Wellauer P. and Hagenbüchle O., personal communication, August 1997, and Adell et al.9)—and PTF1␣/p48. The latter proteins have been found to bind to the PTF1 bipartite cognate site7,10 through a TGGGA sequence and an E box, respectively. The p48 subunit is the only pancreas-specific constituent of the PTF1 complex,11 and its expression is restricted to acinar cells in the normal adult pancreas.9 An antisense RNA-mediated reduction of p48 synthesis in cultured AR42J exocrine pancreatic cells led to the inhibition of the exocrine transcription program.11 Moreover, in vitro acinar-to-ductal transdifferentiation of normal exocrine Abbreviations used in this paper: bHLH, basic-helix-loop-helix; BrdU, bromodeoxyuridine; CDKI, cyclin-dependent kinase inhibitor; HES, hairy enhancer of split; MT, metallothionein; PTF1␣, pancreas-specific transcription factor 1␣; RT-PCR, reverse-transcription polymerase chain reaction; SDS-PAGE, sodium dodecyl sulphate-polyacrylamide gel electrophoresis; TBST, Tris-buffered saline containing 0.1% Tween 20. © 2004 by the American Gastroenterological Association 0016-5085/04/$30.00 doi:10.1053/j.gastro.2004.06.058

938

RODOLOSSE ET AL.

pancreas is associated with a loss of the activity of the PTF1 complex because of the selective down-regulation of p48 expression.12 These findings indicate that p48 is essential for maintaining the terminally differentiated state in acinar cells. An unexpected role of p48 in the developing mouse embryo was unfolded upon its inactivation by homologous recombination: homozygous null mice lack a pancreas and contain a reduced number of single endocrine hormone-producing cells misallocated to the spleen.13,14 A role for p48 early in the course of pancreatic development is also supported by the observation that p48 mRNA is first detected at e9.5 using reverse-transcription polymerase chain reaction (RTPCR).13,15 p48 protein is detectable at e10.5,16 shortly after the onset on endodermal budding that forms the pancreatic anlage, and precedes by several days the appearance of the PTF1 complex, at day 15 of gestation.11,17 Recently, recombination-based lineage tracing studies have revealed that p48 is expressed at these stages in pancreatic progenitors present in the pancreatic ducts and becomes restricted to the acinar compartment from e14 onward.11,14 In the absence of p48, progenitors from the dorsal pancreatic bud give rise to the 4 differentiated intestinal cell types. Altogether, these findings support the idea that p48, together with Pdx-1,18 –20 is necessary for committing endoderm to a pancreatic fate and that p48 is required for cells to activate the exocrine fate at later stages of development. Furthermore, Pdx-1 participates in the regulation of acinar-specific gene expression.21 A previous study addressed whether p48 is able, on its own, to instruct an acinar differentiation program in pancreatic cancer cell lines displaying a ductal phenotype and provided evidence that constitutive p48 expression is not sufficient to establish the acinar transcription program.9 In the course of these studies, we noted that stable p48 expression resulted in a reduced number of permanently transfected colonies, a decrease in cell growth, or, in some cases, a growth arrest of p48 expressing cells. In addition, stable transfectants tended to lose p48 expression on continued culture (unpublished data, November 1999). In this report, we show that p48 inhibits cell proliferation of acinar and nonacinar cells by inducing a delay in G1-S progression. We have found that one mechanism underlying the p48-mediated inhibition of cell growth involves changes in the expression of p21CIP1/WAF1, p27KIP1, and cyclin D2. We have identified that antiproliferative activity of p48 maps to its carboxy-terminal region and does not require the bHLH domain. Acinar cells in the pancreas of Ptf1␣Cre/wt mice showed a modest increase in proliferation rate, relative to nonacinar cells. These findings strongly suggest that p48 regulates cell differentiation and cell proliferation in the

GASTROENTEROLOGY Vol. 127, No. 3

exocrine pancreas through distinct molecular mechanisms.

Materials and Methods Mice Pancreatic tissue from transgenic mice expressing transforming growth factor (TGF) ␣ under the control of the metallothionein (MT) promoter (MT-TGF-␣) and corresponding control mice was obtained from E. Sandgren (University of Wisconsin, MA). Breeding, genotyping, and transgene induction were performed as described elsewhere.22 Pancreata from male Ptf1␣Cre/wt 14 and Ptf1␣wt/wt littermates of 3– 4 months age (n ⫽ 6 for each genotype) were obtained from P. Herrera (Université de Genève, Switzerland). Experiments were performed on sex- and age-matched littermates.

Cells and Cell Culture RWP-1 human pancreas cancer cells were derived from a liver metastasis from a ductal pancreatic adenocarcinoma23; AR42J rat pancreas cancer cells were derived from an azaserine-induced rat pancreatic acinar tumor.24 Both cell lines were kindly provided by N. Vaysse (INSERM U531, Toulouse, France). Cos-7 cells were obtained from the American Type Culture Collection. 3T3 cells derived from p53 wild-type (WT) or p53⫺/⫺ mice were obtained from P. Muñoz (Centre de Regulació Genòmica, Barcelona, Spain). All cells were cultured in Dulbecco’s modified Eagle’s medium (Life Technologies, Inc., Gaithersburg, MD), supplemented with 10% fetal bovine serum, L-glutamine, nonessential amino acids, penicillin, and streptomycin (complete medium).

Transfections and Plasmids The pIRESneo vector (Clontech Laboratories, Heidelberg, Germany) was used to generate expression plasmids containing the full-length rat p48 cDNA sequence (nucleotides 226 –1206 of the rat p48 cDNA deposited in Genbank, GI:X98170) cloned into EcoRI/BamHI restriction sites. p48 cDNA deletion fragments were generated by PCR from the pIRESp48 plasmid using the following primers: N-bHLH and N⫹bHLH forward primer (TATGAATTCCACCATGGACGCCGTGCTCCTGGAGCATT), N-bHLH reverse primer (TATGGATCCTCAGTTGGCCGCTTGTCGCAGCT), N⫹bHLH reverse primer (CCCGGATCCTCACAGCTCGCTGAGGAAGTTAATGTAGCC), C-bHLH forward primer (GGCGAATTCCACCATGCAGCTGCGACAAGCGGCCAA), C⫹bHLH forward primer (TATGAATTCCACCATGCAGCTGCGACAAGCGGCCAA), C-bHLH and C⫹bHLH reverse primer (TATGGATCCTCAGGACACAAACTCAAAAGGTGGTT). The PCR products were digested with EcoRI and BamHI and inserted in the pIRESneo vector as described previously. Plasmids corresponding to the N-terminal domain, containing (nucleotides 226 – 876) or lacking (nucleotides 226 –729) the bHLH region, or the Cterminal domain, containing (nucleotides 708 –1206) or lacking (nucleotides 855–1206) the bHLH region, were con-

September 2004

structed. The different plasmids described previously showed similar expression efficiency upon transfection. To generate stable p48-expressing cell lines and the corresponding control lines, RWP-1, AR42J, and Cos-7 cells were grown for 24 hours in 6-well plates and transfected with 1 ␮g of the corresponding plasmid using lipofectamine (Lipofectamine Plus Reagent, GIBCO, Gaithesburg, MD) following manufacturer’s instructions. Transfected cells were selected for 14 –20 days in complete medium supplemented with G418 (500 ␮g/mL). p48 Expression was assessed by Western blotting as described later.

Colony Formation Assay To test the colony-forming capacity, pools of G418selected control and p48 transfectants obtained from 3 independent experiments using RWP-1 and AR42J cells were tested for their capacity to form colonies. For AR42J, control and p48 transfectants were seeded at the same density (1000 cells/well) in duplicate in 6-well plates. After 14 days in culture in G418-containing medium, colonies were fixed with 1% glutaraldehyde in phosphate-buffered saline (PBS) for 20 minutes and stained for 1 hour with 0.1% crystal violet (Sigma, St. Louis, MO). For RWP-1, equal amounts of control or p48 transfected cells (5000 cells/well) were resuspended in soft agar medium (DMEM containing 0.3% agar) and seeded in duplicate onto a base of DMEM containing 0.7% agar in 6-well plates. Soft agar cultures were maintained for 2 weeks in medium containing G418. Colonies were scored by visual (for AR42J cells) or microscopic (for RWP-1 cells) inspection and counted. The number of RWP-1 colonies was determined by calculating the average of colonies in 24 random fields at 50⫻ magnification on microscopic inspection. At this magnification, a microscope field corresponds to an area of 0.25 cm2.

Growth Curves and Cell Death Analysis To determine the growth rates of RWP-1 and Cos-7 stable transfectants, cells were seeded in quadruplate in 6-well plates in medium supplemented with G418 and counted over a 7-day (RWP-1) or a 14-day period (Cos-7). Cells were harvested by trypsinization and stained with 0.4% trypan blue solution in PBS to discriminate viable from dead cells. Growth curves were obtained from viable cells counted at each time point. To estimate cell death, the percentage of dead cells was calculated on days 3, 5, 6, and 7 by dividing the number of trypan blue positive cells by the total cell number. DNA fragmentation was analyzed by agarose gel electrophoresis.

Cell Cycle Distribution Control and p48 transfectants were seeded at 150,000 cells/plate in 6-cm-diameter plates and cultured for 24 hours in complete medium. Cells were cultured in serum-free DMEM for 48 hours and for an additional 24 hours in complete medium. For cell cycle analysis, cells were washed twice in PBS, fixed, permeabilized with 70% ethanol for 30 minutes, and resuspended in propidium iodide (PI) staining buffer (1.14 mmol/L sodium citrate, 15 ␮g/mL PI, 0.3 mg/mL ribonucle-

PTF1␣/p48 TRANSCRIPTION FACTOR

939

ase A in PBS). After 30 minutes of incubation at 37°C, flow cytometry was performed using a Becton-Dickinson FACScan. The proliferation index was calculated as the following (percentage cells in S⫹G2/M)/(percentage cells in G0/G1).

Western Blotting Cultured cells were lysed in 25 mmol/L Tris, pH 7.5, 1 mmol/L EGTA, 1 mmol/L EDTA, and 1% SDS containing a protease inhibitor cocktail. Lysates were boiled for 15 minutes, cleared by centrifugation, and protein concentration was determined. Total cell lysates (50 ␮g) were fractionated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Proteins were electroblotted onto nitrocellulose membranes. Nonspecific binding sites of membranes were saturated with 5% skim milk in TBST solution (100 mmol/L Tris-Cl, pH 7.5, 150 mmol/L NaCl, 0.1% Tween 20) and incubated for 1 hour with antibodies at room temperature. The following antibodies were used: affinity-purified rabbit anti-p48,9 monoclonal antibody (mAb) G3-245 detecting Rb (Pharmingen, San Diego, CA), mAb Ab-1 detecting p21CIP1/WAF1 (Calbiochem, San Diego, CA), mAb clone 57 detecting p27KIP1 (Transduction Laboratories, San Diego, CA), rabbit polyclonal antibodies M-20 and H-432 detecting cyclin D1 and cyclin A, respectively (Santa-Cruz Biotechnology, Santa Cruz, CA), rabbit antiserum detecting procaspase-3 (G. Gil; IMIM; Barcelona, Spain), rabbit polyclonal antibodies detecting cleaved caspase-3 (Cell Signaling Technology, Beverly, MA), and mAb AC-15 detecting ␤-actin (Sigma, St. Louis, MO). After 3 washes with TBS, the filters were incubated with peroxidaseconjugated secondary antibody in 0.5% skim milk in TBS for 1 hour at room temperature; reactions were developed using enhanced chemoluminiscence (Amersham Pharmacia Biotechnology, Uppsala, Sweden).

RNA Isolation and Semiquantitative RT-PCR Total RNA was isolated from control and p48 transfectants using Gene Elute mammalian total RNA kit (Sigma). RT-PCR was performed with Ready-to-go RT-PCR beads (Amersham Pharmacia) using serially diluted RNA samples to establish the linearity of the reactions. PCR products were obtained after 32 cycles of amplification with an annealing temperature of 55°C– 62°C and visualized by ethidium bromide staining after agarose electrophoresis. RT-PCR products were semiquantitated after image analysis with Imagegauge software and normalization against the cyclophilin internal control. Primer sequences used for human target gene detection are as follows: p21CIP1/WAF1 (ACTTCCTCCTCCCCACTTGT and CTGTGCTCACTTCAGGGTCA), p27KIP1 (GGCCTCAGAAGACGTCAAAC and CCAACGCTTTTAGAGGCAGA), cyclin D1 (AGGAGAACAAACAGATCA and TAGGACAGGAAGTTGTTG), cyclin D2 (ATTGAACCATTTGGGATGGA and ATGGTGGTGTCTGCAATGAA), cyclin D3 (GTGGCCACTAAGCAGAGGAG and AGCTTGACTAGCCACCGAAA), and cyclophilin (ATGGTCAACCCCACCGTG and TTGCAATCCAGCTAGGCATG).

940

RODOLOSSE ET AL.

Real-Time Quantitative RT-PCR Expression of p21CIP1/WAF1, p27KIP1, and cyclin D2 mRNA in stable transfectants was analyzed with the Quantitect Sybr green RT-PCR kit (Qiagen Inc., Valencia, CA) and quantified using an ABIPRISM 7900HT instrument (Applied Biosystems, Forster City, CA). For each experiment, cells in 3 wells were transfected with empty control or p48-coding plasmid and selected for 14 days. RT-PCR reactions were carried out in triplicate with 10 ng of RNA in a final volume of 20 ␮L. RT-PCR conditions were optimized to minimize differences in RT efficiencies between each target transcript and the cyclophilin internal reference mRNA and enable data to be expressed in relation to cyclophilin. RT-PCR conditions were as follows: 50°C for 30 minutes, 95°C for 15 minutes, then 40 cycles of 95°C for 15 seconds, 59°C for 30 seconds, and 72°C for 30 seconds. Expression level of target genes in control and p48 transfectants was calculated by using the comparative Ct method according to the manufacturer’s guidelines. For each reaction, Ct values (the cycle number at which logarithmic PCR plots cross a calculated threshold line) were determined, and ⌬Ct (Ct of target gene ⫺ Ct of cyclophilin) was calculated. Fold difference in expression of target genes between p48 and control transfectants was determined as 2⫺⌬⌬Ct where ⌬⌬CT ⫽ ⌬Ct of p48 transfectants ⫺ ⌬Ct of control transfectants.

Promoter Activity Assays Twenty-four hours after seeding in 24-well plates, RWP-1 cells were transiently cotransfected with 0.4 ␮g of pIRESneo or pIRESp48 vector, 0.1 ␮g of the p21-luc reporter construct containing the 2.4-kb HindIII fragment of the human p21Cip1/WAF1 promoter inserted into the pGL2 basic vector (a gift from X. H. Sun, Oklahoma Medical Research Foundation, OK) and 15 ng of pRL-TK vector (Promega, Madison, WI) using lipofectamine. The pRL-TK vector was used as an internal control for normalization of luciferase activity. For transcriptional activity analysis of p48 deletion mutants, a reporter construct containing a hexamer of A element of the rat elastase-1 promoter inserted into the pGL3 basic vector (Promega) (6XA26-luc) was generated from the 6A26Elp.hGH reporter plasmid kindly provided by R. MacDonald and G. Swift (UT Southwestern Medical Center, Dallas, TX).25 AR42J cells seeded in 24-well plates were transiently cotransfected as described previously with 0.4 ␮g of pIRESneo vector containing the full-length, or partially deleted, p48, 0.1 ␮g 6XA26-luc reporter plasmid, and 15 ng pRL-TK vector (Promega). Cells were lysed 48 hours after transfection, and luciferase activity was determined using the Dual Luciferase Reporter Assay system (Promega), following the manufacturer’s specifications. Luciferase and Renilla luciferase luminiscence were measured using a luminometer.

BrdU Incorporation Assay RWP-1, 3T3 WT, and 3T3 p53⫺/⫺ cells seeded on coverslips in 24-well plates were transfected with 0.4 ␮g

GASTROENTEROLOGY Vol. 127, No. 3

pIRES-neo control or pIRES-p48 DNA. Twenty hours after transfection, complete medium containing 1 ␮mol/L bromodeoxyuridine (BrdU) was added for 6 –12 hours prior to immunofluorescence staining with anti-BrdU and anti-p48 antibodies. Cells were fixed for 15 minutes with 4% paraformaldehyde in PBS and permeabilized with 70% ethanol for 10 minutes at 4°C. After 15-minute incubation with PBS containing 0.5% bovine serum albumin (BSA) and 2 mmol/L HCl to denature DNA, coverslips were washed 3 times with 0.5% BSA and 0.5% Tween 20 in PBS, and a mouse anti-BrdU mAb (Pharmingen) (1:1000 in PBS containing 0.5% BSA, 0.5% Tween 20) was added for 1 hour. For p48 staining, affinitypurified rabbit polyclonal anti-p48 antibodies were added.9 Reactions were developed using rhodamine-conjugated goat anti-mouse Ig (Pierce) for BrdU staining and peroxidaseconjugated goat anti-rabbit Ig (Dako, Glostrup, Denmark) for p48 staining. The percentage of BrdU-positive cells among p48-transfected and -untransfected cells was scored by counting at least 200 cells from each of 3 independent coverslips.

Immunohistochemical Assays Pancreatic tissue blocks from patients undergoing surgery for chronic pancreatitis or pancreatic cancer containing areas of ductal complexes and histologically normal pancreas were retrieved from the files of the Department of Pathology, Hospital del Mar, Barcelona, Spain. Pancreatic samples from 3-month-old, sex-matched Ptf1␣Cre/wt (n ⫽ 6) or Ptf1␣wt/wt (n ⫽ 6) mice were fixed with 4% paraformaldehyde and embedded in paraffin. Sections of paraffin-embedded tissues were deparaffinized and rehydrated, and antigen retrieval was carried out by autoclaving at 120°C in citrate buffer, pH 6.0, for 1 minute. Affinity-purified rabbit polyclonal antibodies recognizing p48 were used at 5 ␮g/mL; rabbit anti-Ki-67 (Novocastra Laboratories Ltd., Newcastle Upon Tyne, United Kingdom) or rabbit anti-amylase (Sigma) were used at 1:1500 and 1:1000 dilution, respectively. Reactions were revealed using the Envision secondary reagent (Dako) and diaminobenzidine as a chromogen. Immunohistochemical assays were performed using an automated Ventana staining instrument. To estimate the proportion of immunoreactive cells in human pancreas tissue sections, images corresponding to areas of interest (4 – 6 areas/case) were digitalized, and Ki-67-expressing cells in the whole image were counted; the proportion of immunoreactive cells was determined by dividing the number of Ki-67-positive cells by the total number of cells counted. The number of counted nuclei ranged between 4000 and 20,000/case. To determine the proportion of proliferating cells in the pancreas of Ptf1␣Cre/wt and Ptf1␣wt/wt mice, the number of Ki-67expressing cells present in 10 random fields of each of 2 sections was assessed using the ⫻20 lens. A similar strategy was used to determine the proportion of proliferating cells in ductal complexes and acini of MT-TGF-␣ mice. Results were expressed as an index: percentage proliferating ductal cells/ percentage proliferating acinar cells for the MT-TGF-␣ mice and percentage proliferating acinar cells/percentage proliferating ductal ⫹ islet cells for the Ptf1␣Cre/wt mice. TUNEL assays

September 2004

Figure 1. Cell growth inhibition of pancreatic cancer cell lines by p48. Control (C) and p48 transfectants were seeded in 6-well culture plates at the same density. After 2 weeks, colonies were stained and counted as reported in the Materials and Methods section. Values are shown as mean ⫾ SD of 3 independent experiments. For each cell line, 1 representative colony formation assay is shown. (A) AR42J cells. (B) RWP-1 cells seeded into soft agar.

were performed using the ApopTag Peroxidase In Situ Apoptosis Detection Kit (Intergen) according to manufacturer’s instructions.

Statistical Analysis Comparison of proportion of cells in Go/G1, S, and G2/M phases was performed using the Mann–Whitney test. ␹2 was used to compare the proportion of Ki-67 reactive cells in samples of normal pancreas vs. chronic pancreatitis; Student t test was used to compare Ki-67 reactive cells in Ptf1␣Cre/wt vs. Ptf1␣wt/wt mice. Comparisons were considered significant at a 2-sided P value of ⬍0.05.

PTF1␣/p48 TRANSCRIPTION FACTOR

941

with p48 cDNA or with control empty vector was estimated over 14 days. Transfection of p48 was associated with a 75% decrease in the number of outgrowing colonies when using AR42J cells, and a similar growth inhibition was observed with RWP-1 cells (Figure 1A and 1B). In both cases, the size of colonies growing from p48 transfectants was 2- or 3-fold smaller than that of control colonies (Figure 1A and 1B). Figure 2A shows that transfection of p48 cDNA into RWP-1 cells was associated with a marked decrease in growth rate in a standard proliferation assay. A similar degree of growth inhibition was observed using clones of transfected AR42J and ARIP cells (data not shown). These results indicate that p48 negatively influences cell growth regardless of the acinar/ductal phenotype and that growth effects are independent from the effects on differentiation because p48 is unable to activate an acinar program in RWP-1 cells.9 To determine whether growth inhibition also occurred in nonpancreatic cells, we used Cos-7 fibroblasts. Cos-7 cells do not form compact colonies; therefore, we monitored the total number of cells/plate, and a 95% reduction in cell number was observed at day 14 (Figure 2B), indicating that the effects of p48 on cell growth also take place in nonepithelial cells. The Growth Inhibitory Effects of p48 Do Not Result From an Increase in Cell Death To determine whether the net effect on cell growth was related to an effect on cell death, we assessed the proportion of nonviable cells in p48 or control transfectant RWP-1 cultures using trypan blue exclusion over a 7-day period. Figure 3A shows that cell death rate was similar in control and p48 transfectants. Moreover, there

Results p48 Expression Inhibits Cell Growth Independently of the Acinar Differentiation Program To examine the effects of the introduction of p48 cDNA on cell proliferation, a panel of pancreatic and nonpancreatic cell lines was used: AR42J and ARIP cells are derived from a tumor induced by azaserine in rats and display mixed acinar/neuroendocrine features and ductallike features, respectively.24 RWP-1 cells are derived from a human pancreatic ductal adenocarcinoma and display ductal features,26 and Cos-7 are monkey fibroblasts. Colony-formation capacity of cells transfected

Figure 2. p48 Decreases the growth rate of pancreatic and nonpancreatic cells. (A) RWP-1 transfectants expressing, or not, p48 were seeded in 6-well plates. Cells were counted over a 7-day period. Each point corresponds to the mean ⫾ SD of 4 values. (B) Stably transfected Cos-7 cells, obtained from 3 independent transfection experiments, were seeded in duplicate in 6-well plates and counted after 14 days, as reported in the Materials and Methods section.

942

RODOLOSSE ET AL.

GASTROENTEROLOGY Vol. 127, No. 3

the notion that the growth reduction effected by p48 is not due to increased cell death. p48 Expression Induces a Delay in the G1/S Transition of the Cell Cycle

Figure 3. p48 does not affect cell death and causes a delay in G1-S progression. (A) 104 RWP-1 control (open bars) and p48 transfectants (solid bars) were seeded in 6-well plates and counted after trypan blue staining on culture day 3, 5, 6, and 7. Percentage of dead cells was determined by dividing the number of trypan blue-stained cells by total cell number. Results were obtained from 3 independent control and p48 transformant populations. (B) Western blotting analysis was performed with lysates from 2 RWP-1 control (C) or p48-transfected cell populations. Proteins of the expected size (32 kilodaltons and 17 kilodaltons) were detected with polyclonal anti-procaspase-3 and anticleaved caspase-3 antisera, respectively. Equal protein loading was confirmed by probing with an antibody against ␤-actin. (C and D) FACS analysis of cell cycle proliferation. RWP-1 transfectants expressing or not p48 were cultured in serum-deprived medium for 48 hours. Serum-deprived medium was then replaced by 10% serum containing medium. Cells were collected before (0% FBS, open bars) and 24 hours after medium change (10% FBS, solid bars) for PI staining and FACS analysis. Fractions of cells in G0/G1, S, G2/M phase were determined by FACS for each condition (0% FBS or 10% FBS) (C), and the proliferation index of control and p48 transfectants was calculated as reported in the Materials and Methods section (D). Data were obtained from 3 control and p48 transfectant populations in at least 4 independent experiments.

was no difference in the levels of procaspase-3 or cleaved, active, caspase-3 between control and p48-transfected cells (Figure 3B), indicating the lack of activation of apoptosis by p48. Consistently, analysis of apoptosisinduced DNA fragmentation in transfectant cultures failed to reveal differences between control and p48expressing cells (data not shown). These results support

We next investigated the effects of p48 on G1-S progression using fluorescence-activated cell sorter analysis of cell cycle distribution. RWP-1 cells were synchronized by 48 hours’ culture in serum-free medium, and cell cycle entry was stimulated by adding 10% FBS. Twenty-four hours after adding FBS, there was a 21.7% and a 7.1% decrease in the proportion of cells with a G0/G1 DNA content in control (P ⫽ 0.002) and p48transfected cells (P ⫽ 0.04), respectively, indicating a reduced exit from quiescence in p48 transfectants. At the same time, there was a 15% and a 6.8% increase in the proportion of cells with an S (P ⫽ 0.001) and G2/M (P ⫽ 0.13) DNA content in control cells. In p48 transfectants, the corresponding increase in cells with an S phase content was 9.9% (P ⫽ 0.04), and there was no increase in the G2/M population (Figure 3C). The proliferation index of control transfectants cultured in 10% FBS was 2.5 ⫾ 0.44-fold higher than in the absence of FBS; in p48-transfected cells, the corresponding fold increase was 1.28 ⫾ 0.15. The difference between the fold increase observed in control and p48-transfected cells was statistically significant (P ⫽ 0.001, Student t test) (Figure 3D). These results represent the mean of 4 independent experiments. Taken together, these findings support the conclusion that p48 expression inhibits cell proliferation by inducing a delay in the progression from the G1 to S phase of the cell cycle. p48 Expression Leads to the Up-regulation of p21CIP1/WAF1 and p27KIP1 and to pRb Hypophosphorylation To define the molecular mechanisms through which p48 may exert its antiproliferative activity, we analyzed the expression of key regulators of the G1-S transition by Western blotting (Figure 4). The levels of the cyclin-dependent kinase inhibitors (CDKI) p21CIP1/WAF1 and p27KIP1 were clearly and consistently increased in p48 transfectants, compared with control cells. By contrast, p48-expressing and control cultures did not show consistent changes in the levels of cyclin D1, cyclin A, and cyclin E. In agreement with these findings, the relative levels of hypophosphorylated pRb, the active form of the protein, were higher in p48 transfectants than in control cells (Figure 4). There is extensive evidence that p21CIP1/WAF1 is mainly regulated at the transcriptional level. Therefore, semiquantitative RT-PCR was performed to examine the

September 2004

PTF1␣/p48 TRANSCRIPTION FACTOR

943

region of the p21CIP1/WAF1 gene, we carried out transient cotransfection experiments in RWP-1 cells with the p48 expression vector and a p21-luc reporter construct containing the 2.4-kb promoter region of the p21CIP1/WAF1 gene. Figure 6A shows that p48 expression results in a reproducible 2-fold increase in the activity of the p21CIP1/WAF1 promoter. This result suggests that inhibition of cell proliferation induced by p48 is mediated, at least in part, by transcriptional activation of the p21CIP1/WAF1 gene. The 5= regulatory region of p21CIP1/WAF1 contains a p53 responsive element. To establish whether p53 was required for p48-mediated cell cycle inhibition, we examined BrdU uptake in p48-transfected RWP-1, 3T3 WT, and 3T3 p53⫺/⫺ cells. The percentage of BrdU-positive cells among p48-positive or p48-negative populations was determined by double immunostaining. Figure 6B shows that p48 expression resulted in a 6-fold and 2.5-fold reduction of the percentage of BrdU-positive RWP-1 and 3T3 WT cells, respectively. In 3T3 p53⫺/⫺ cells, p48 also induced a 3.5-fold decrease in BrdU uptake. These results indicate that p53 is not required for the antiproliferative effects of p48. Figure 4. Effects of p48 on the expression of cell growth regulators. Up-regulation of p21CIP1/WAF1 and p27KIP1. Western blotting analysis of G1 phase regulators was performed with whole-cell extracts (50 ␮g) prepared from stably transfected RWP-1 cells. Results shown were obtained with cell extracts of 2 control and 2 p48 transfectant populations obtained independently (designated 1 and 2, respectively).

effects of p48 expression on levels of CDKI and cyclin transcripts using RNA extracted from each of 3 independent control or p48 transfectant populations. As shown in Figure 5, p21CIP1/WAF1 mRNA was 2-fold more represented in p48-expressing cells than in control cells, whereas p27KIP1 mRNA was not modified by p48. Similar results were obtained using real-time quantitative RT-PCR: p21CIP1/WAF1 and p27KIP1 mRNA levels were 1.7- ⫾ 0.20-fold and 1.06- ⫾ 0.05-fold higher in cells transfected with p48 cDNA than in those transfected with control plasmid. In addition, a consistent 2-fold decrease in the levels of cyclin D2 mRNA was observed in p48-expressing cells, whereas the levels of cyclins D1, D3, A, and E were unaffected (Figure 5 and data not shown). These results were also confirmed by real-time quantitative RT-PCR: There was a 40% reduction in the levels of cyclin D2 mRNA in p48 transfectants. Transiently Expressed p48 Protein Activates p21CIP1/WAF1 Promoter To determine whether increased p21CIP1/WAF1 mRNA expression is mediated by the 5= regulatory

Figure 5. p21CIP1/WAF1 and cyclin D2 are regulated at the mRNA level. RT-PCR analysis was carried out with total RNA extracted from control of p48 RWP-1 transfectants. The amount of RNA used in RT-PCR reactions is indicated. The relative intensity of the bands corresponding to the RT-PCR products was quantitated by image analysis, and levels of p21CIP1/WAF1, p27KIP1, and cyclin D2 RT-PCR products were normalized against those of cyclophilin.

944

RODOLOSSE ET AL.

GASTROENTEROLOGY Vol. 127, No. 3

pressing the different deletion mutants of p48 were tested for their capacity to form colonies over a 14-day time period. Figure 7B shows that expression of the C-terminal region of p48 lacking the bHLH domain inhibited cell growth as efficiently as the whole protein in AR42J and RWP-1 cells. In addition, the bHLH domain was not required for the antiproliferative effects of p48. The N-terminus containing constructs had a

Figure 6. p48 activates the p21CIP1/WAF1 promoter. (A) p48 activates the promoter of p21CIP1/WAF1 gene. pIRESneo control or pIRESp48 vector (0.4 ␮g) was cotransfected with 0.1 ␮g p21-luc reporter construct27 and 15 ng pRL-TK vector containing the herpes simplex virus thymidine kinase promoter upstream of Renilla luciferase cDNA in RWP-1 cells plated in 24-well plates. pRL-TK vector was included as an internal control for normalization. Luciferase expression was evaluated 48 hours after transfection. Relative luciferase activity values are the means of 2 independent experiments, each performed in triplicate. (B) p53 is not required for the antiproliferative activity of p48. RWP-1, 3T3 WT, and 3T3 p53⫺/⫺ cells were transfected with pIRESneo (open bars) or pIRESp48 vector (solid bars) (0.4 ␮g). Twenty hours after transfection, cells were labeled with 1 ␮mol/L BrdU for 6 –12 hours, and quantitation of BrdU incorporation was assessed by double immunostaining of BrdU and p48 as indicated in the Materials and Methods section.

The C-terminal Region of p48 Is Sufficient to Induce a Growth Inhibitory Effect in AR42J and RWP-1 Cells To identify the region of p48 involved in growth inhibition, deletion mutants encoding the N-terminal and C-terminal fragments of p48, containing or lacking the bHLH domain (Figure 7A), were transfected in AR42J and RWP-1 cells. Stably transfected cells ex-

Figure 7. Structure and antiproliferative activity of deletion mutants of p48. (A) Structure of the p48 deletion mutants. (B) AR42J (open bars) and RWP-1 cells (solid bars) were stably transfected with expression vectors of the p48 deletion mutants represented in panel A. AR42J and RWP-1 proliferative capacity was determined by colony formation assays performed as described in Figure 1. The results shown were obtained from 2 independent experiments. (C) Transcriptional activation of the A element of the elastase promoter by p48 deletion mutants. AR42J cells were transiently cotransfected with the pIRESneo vector containing the full-length, or partially deleted, p48 and the 6XA26-luc reporter construct. pRL-TK vector was included as an internal control for normalization, and luciferase activity was determined 48 hours after transfection.

September 2004

PTF1␣/p48 TRANSCRIPTION FACTOR

945

Figure 8. Cell proliferation in ductal complexes. (A) Comparison of the proportion of Ki-67 immunoreactive cells in paired samples of histologically normal pancreas (open bars) and regions containing ductal complexes typical of chronic pancreatitis (solid bars). Samples were obtained from 3 patients (designated 1, 2, and 3). The total number of cells counted ranged between 4000 and 20,000. Statistical analysis: *P ⫽ 0.02; **P ⬍ 0.001 (␹2 test). (B–E) Cell proliferation and differentiation were assessed in paraffin-embedded pancreatic tissue sections using immunohistochemistry with antibodies recognizing Ki-67 or amylase. Areas corresponding to histologically normal pancreas (B) or an area containing ductal complexes (C) from a patient with chronic pancreatitis: less than 1% of proliferating cells are present in normal pancreas, whereas a higher proportion of proliferating cells is observed in chronic pancreatitis-associated ductal complexes. Transdifferentiated ductal complexes in pancreatic tissue from MT-TGF-␣ transgenic mice (D and E); Anti-Ki-67 (B–D); amylase (E).

modest antiproliferative effect in RWP-1 cells but not in AR42J cells. Loss of p48 Expression Is Associated With Enhanced Proliferative Activity in Acinar Cells To determine whether the loss of expression of p48 in normal exocrine pancreas is associated with changes in cell proliferation, we examined the expression of the proliferation marker Ki-67 in histologically normal pancreas and in ductal complexes present in areas of chronic pancreatitis. In the 3 cases analyzed, the proportion of Ki-67 immunoreactive cells was significantly higher in areas of chronic pancreatitis-associated ductal complexes than in histologically normal pancreas (P ⬍ 0.001 for the pooled data from the 3 cases analyzed), indicating that ductal transdifferentiation—which is associated with down-regulation of p4812—is associated with an increase in cell proliferation (Figure 8A–C). In the pancreas from MT-TGF-␣ mice, in which TGF-␣ is induced in acinar cells by administration of Zn, extensive acinar-ductal metaplasia takes place.22 The proportion of Ki-67 cells in metaplastic ducts was 16-fold higher than in normal pancreatic ductal cells from control mice. Ductal complexes from MT-TGF-␣ mice, lacking amylase expression, showed a 10.5-fold increase in prolifer-

ative index in comparison with amylase-expressing acinar cells present in the same tissue samples (Figure 8D and 8E). These findings are in agreement with prior reports.22 Cell proliferation was also analyzed in the pancreas of Ptf1␣Cre/wt (n ⫽ 6) and control Ptf1␣wt/wt (n ⫽ 6) littermates. The histologic appearance of both exocrine and endocrine pancreas is completely normal in 3-month-old Ptf1␣Cre/wt mice. To normalize for p48unrelated changes in cell proliferation in the pancreas, we determined the index of cycling acinar cells—which express p48 —in comparison with ductal or islet cells— which lack p48 expression. Proliferating cells were detected using anti-Ki-67 antibodies in 20 random ⫻200 fields as indicated in the Materials and Methods section, and the acinar/ductal proliferation index was higher in Ptf1␣Cre/wt than in sex- and age-matched control Ptf1␣wt/wt littermates (3.61 vs. 2.27, respectively). The index of positive acinar cells/field was 6.96 (Ptf1␣Cre/wt) vs. 5.38 (Ptf1␣wt/wt) (P ⫽ 0.05, Student t test). By contrast, nonacinar cells showed no significant difference in the index of labeled cells/field: 1.93 (Ptf1␣Cre/wt) vs. 2.35 (Ptf1␣wt/wt). These findings are consistent with a role for p48 in the regulation of cell proliferation in the exocrine pancreas in vivo. Using the TUNEL assay, the

946

RODOLOSSE ET AL.

proportion of apoptotic cells in the pancreas of Ptf1␣Cre/wt and control mice was found to be extremely low (less than 0.1% cells, less than 1 cell/mm2 pancreatic tissue).

Discussion The study of many different cell types has shown that differentiation results from the fulfillment of 2 coordinated events: (1) cell cycle arrest and, possibly, irreversible cell cycle withdrawal and (2) induction of tissue-specific genes resulting in characteristic cellular phenotypes. Little is known about how these events take place in the exocrine pancreas, and the results presented here provide new insights about the molecular mechanisms by which p48 may couple cell proliferation and differentiation in acinar cells. Transcriptional activity of the PTF1 complex has been shown to be restricted to acinar cells and is required to maintain the expression of exocrine-specific genes such as elastase-1 and amylase.7,11,21 Among the PTF1 complex components, p48 is selectively down-regulated during the acinar-to-ductal transdifferentiation of normal exocrine pancreas in vitro as well as during loss of the acinar phenotype in azaserine-induced cultured tumor cells.9 In these cellular systems, reintroduction of p48 cDNA by transfection is not able to reestablish the acinar differentiation program9 and does not lead to an increase in the activity of a luciferase reporter under the control of a synthetic promoter containing 6 multimerized A boxes from the rat Ela1 gene (unpublished data, November 1999), indicating lack of formation of an active PTF1 complex. By contrast, we noted that transfection of p48 cDNA in a variety of cell types was associated with a marked decrease in the number of outgrowing clones, regardless of the origin of the cells used in these assays. Here, we show that introduction of p48 results in a highly reproducible up-regulation of the CDKI p21CIP1/WAF1 and p27KIP1 and the down-regulation of cyclin D2. These effects occur in pancreatic and nonpancreatic cells in which an active PTF1 complex is not formed, based on the lack of activation of the elastase promoter in transient transfection assays or the lack of expression of acinar markers in stably transfected cells. The final effect of p48 is an increase in the levels of the active, hypophosphorylated form of pRb. In its hypophosphorylated form, pRb associates with and inactivates E2F proteins, leading to the repression of genes required for G1 progression.28 The up-regulation of p21CIP1/WAF1 and p27KIP1 and the down-regulation of cyclin D2 are likely to play a role in the reduced phosphorylation of Rb by CDKs.

GASTROENTEROLOGY Vol. 127, No. 3

These findings are reminiscent of those reported for MyoD, a paradigm of the tissue-specific bHLH factors involved in muscle differentiation. MyoD has been shown to couple cell differentiation and proliferation in myogenic cells through a variety of effects, most notably (1) transcriptional activation of p21CIP1/WAF1:29 an effect that can be overcome by the over-expression of cyclin D1,30 (2) regulation of Rb function through regulation of Rb gene transcription31 by an E-box-independent mechanism,32 and (3) direct interaction with Rb.33 The antiproliferative effects of MyoD are also similar to those of p48 in that neither of them requires functional p53 nor is restricted to muscle or acinar cells, respectively.34 Additional work has shown that bHLH factors may also participate in growth regulation in other tissues through the modulation of CDKI expression, including neuronal cells,35 and osteoblats. The effects on p21CIP1/WAF1 promoter activation mediated by E12 in osteoblasts,36 MyoD in muscle cells,31 and p48 in pancreatic and nonpancreatic cells do not show an absolute requirement for p53 functionality. It has been generally reported that p21CIP1/WAF1 transactivation by bHLH transcription factors was mediated by the binding of the bHLH domain to E-boxes contained in its promoter.29,37 Here, we show that the C-terminal fragment of p48, devoid of the bHLH region, was as effective as the wild-type protein in inducing cell cycle arrest, whereas it was unable to activate transcription from a p48-responsive promoter and rather antagonized the endogenous p48 transcriptional activity (Figure 7C). The 112 amino acid C-terminal region of p48 does not bear any homology to other known proteins in the genome, thus not providing clues as to the mechanisms through which these effects take place. Interestingly, Obata et al. have recently reported that p48 interacts with RBP-J␬ using a yeast-2 hybrid screening with a cDNA library from e9.5–12.5 embryonic RNA and that the 94 amino acids of p48 C-terminal region are essential for binding to RBP-J␬.15 RBP-J␬ is a transcriptional regulator that binds DNA and plays a pivotal role in the Notch signalling pathway, involved in cell fate decisions in the developmental programs of a variety of tissues.38,39 In this pathway, the interaction of Notch ligands with the receptor leads to the proteolysis of Notch intracellular domain (Notch IC), its nuclear translocation, and subsequent binding to RBP-J␬, resulting in the activation of transcription of target genes. Among them is the mammalian homologue of hairy enhancer of split (HES) genes. Activation of HES in cells through Notch IC signalling is associated—in a variety of tissues, including the pancreas—with the maintenance of an undifferentiated state.40 In agreement with this, we have

September 2004

found that both Hes-1 and Notch IC inhibit the activity of the elastase promoter in acinar cells in vitro in transient reporter assays (data not shown). By contrast, cells expressing Notch ligands undergo differentiation. It is presently thought that, in the developing pancreas, Notch signalling plays a crucial role in the specification of endocrine cells: in cells in which the Notch pathway is inactive, ngn3 expression is activated, and the endocrine differentiation program ensues.41,42 The interaction of RBP-J␬ and p48 might—through yet unknown mechanisms—play a role in the activation of the acinar differentiation program as well as in cell cycle exit. The latter notion would be favored by the fact that, in differentiating primary keratinocytes, Notch 1 binding to RBP-J␬ at the p21CIP1/WAF1 promoter leads to growth suppression through an up-regulation of p21CIP1/WAF1 expression.43 Recent work supports the notion that Notch activation represses exocrine differentiation44,45 and that this pathway plays a crucial role in the TGF␣-induced phenotypical acinar-to-ductal switch in the exocrine pancreas.40 In addition to the effects on CDKI, p48 may also affect cell growth through other mechanisms. We analyzed whether p48 induced apoptosis, as MyoD does in certain cellular contexts,31 and found no evidence for its participation in growth reduction in pancreatic cells. The antiproliferative effect of p48 described here may be of relevance in understanding the relationship between chronic pancreatitis and pancreatic cancer. The former is characterized by the substitution of the acinar parenchyma by ductal complexes and the presence of a marked desmoplastic reaction. Chronic pancreatitis is associated with an increased risk for the development of exocrine pancreas cancer, both in its sporadic46 and hereditary forms.47 However, the precise molecular mechanisms involved in this predisposition to cancer are not known. It is likely that cellular changes in the exocrine epithelium, as well as in the surrounding mesenchyme, contribute to tumor development. The epithelial changes, characterized by acinar-to-ductal transdifferentiation, can be recapitulated in vitro when the exocrine fraction of normal human pancreas is placed in culture: a loss of expression of acinar genes and the activation of expression of ductal markers, as well as the acquisition of the ability to respond to hormones that typically affect only ductal cells, take place.52 Such changes are associated with the selective loss of expression of p48 in cultured cells, whereas expression of the other reported components of the PTF1 complex is unaltered.9,12 There is an association between the loss of acinar properties, typical of ductal complexes, lack of p48 expression, and increased proliferation, both in human

PTF1␣/p48 TRANSCRIPTION FACTOR

947

tissue samples and in the pancreas of genetically modified mice developing chronic pancreatitis-like lesions such as MT-TGF-␣ and Ela-TGF-␣ transgenic mice.22,49 Nevertheless, there is no direct evidence that such an association reflects a causal relationship. In these mouse strains, loss of normal exocrine tissue architecture is also accompanied by an increased susceptibility to develop pancreatic tumors.49,50 Activation of expression of TGF-␣ in the pancreas through the metallothionein promoter leads to extensive acinar-ductal transdifferentiation and a marked increase in cell proliferation in cells within the ductal complexes (Figure 8),22 in which the exocrine program has been turned off, but not in cells maintaining an acinar phenotype. The in vitro antiproliferative effects of p48 and the modest increase in cell proliferation in acinar cells of p48Cre/wt mice lead us to hypothesize that p48 down-regulation could play a pathogenic role. Further work is required to determine whether the mechanisms associated with the antiproliferative effect of p48 in cultured cells are also responsible for the biologic activity of p48 in vivo. Although the vast majority of genetic evidence available suggests that exocrine pancreatic cancer arises through the progression of preneoplastic lesions arising in pancreatic ducts,51–53 it is conceivable that—in some cases and more specifically in the context of chronic pancreatitis—transdifferentiated ductal cells could be the target for malignant transformation in the exocrine pancreas.9,40,54 –56 Evidence in support of this possibility has recently been obtained using transgenic mice in which mutant K-rasG12D was targeted to mouse acinar cells using the elastase promoter, leading to the development of acinar dysplasia and prenoplastic ductal lesions with papillary features. The prenoplastic lesions arising in the offspring of Ela-K-rasG12D mice correspond to ductal cells because K19 is a typical ductal cell marker.57 The sustained expression of mutant K-ras RNA in ductal lesions was confirmed using RT-PCR and RNA from laser microdissection.58 These findings, together with recent work using other mouse models of pancreas cancer,59 provide additional plausibility to the hypothesis that targeting genetic lesions to acinar cells can lead to the development of pancreatic intraductal neoplasia. We speculate that down-regulation of p48 associated with acinar-ductal transitions leads to the loss of a negative growth regulatory mechanism that, together with altered regulation of additional signalling pathways (i.e., Notch),40 is associated with an increased propensity for cells to progress and acquire neoplastic properties. Altogether, our findings indicate that changes in p48 expression may play an important role in tissue ho-

948

RODOLOSSE ET AL.

meostasis in the exocrine pancreas and may contribute to dysregulated growth and tumorigenesis.

References 1. Massari ME, Murre C. Helix-loop-helix proteins: regulators of transcription in eukaryotic organisms. Mol Cell Biol 2000;20:429 – 440. 2. Murre C, McCaw PS, Vaessin H, Caudy M, Jan LY, Jan YN, Cabrera CV, Buskin JN, Hauschka SD, Lassar AB, Weintraub H, Baltimore D. Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 1989;58:537–544. 3. Buskin JN, Hauschka SD. Identification of a myocyte nuclear factor that binds to the muscle-specific enhancer of the mouse muscle creatine kinase gene. Mol Cell Biol 1989;9:2627–2640. 4. Naya FJ, Stellrecht CM, Tsai MJ. Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev 1995;9:1009 –1019. 5. Grant AL, Jones A, Thomas KL, Wisden W. Characterization of the rat hippocalcin gene: the 5= flanking region directs expression to the hippocampus. Neuroscience 1996;75:1099 –1115. 6. Bessis A, Salmon AM, Zoli M, Le Novere N, Picciotto M, Changeux JP. Promoter elements conferring neuron-specific expression of the ␤ 2 subunit of the neuronal nicotinic acetylcholine receptor studied in vitro and in transgenic mice. Neuroscience 1995;69: 807– 819. 7. Cockell M, Stolarczyk D, Frutiger S, Hughes GJ, Hagenbuchle O, Wellauer PK. Binding sites for hepatocyte nuclear factor 3 ␤ or 3 ␥ and pancreas transcription factor 1 are required for efficient expression of the gene encoding pancreatic ␣-amylase. Mol Cell Biol 1995;15:1933–1941. 8. Sommer L, Hagenbuchle O, Wellauer PK, Strubin M. Nuclear targeting of the transcription factor PTF1 is mediated by a protein subunit that does not bind to the PTF1 cognate sequence. Cell 1991;67:987–994. 9. Adell T, Gomez-Cuadrado A, Skoudy A, Pettengill OS, Longnecker DS, Real FX. Role of the basic helix-loop-helix transcription factor p48 in the differentiation phenotype of exocrine pancreas cancer cells. Cell Growth Differ 2000;11:137–147. 10. Roux E, Strubin M, Hagenbuchle O, Wellauer PK. The cell-specific transcription factor PTF1 contains two different subunits that interact with the DNA. Genes Dev 1989;3:1613–1624. 11. Krapp A, Knofler M, Frutiger S, Hughes GJ, Hagenbuchle O, Wellauer PK. The p48 DNA-binding subunit of transcription factor PTF1 is a new exocrine pancreas-specific basic helix-loop-helix protein. EMBO J 1996;15:4317– 4329. 12. Adell T, Skoudy A, Gomez-Cuadrado A, Palomero T, Real FX. The bHLH transcription factor p48 in exocrine pancreas differentiation in vitro. In: Gress TM, ed. Molecular pathogenesis of pancreatic cancer. Amsterdam: The Netherlands: IOS Press, 2000: 80 – 87. 13. Krapp A, Knofler M, Ledermann B, Burki K, Berney C, Zoerkler N, Hagenbuchle O, Wellauer PK. The bHLH protein PTF1-p48 is essential for the formation of the exocrine and the correct spatial organization of the endocrine pancreas. Genes Dev 1998;12: 3752–3763. 14. Kawaguchi Y, Cooper B, Gannon M, Ray M, MacDonald RJ, Wright CV. The role of the transcriptional regulator Ptf1␣ in converting intestinal to pancreatic progenitors. Nat Genet 2002;32:128 – 134. 15. Obata J, Yano M, Mimura H, Goto T, Nakayama R, Mibu Y, Oka C, Kawaichi M. p48 subunit of mouse PTF1 binds to RBP-J␬/CBF-1, the intracellular mediator of Notch signalling and is expressed in the neural tube of early stage embryos. Genes Cells 2001;6: 345–360.

GASTROENTEROLOGY Vol. 127, No. 3

16. Li H, Edlund H. Persistent expression of Hlxb9 in the pancreatic epithelium impairs pancreatic development. Dev Biol 2001;240: 247–253. 17. Petrucco S, Wellauer PK, Hagenbuchle O. The DNA-binding activity of transcription factor PTF1 parallels the synthesis of pancreas-specific mRNAs during mouse development. Mol Cell Biol 1990;10:254 –264. 18. Jonsson J, Carlsson L, Edlund T, Edlund H. Insulin-promoterfactor 1 is required for pancreas development in mice. Nature 1994;371:606 – 609. 19. Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BL, Wright CV. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 1996;122:983–995. 20. Holland AM, Hale MA, Kagami H, Hammer RE, MacDonald RJ. Experimental control of pancreatic development and maintenance. Proc Natl Acad Sci U S A 2002;99:12236 –12241. 21. Rose SD, Swift GH, Peyton MJ, Hammer RE, MacDonald RJ. The role of PTF1-P48 in pancreatic acinar gene expression. J Biol Chem 2001;276:44018 – 44026. 22. Sandgren EP, Luetteke NC, Palmiter RD, Brinster RL, Lee DC. Overexpression of TGF ␣ in transgenic mice: induction of epithelial hyperplasia, pancreatic metaplasia, and carcinoma of the breast. Cell 1990;61:1121–1135. 23. Dexter DL, Matook GM, Meitner PA, Bogaars HA, Jolly GA, Turner MD, Calabresi P. Establishment and characterization of two human pancreatic cancer cell lines tumorigenic in athymic mice. Cancer Res 1982;42:2705–2714. 24. Jessop J, Hay RJ. Characteristics of two rat pancreatic exocrine cell lines derived from transplantable tumors. In Vitro 1980;16: 212. 25. Rose SD, Kruse F, Swift GH, MacDonald RJ, Hammer RE. A single element of the elastase I enhancer is sufficient to direct transcription selectively to the pancreas and gut. Mol Cell Biol 1994; 14:2048 –2057. 26. Vilá MR, Balagué C, Real FX. Cytokeratins and mucins as molecular markers of cell differentiation and neoplastic transformation in the exocrine pancreas. Zentr Pathol 1994;140:225–235. 27. Prabhu S, Ignatova A, Park ST, Sun XH. Regulation of the expression of cyclin-dependent kinase inhibitor p21 by E2A and Id proteins. Mol Cell Biol 1997;17:5888 –5896. 28. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 1999;13:1501– 1512. 29. Halevy O, Novitch BG, Spicer DB, Skapek SX, Rhee J, Hannon GJ, Beach D, Lassar AB. Correlation of terminal cell cycle arrest of skeletal muscle with induction of p21 by MyoD. Science 1995; 267:1018 –1021. 30. Skapek SX, Rhee J, Spicer DB, Lassar AB. Inhibition of myogenic differentiation in proliferating myoblasts by cyclin D1-dependent kinase. Science 1995;267:1022–1024. 31. Peschiaroli A, Figliola R, Coltella L, Strom A, Valentini A, D’Agnano I, Maione R. MyoD induces apoptosis in the absence of RB function through a p21(WAF1)-dependent re-localization of cyclin/cdk complexes to the nucleus. Oncogene 2002;21:8114 – 8127. 32. Magenta A, Cenciarelli C, De Santa F, Fuschi P, Martelli F, Caruso M, Felsani A. MyoD stimulates RB promoter activity via the CREB/p300 nuclear transduction pathway. Mol Cell Biol 2003; 23:2893–2906. 33. Gu W, Schneider JW, Condorelli G, Kaushal S, Mahdavi V, NadalGinard B. Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation. Cell 1993;72:309 –324. 34. Crescenzi M, Fleming TP, Lassar AB, Weintraub H, Aaronson SA. MyoD induces growth arrest independent of differentiation in

September 2004

35.

36.

37.

38. 39. 40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

normal and transformed cells. Proc Natl Acad Sci U S A 1990;87:8442– 8446. Farah MH, Olson JM, Sucic HB, Hume RI, Tapscott SJ, Turner DL. Generation of neurons by transient expression of neural bHLH proteins in mammalian cells. Development 2000;127:693–702. Funato N, Ohtani K, Ohyama K, Kuroda T, Nakamura M. Common regulation of growth arrest and differentiation of osteoblasts by helix-loop-helix factors. Mol Cell Biol 2001;21:7416 –7428. Pagliuca A, Gallo P, De Luca P, Lania L. Class A helix-loop-helix proteins are positive regulators of several cyclin-dependent kinase inhibitors’ promoter activity and negatively affect cell growth. Cancer Res 2000;60:1376 –1382. Weinmaster G, Roberts VJ, Lemke G. Notch2: a second mammalian Notch gene. Development 1992;116:931–941. Honjo T. The shortest path from the surface to the nucleus: RBP–J␬/Su(H) transcription factor. Genes Cells 1996;1:1–9. Miyamoto Y, Maitra A, Ghosh B, Zechner U, Argani P, IacobuzioDonahue CA, Sriuranpong V, Iso T, Meszoely IM, Wolfe MS, Hruban RH, Ball DW, Schmid RM, Leach SD. Notch mediates TGF-␣-induced changes in epithelial differentiation during pancreatic tumorigenesis. Cancer Cell 2003;3:565–576. Apelqvist A, Li H, Sommer L, Beatus P, Anderson DJ, Honjo T, Hrabe de Angelis M, Lendahl U, Edlund H. Notch signalling controls pancreatic cell differentiation. Nature 1999;400:877– 881. Jensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M, Kageyama R, Guillemot F, Serup P, Madsen OD. Control of endodermal endocrine development by Hes-1. Nat Genet 2000; 24:36 – 44. Rangarajan A, Talora C, Okuyama R, Nicolas M, Mammucari C, Oh H, Aster JC, Krishna S, Metzger D, Chambon P, Miele L, Aguet M, Radtke F, Dotto GP. Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J 2001;20:3427–3436. Murtaugh LC, Stanger BZ, Kwan KM, Melton DA. Notch signaling controls multiple steps of pancreatic differentiation. Proc Natl Acad Sci U S A 2003;100:14920 –14925. Esni F, Ghosh B, Biankin AV, Lin JW, Albert MA, Yu X, MacDonald RJ, Civin CI, Real FX, Pack MA, Ball DW, Leach SD. Notch inhibits exocrine differentiation in developing mouse and zebrafish pancreas. Development 2004;131:4213– 4224. Lowenfels AB, Maisonneuve P, Cavallini G, Ammann RW, Lankisch PG, Andersen JR, DiMagno EP, Andren-Sandberg A, Domellof L. Pancreatitis and the risk of pancreatic cancer. International Pancreatitis Study Group. N Engl J Med 1993;328:1433–1437. Lowenfels AB, Maisonneuve P, DiMagno EP, Elitsur Y, Gates LK Jr, Perrault J, Whitcomb DC. Hereditary pancreatitis and the risk of pancreatic cancer. International Hereditary Pancreatitis Study Group. J Natl Cancer Inst 1997;89:442– 446. Vila MR, Lloreta J, Real FX. Normal human pancreas cultures display functional ductal characteristics. Lab Invest 1994;71: 423– 431. Wagner M, Luhrs H, Kloppel G, Adler G, Schmid RM. Malignant transformation of duct-like cells originating from acini in trans-

PTF1␣/p48 TRANSCRIPTION FACTOR

50.

51. 52. 53. 54.

55.

56. 57.

58.

59.

949

forming growth factor transgenic mice. Gastroenterology 1998;115:1254 –1262. Wagner M, Greten FR, Weber CK, Koschnick S, Mattfeldt T, Deppert W, Kern H, Adler G, Schmid RM. A murine tumor progression model for pancreatic cancer recapitulating the genetic alterations of the human disease. Genes Dev 2001;15:286 – 293. Jaffee EM, Hruban RH, Canto M, Kern SE. Focus on pancreas cancer. Cancer Cell 2002;2:25–28. Hruban RH, Wilentz RE, Kern SE. Genetic progression in the pancreatic ducts. Am J Pathol 2000;156:1821–1825. Real FX. A “catastrophic hypothesis” for pancreas cancer progression. Gastroenterology 2003;124:1958 –1964. Scarpelli DG, Rao MS, Reddy JK. Are acinar cells involved in the pathogenesis of ductal adenocarcinoma of the pancreas? Cancer Cells 1991;3:275–277. Real FX. The cell biology of pancreatic cancer: an overview. In: Neptolemos J, Lemoine NR, eds. Pancreatic cancer. Oxford: Blackwell Science Press, 1995:3–17. Schmid RM. Acinar-to-ductal metaplasia in pancreatic cancer development. J Clin Invest 2002;109:1403–1404. Schussler MH, Skoudy A, Ramaekers F, Real FX. Intermediate filaments as differentiation markers of normal pancreas and pancreas cancer. Am J Pathol 1992;140:559 –568. Grippo PJ, Nowlin PS, Demeure MJ, Longnecker DS, Sandgren EP. Preinvasive pancreatic neoplasia of ductal phenotype induced by acinar cell targeting of mutant K-ras in transgenic mice. Cancer Res 2003;63:2016 –2019. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jakobetz MA, Ross S, Conrads TP, Veenstra TD, Hitt BA, Kawaguchi Y, Johann D, Liotta LA, Crawford HC, Putt ME, Jacks T, Wright CV, Hruban RH, Lowy AM, Tuveson DA. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 2003;4:437– 450.

Received July 9, 2003. Accepted June 10, 2004. Address requests for reprints to: Francisco X. Real, M.D., Unitat de Biologia Cel.lular i Molecular, Institut Municipal d’Investigació Mèdica, 08003 Barcelona, Spain. e-mail: [email protected]; fax: (34) 932213237. Supported in part by grants from Plan Nacional de IⴙD, Ministerio de Ciencia y Tecnología (grants PM97-0077 and SAF2001-0420), Marató de TV-3, Generalitat de Catalunya (SGR-00410), and Ministerio de Educación, Cultura y Deporte (to A.R.), and Generalitat de Catalunya (to T.A.). The authors thank J. M. Corominas for providing human tissue specimens, E. Sandgren, C. W. Wright, P. L. Herrera for providing pancreata from mutant mice, the investigators mentioned in the text for providing reagents, N. Malats for statistical analyses, A. Mallabiabarrena and M. L. Campos for valuable contributions, and X. Mayol for critical review of the manuscript.