Pathway identification combining metabolic flux and functional genomics analyses: Acetate and propionate activation by Corynebacterium glutamicum

Journal of Biotechnology 140 (2009) 75–83

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Pathway identification combining metabolic flux and functional genomics analyses: Acetate and propionate activation by Corynebacterium glutamicum Andrea Veit a , Doris Rittmann a , Tobias Georgi a , Jung-Won Youn c , Bernhard J. Eikmanns b , Volker F. Wendisch c,∗ a

Institute of Biotechnology 1, Research Center Jülich, D-52425 Jülich, Germany Institute of Microbiology and Biotechnology, University of Ulm, D-89061 Ulm, Germany c Institute of Molecular Microbiology and Biotechnology, Westfalian Wilhelms University Muenster, Corrensstr. 3, D-48149 Muenster, Germany b

a r t i c l e

i n f o

Article history: Received 15 July 2008 Received in revised form 13 November 2008 Accepted 19 December 2008 Keywords: Corynebacterium glutamicum Amino acid production Acetate activation Propionate activation CoA transferase

a b s t r a c t Corynebacterium glutamicum can utilize acetic acid and propionic acid for growth and amino acid production. Growth on acetate as sole carbon source requires acetate activation by acetate kinase (AK) and phosphotransacetylase (PTA), encoded in the pta-ack operon. Genetic and enzymatic studies showed that these enzymes also catalyze propionate activation and were required for growth on propionate as sole carbon source. However, when glucose was present as a co-substrate strain lacking the AK-PTA pathway was still able to utilize acetate or propionate for growth indicating that an alternative activation pathway exists. As shown by 13 C-labelling experiments, the carbon skeleton of acetate is conserved during activation to acetyl-CoA in this pathway. Metabolic flux analysis during growth on an acetate–glucose mixture revealed that in the absence of the AK-PTA pathway carbon fluxes in glycolysis, the tricarboxylic acid (TCA) cycle and anaplerosis via PEP carboxylase and/or pyruvate carboxylase were increased, while the glyoxylate cycle flux was decreased. DNA microarray experiments identified cg2840 as a constitutively and highly expressed gene putatively encoding a CoA transferase. Purified His-tagged Cg2840 protein was active as CoA transferase interconverting acetyl-, propionyl- and succinyl-moieties as CoA acceptors and donors. Strains lacking both the CoA transferase and the AK-PTA pathway could neither activate acetate nor propionate in the presence or absence of glucose. Thus, when these short-chain fatty acids are cometabolized with other carbon sources, CoA transferase and the AK-PTA pathway constitute a redundant system for activation of acetate and propionate. © 2008 Elsevier B.V. All rights reserved.

1. Introduction The non-pathogenic Corynebacterium glutamicum is used for the biotechnological production of amino acids such as l-glutamate or l-lysine (Shimizu and Hirasawa, 2007; Wittmann and Becker, 2007). This bacterium can grow on acetate and propionate as sole sources of carbon and energy (Arndt and Eikmanns, 2008; Claes et al., 2002; Gerstmeir et al., 2003; Wendisch, 2006). These shortchain fatty acids play a major role in nature’s carbon cycle; they are produced by fermentative bacteria and are oxidized by respiratory microorganisms to CO2 either aerobically or anaerobically. As in methylotrophic yeasts (Tabuchi et al., 1974) and in E. coli (Textor et al., 1997), the methylcitrate cycle for the conversion of propionyl-CoA to pyruvate is required for growth of C. glutamicum

∗ Corresponding author. Tel.: +49 251 833 9827; fax: +49 251 833 8388. E-mail address: [email protected] (V.F. Wendisch). 0168-1656/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2008.12.014

on propionate (Claes et al., 2002). While the prpD2B2C2 operon was shown to encode the key enzymes of the methylcitrate cycle, it was unknown how C. glutamicum activates propionate to propionyl-CoA (Claes et al., 2002). In contrast to enterobacteria, no prpE homologue encoding propionyl-CoA synthetase is located adjacent to C. glutamicum prp genes (Kalinowski et al., 2003). The metabolism of acetate and its regulation is well studied in C. glutamicum (Arndt and Eikmanns, 2008; Gerstmeir et al., 2003; Wendisch, 2006). Unlike in E. coli or Bacillus subtilis, acetate is not a typical overflow metabolite of glucose catabolism in C. glutamicum, but may be formed under oxygen-deprivation conditions (Dominguez et al., 1993) likely involving decarboxylation of pyruvate by pyruvate:quinone oxidoreductase Pqo (Schreiner and Eikmanns, 2005). During growth on acetate, acetate is taken up into the C. glutamicum cell in symport with protons by the carrier MctC (Jolkver et al., 2008) which also accepts propionate as substrate (Ebbighausen et al., 1991). Acetate is phosphorylated to acetyl-phosphate by acetate kinase (AK) and phosphotransacety-

76

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83

lase (PTA) subsequently converts acetyl-phosphate to acetyl-CoA (Reinscheid et al., 1999). AK and PTA are encoded in the pta-ack operon (Reinscheid et al., 1999) and both enzymes are essential for growth on acetate as sole source of carbon and energy (Reinscheid et al., 1999). Acetyl-CoA is oxidized to CO2 in the TCA cycle for generation of energy and reduction equivalents. When intermediates of the TCA cycle are withdrawn for anabolic reactions during growth on acetate, the TCA cycle is replenished by the glyoxylate cycle (Reinscheid et al., 1994a,b; Wendisch et al., 2000). The key enzymes of the glyoxylate cycle, isocitrate lyase and malate synthase, encoded by the divergent genes aceA and aceB (Reinscheid et al., 1994a, b), are essential for the growth of C. glutamicum on acetate, ethanol and fatty acids (Arndt et al., 2008; Arndt and Eikmanns, 2007, 2008). For growth of C. glutamicum on gluconeogenic carbon sources such as acetate, the reactions of PEP carboxykinase (Riedel et al., 2001) and fructose1,6-bisphosphatase (Rittmann et al., 2003) have been shown to be essential. In their natural habitats, bacteria may encounter substrate mixtures. Carbon source utilization by E. coli and B. subtilis typically is characterized by the sequential utilization of the carbon sources present in a substrate mixture with glucose being the preferred substrate (Lin, 1996). While glucose also sustains high growth rates and biomass yields in C. glutamicum, co-utilization of carbon sources characterizes growth of this bacterium on substrate mixtures. C. glutamicum co-utilizes glucose with other sugars (e.g. fructose), with acids such as acetate, propionate, pyruvate and l-lactate and with vanillate, protocatechuate and the non-growth substrate serine (Arndt and Eikmanns, 2008; Claes et al., 2002; Dominguez et al., 1998; Merkens et al., 2005; Netzer et al., 2004; Wendisch et al., 2000). As exception, growth of C. glutamicum on mixtures with glucose and either ethanol or glutamate is characterized by preferential utilization of glucose before ethanol and glutamate, respectively (Arndt et al., 2008; Krämer and Lambert, 1990). C. glutamicum shows monophasic growth on and co-utilization of a mixture of acetate and glucose (Wendisch et al., 2000). Metabolic flux analysis revealed that the activity of the TCA cycle was high on acetate, intermediate on acetate plus glucose and low on glucose. The anaplerotic function was fulfilled by carboxylation of phosphoenolpyruvate (PEP) and/or pyruvate during growth on glucose, while on acetate as well as on glucose–acetate mixture the glyoxylate cycle replenished the TCA cycle (Wendisch et al., 2000). During growth on glucose–acetate mixtures, the consumption rates for the individual carbon sources were reduced in such a way that the total carbon consumption was about the same as that during growth on either carbon source alone. With respect to acetate utilization, this indicated that either the uptake of acetate or the in vivo carbon fluxes from acetate to acetyl-CoA are directly or indirectly regulated by the carbon source in the growth medium or that different pathways for acetate activation are active (Wendisch et al., 2000). In biotechnological applications, glucose–acetate mixtures have recently been used for the production of l-valine and l-lysine by recombinant C. glutamicum production strains. These strains, which carried aceE deletions and, thus, lacked pyruvate dehydrogenase complex activity (Blombach et al., 2007a, b), require acetate for growth. The ability of C. glutamicum to co-utilize acetate with glucose allowed using the acetate feed for process control. Similarly, growth by co-utilization of acetate and glucose was decoupled from the production of l-valine or l-lysine from glucose when growth ceased (Blombach et al., 2007a, b). Here, we show that the AK-PTA pathway is essential for activation of propionate in C. glutamicum and for growth on propionate as sole carbon source. In addition, the role of this pathway for the co-utilization of propionate–glucose and acetate–glucose mixtures was investigated in detail.

2. Materials and methods 2.1. Materials Sodium [1-13 C]acetate (99% atom-enrichment) was purchased from Cambridge Isotope Laboratories, Andover, MA, USA, and sodium 3-trimethylsilyl-[2,2 ,3,3 -D4 ]propionate(99% atomenrichment) from Aldrich Chemicals, Milwaukee, WI, USA. 2.2. Microorganisms and cultivation conditions The wild-type (WT) strain of C. glutamicum ATCC 13032, the mutant IN-pta (Reinscheid et al., 1999) and the CoA transferasenegative mutant C. glutamicum cat, the CoA transferase and AK-PTA pathway-negative double mutant C. glutamicum INptacat (all described in this work) were used. To complement C. glutamicum IN-ptacat, plasmids pXMJ19-cat (see below) and pJU2 (Reinscheid et al., 1999), which is based on pJC1 (Cremer et al., 1990) were used. All C. glutamicum strains were pre-cultured on Luria–Bertani (LB) complex medium (Sambrook and Russell, 2001) with chloramphenicol (25 ␮g/ml) and kanamycin (25 ␮g/ml) added when appropriate. Exponentially growing cells were harvested by centrifugation (5000 × g, 5 min, 4 ◦ C), washed twice in 50 mM NaCl–50 mM Tris–HCl (pH 6.3) and used to inoculate CgC minimal medium (Eikmanns et al., 1991). For flux analysis, the carbon and energy sources were either unlabelled sodium acetate and/or glucose at concentrations indicated in the results section or, in case of the 13 C-labelling experiments, sodium [1-13 C]acetate (99% atom-enrichment) (10 g/l) with unlabelled glucose (10 g/l). All cultivations were done as 60 ml cultures in 500 ml baffled Erlenmeyer flasks at 30 ◦ C and with agitation at 140 rpm. After about four generations, exponentially growing cells were harvested and washed as described above. The cell pellet was then used for the extraction of amino acids. 2.3. Quantitation of metabolite fluxes For the quantitation of carbon fluxes in the central metabolism of C. glutamicum, NMR spectroscopic and metabolite balancing data were combined in a non-linear least squares fitting procedure as described previously (Marx et al., 1996; Wendisch et al., 2000). C. glutamicum IN-pta and IN-ack were cultured on sodium [1-13 C]acetate and unlabelled glucose and the 13 C labelling patterns of amino acids purified from exponentially growing cells were determined. The 13 C labelling patterns of the precursors pyruvate, oxaloacetate, 2-oxoglutarate and 3-phosphoglycerate were deduced from the labelling patterns of alanine and valine, threonine and aspartate, glutamate and arginine and serine and glycine, respectively (Marx et al., 1996; Wendisch et al., 2000). For flux calculations, a representation of the central metabolism of C. glutamicum as described by Wendisch et al. (2000) was used. The precursor requirements for C. glutamicum biomass synthesis were taken from Marx et al. (1996) and modified as in Wendisch et al. (2000). For flux calculations the mathematical approach and the computational tools described by Wiechert and de Graaf (1997) and Wiechert et al. (1997) were used. 2.4. Extraction, purification and quantification and NMR spectroscopic analysis of amino acids Amino acids were extracted by acid hydrolysis of cell pellets, purified by cation exchange chromatography and quantified by reversed-phase liquid chromatography with precolumn orthophthaldialdehyde derivatization as described previously (Wendisch et al., 2000). High-resolution 1 H NMR spectra of amino acids were obtained by an AMX-400 WB spectrometer (Bruker, Karlsruhe, Ger-

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83

many) operating at 400.13 MHz and equipped with a multichannel interface and a 5 mm inverse probehead. 13 C-enrichments were determined using the parameters and the methods described previously (Sonntag et al., 1993; Wendisch et al., 1997a). 2.5. Construction of the succinyl-CoA transferase-deficient C. glutamicum strains To construct a cat deletion mutant and a cat and pta double mutant of C. glutamicum WT, regions upstream and downstream of the cat gene were PCR-amplified using primers cat-A (5 -GCTCTAGACCTAACTATTGTCCC-3 (nt 2731377 of NC003450 is underlined and the XbaI restriction site is given in bold), cat-B (5 -CCCATCCACTAAACTTAAACATGAAGCAATGCGATCAGA-3 ; nt 2730864 of NC003450 is underlined; a linker sequence complementary to that in cat-C is given in italics), as well as cat-C (5 -TGTTTAAGTTTAGTGGATGGGCACATCAACCTGGCTAAG-3 ; nt 2729414 of NC003450 is underlined; a linker sequence complementary to that in cat-B is given in italics) and cat-D (5 -GCGTCGACGCCACCACGATAACGC-3 ; nt 2728886 of NC003450 is underlined and the SalI restriction is given in bold). In a crossover PCR using both of the generated PCR fragments as templates, a 1062 bp fragment was amplified with primers cat-A and cat-D. Subsequently, this fragment was cloned into pK19mobsacB (Schäfer et al., 1994) via its primer-attached XbaI and PstI sites. Gene deletion mutagenesis with pK19mobsacBcat was performed as described previously (Peters-Wendisch et al., 1993). The correct genotype of the cat deletion mutant was verified by PCR analysis using the primers 1-cat (5 -GTTCACGGCACAGCGTGC-3 ; nt 2731476 of NC003450 is underlined), and 2-cat (5 -GACCGTCGTCTTCGGAAG3 ; nt 2728735 of NC003450 is underlined). The cat deletion mutant was designated C. glutamicum cat. Subsequently, the pta gene was disrupted in C. glutamicum cat using pEM1-pta as described previously for C. glutamicum WT (Reinscheid et al., 1999). The resulting cat-pta double mutant was devoid of PTA activity, could not grow on acetate as sole carbon source and was named C. glutamicum IN-ptacat. 2.6. Overexpression of cat in E. coli and C. glutamicum For overexpression of the CoA transferase gene, cat was amplified from genomic DNA of C. glutamicum WT by PCR using primers with the following sequences: 5 -GCTCTAGAAAGGAGATATAGATATGTCTGATCGCATTGCT-3 (nt 2730884 of NC003450 is underlined; the XbaI restriction site is given in bold, the sequence upstream of the T7 gene 10 including the ribosome binding site is given in italics) and 5 -GCGAATTCTTATGCCTTCATGGAGCCGTTCTT3 (nucleotide 2729376 of NC 003450 is underlined; the EcoRI restriction site is given in bold). The amplification product was subcloned into vector pGEM-T (Promega, Mannheim, Germany) resulting in vector pGEM-T-cat. After restriction with EcoRI and XbaI, the corresponding 1.5 kb fragment from pGEM-T-cat was ligated to EcoRI and XbaI restricted pXMJ19. The resulting vector, pXMJ19-cat, allows for IPTG-inducible expression of cat in C. glutamicum and E. coli. 2.7. Purification of CATHis For the expression of the CAT gene, cg2840 was amplified via PCR from genomic DNA of C. glutamicum WT using primers 2881His-for (5 -GGCCCTTCATATGTCTGATCGCATTG-3 ; nt 2730884 to 2730869 of NC003450 are italicized, the start codon is underlined, and the NdeI recognition site is shown in bold) and 2881His-rev (5 CTAAGAGGAATTCTTATGCCTTCATG -3 ; nt 2729375 to 2729388 of NC003450 are italicized, the stop codon is underlined, and the EcoRI restriction site is shown in bold). The amplification prod-

77

uct was cloned via the NdeI and EcoRI restricition sites into pET28a (Novagen, Madison, WI). The vector, pET28a-cat, allows IPTG-inducible expression of the gene encoding CAT with an Nterminal hexahistidyl tag in E. coli BL21(DE3). The induction with 0.5 mM IPTG was started at an OD 600 of 0.3 in LB. The cells (500 ml) were harvested 4 h after induction and washed in 50 mM potassium phosphate, pH 7.5, containing 50 mM NaCl. Pelleted cells were stored at −20 ◦ C until protein purification. Prior to lysis by French press, cells were resuspended in 50 mM potassium phosphate, pH 7.5, containing 50 mM NaCl, and protease activity was inhibited by addition of 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 mM diisopropylfluorophosphate (DFP). The extract was cleared by centrifugation for 1.5 h at 140,000 × g. Peak fractions of Ni-nitrilotriacetic acid (Ni-NTA) agarose affinity chromatography eluted with 20 mM Tris, 300 mM NaCl, 100 mM, 200 mM, or 400 mM imidazol, and 5% (v/v) glycerol were pooled, and the pooled fractions were desalted using Sephadex G25 gel filtration (Amersham Bioscience, Uppsala) and buffered in 50 mM potassium phosphate, pH 7.5, containing 50 mM NaCl. The molecular weight of purified CAT was determined by gel filtration using a Superdex column (HiLoad 26/60 Superdex200 prep grade; Amersham). Therefore, 2 mg CAT dissolved in 2 ml of 50 mM potassium phosphate, pH 7.5, containing 50 mM NaCl was applied to the column. The calibration was carried out using gel filtration molecular weight markers (MW-GF-200; Sigma) containing the proteins cytochrome c (12.4 kDa), carbonic anhydrase (29 kDa), bovine serum albumin (66 kDa), alcohol dehydrogenase (150 kDa), and ␤-amylase (200 kDa). The void volume was determined with blue dextran. 2.8. Succinyl-CoA transferase assay Succinyl-CoA:acetate CoA-transferase activity was measured in a coupled spectrophotometric assay (Scherf and Buckel, 1991) containing 50 mM potassium phosphate, pH 7.5, 0.1 mM succinylCoA, 1 mM oxaloacetate, 1 mM DTNB and porcine heart citrate synthase (5 U/ml). The assay was started with 200 mM acetate. Acetyl-CoA formed by the reaction of the CoA transferase was converted to citrate by coupling to citrate synthase and the liberated CoA was reacted with DTNB and the concomitant formation of TNB (ε412 nm = 13.6 mM−1 cm−1 ) was followed at 412 nm. The protein concentration was determined by the Biuret method (Gornall et al., 1949). Specific succinyl-CoA:acetate CoA-transferase activity is given as U (mg protein)−1 or ␮mol min−1 (mg protein)−1 . To determine the substrate specificity of succinyl-CoA:acetate CoAtransferase, propionyl-, butyryl-, palmitoyl-, stearoyl-, malonyl- or acetoacetyl-CoA was used instead of succinyl-CoA. To test whether acetyl-CoA serves as CoA donor, the amount of acetyl-CoA before and after starting the reaction by adding either propionate or succinate was quantified based on detection with DTNB as described above. 2.9. Phosphate propionyltransferase assay To assay whether the enzyme encoded by C. glutamicum pta is active as phosphate propionyltransferase, enzyme assay conditions similar to those for C. glutamicum PTA were used (Reinscheid et al., 1999), but first propionylphosphate was synthesized using AK from E. coli (Boehringer). Reactions contained in 1 ml 50 mM Tris, pH 7.6, 40 mM NH4 Cl, 5 mM MgCl2 , 3 mM ATP, 0.2 mM CoA, 12.5 U/ml AK from E. coli (Boehringer), 0.2 M sodium propionate, pH 6.3. The reaction was started by adding crude extract and the remaining free CoA of this reaction and of a control reaction without crude extract was quantified discontinuously after fivefold dilution with 100 mM Tris, 0.2 mM DTNB.

78

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83

2.10. Comparative genome and transcriptome analysis using DNA microarrays The generation of C. glutamicum DNA microarrays, total RNA preparation, cDNA synthesis, preparation and labelling of genomic DNA, DNA microarray hybridization, and statistical data analysis were performed as described previously (Ishige et al., 2003; Lange et al., 2003; Polen and Wendisch, 2004; Wendisch, 2003). 3. Results 3.1. Characterization of the growth of C. glutamicum strains IN-pta and IN-ack on propionate C. glutamicum can grow on propionate as sole carbon source (Claes et al., 2002). As in E. coli (Textor et al., 1997), propionate is metabolized via the methylcitrate cycle in C. glutamicum and the operon prpD2B2C2 encoding methylcitrate dehydratase, methylcitrate lyase and methylcitrate synthase, respectively, are shown to be required for growth on propionate (Claes et al., 2002). As a gene homologous to the E. coli propionyl CoA synthetase gene prpE is absent from the C. glutamicum genome (Kalinowski et al., 2003) and as propionyl-CoA synthetase activity could not be detected in C. glutamicum crude extracts (Reinscheid et al., 1999), it was proposed that propionate is activated by AK and PTA in C. glutamicum (Claes et al., 2002). To test this hypothesis, C. glutamicum WT and strains IN-pta and IN-ack, which harbor integration mutations in the pta and ack genes, respectively, were cultured on CgXII minimal medium with 50 mM potassium propionate as sole carbon source. Whereas C. glutamicum WT grew with a growth rate of 0.1 h−1 and formed 2.6 g dry mass l−1 , both C. glutamicum IN-pta and IN-ack showed no growth (data not shown). This indicated that pta and ack are required for activation of propionate in C. glutamicum. 3.2. C. glutamicum pta codes for an enzyme active as phosphotransacetylase and as phosphate propionyltransferase As both ack and pta of C. glutamicum were essential for utilization of propionate as sole carbon source, the encoded enzymes were expected to convert propionate via propionylphosphate to propionyl-CoA. It was shown previously that acetate kinase from C. glutamicum is active with propionate exhibiting a KM of about 15 mM for this substrate, which is slightly higher than the KM of about 8 mM for acetate (Reinscheid et al., 1999). To test whether the pta gene product is also active as a phosphate propionyltransferase, crude extracts of C. glutamicum strains WT, IN-ack and IN-pta grown on propionate plus glucose minimal medium were assayed for this activity. While crude extracts of C. glutamicum strains WT and strain IN-ack exhibited specific activities of phosphate propionyltransferase of 1.1 U (mg protein)−1 and 1.0 U (mg protein)−1 ,

respectively, no specific activity of phosphate propionyltransferase could be detected (<0.005 U (mg protein)−1 ) in C. glutamicum INpta, which carries an insertion in the pta gene. Thus, the enzymes of the AK-PTA pathway in C. glutamicum carry the enzymatic activities required for activation of propionate to propionyl-CoA. 3.3. Characterization of the growth of C. glutamicum strains IN-pta on glucose–acetate and glucose–propionate mixtures AK and PTA have been shown to be essential for growth of C. glutamicum on acetate (Reinscheid et al., 1999) and on propionate as sole carbon source (see above), but were not required for growth on glucose as sole carbon source (Reinscheid et al., 1999). C. glutamicum co-utilizes acetate with glucose (Wendisch et al., 2000) and propionate with glucose (Claes et al., 2002), but the role of ack and pta for co-utilization of short-chain fatty acids with glucose has not been investigated so far. Therefore, C. glutamicum WT and strain IN-pta (which lacks both AK and PTA activity) were cultured on CgXII minimal medium containing a mixture of 50 mM glucose and 50 mM potassium acetate as carbon source. C. glutamicum IN-pta utilized acetate and glucose simultaneously and formed as much biomass as C. glutamicum WT (Table 1). Similarly, when C. glutamicum strains WT and IN-pta were cultured on CgXII minimal medium containing a mixture of 50 mM glucose and 50 mM potassium propionate, C. glutamicum IN-pta co-utilized propionate with glucose and formed nearly as much biomass as C. glutamicum WT (Table 1). Thus, in the absence of acetate/propionate activation via the ack and pta gene products C. glutamicum can co-utilize acetate as well as propionate with glucose, which indicated the operation of an alternative pathway for acetate/propionate activation under these conditions. 3.4. Metabolite flux analysis of C. glutamicum IN-ack and IN-pta during growth on a glucose–acetate mixture In order to determine the fate of 13 C-labelled acetate during co-utilization with glucose in the absence of the AK-PTA pathway, we performed 13 C-labelling experiments with C. glutamicum INack and IN-pta combined with metabolite balancing as described by Wendisch et al. (2000); for details see Section 2. C. glutamicum IN-ack and IN-pta were cultured on minimal medium with a mixture of sodium [1-13 C]acetate and unlabelled glucose as sole carbon sources. No significant by-product formation was detected in NMR analyses of culture supernatants. Exponentially growing cells of the cultures were harvested, hydrolysed and amino acids were purified from the lysate by liquid chromatography as described by Wendisch et al. (2000). The 13 C-labelling patterns of alanine and valine, aspartic acid and threonine, glutamic acid and arginine and serine and glycine were determined by NMR and the corresponding labelling patterns of pyruvate, oxaloacetate, 2-oxoglutarate and 3-phosphoglycerate were deduced (Table 2). The high 13 C-labelling

Table 1 Growth rates, biomass yields and carbon source utilization of C. glutamicum strains WT, IN-pta, cat and IN-ptacata . Biomass formed(g DW l−1 )

Glucose utilized(mM)

Propionate utilized(mM)

Growth on 50 mM glucose plus 50 mM acetate WT 0.35 IN-pta 0.25 cat 0.38 IN-ptacat 0.23

3.5 3.4 3.7 2.6

50 50 50 50

50 50 50 0

Growth on 50 mM glucose plus 50 mM propionate WT 0.29 IN-pta 0.26 cat 0.29 IN-ptacat 0.29

5.0 3.8 4.3 3.0

50 50 50 50

50 50 50 0

C. glutamicum

Growth rate (h−1 )

a C. glutamicum strains WT, IN-pta, cat and IN-ptacat were cultured on CgXII mineral medium containing a mixture of 50 mM glucose plus 50 mM potassium acetate or 50 mM potassium propionate, respectively. Values are from three experiments with relative experimental errors less than 5%.

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83

79

Table 2 13 C-enrichments in carbon atoms of central metabolitesa . Central metabolite

Carbon atom

13

C-enrichments (%)

IN-ack Experimental

IN-pta Fitted

Experimental

Fitted

Pyruvateb

C-1 C-2 C-3

6.2 ± 0.1 1.1 ± 0.4 1.1 ± 0.4

6.2 1.1 1.1

6.4 ± 0.4 1.1 ± 0.4 1.2 ± 0.3

6.4 1.1 1.1

Oxaloacetatec

C-1 C-2 C-3 C-4

27.7 ± 1.0 1.1 ± 0.4 1.1 ± 0.4 30.0 ± 0.2

26.8 1.1 1.1 30.3

27.8 ± 0.8 1.1 ± 0.4 1.1 ± 0.4 31.6 ± 0.4

27.9 1.1 1.1 31.6

2-Oxoglutarated

C-1 C-2 C-3 C-4 C-5

31.1 ± 0.3 1.1 ± 0.4 1.1 ± 0.4 1.1 ± 0.4 70.3 ± 5.2

30.4 1.1 1.1 1.1 65.4

31.6 ± 0.6 1.1 ± 0.4 1.1 ± 0.4 1.1 ± 0.4 66.9 ± 4.5

31.6 1.1 1.1 1.1 66.4

3-Phosphoglyceratee

C-1 C-2 C-3

– 1.1 ± 0.4 –

1.1

– 1.1 ± 0.4 –

1.1

a C. glutamicum IN-pta and IN-ack were cultured on CgC mineral medium containing 10 g glucose/l plus 10 g potassium [1-13 C]acetate/l. 13 C-enrichments were determined by 13 C-edited 1 H NMR in amino acids isolated from acid hydrolysates of exponentially growing cells. The 13 C-enrichments of central metabolites were deduced from the 13 C-enrichments of amino acids as indicated and are means of 2-4 determinations. b 13 C-enrichments deduced from alanine and valine. c 13 C-enrichments deduced from aspartic acid and threonine. d 13 C-enrichments deduced from glutamic acid and arginine. e 13 C-enrichments deduced from glycine and serine.

of C-5 of 2-oxoglutarate (70.3% ± 5.2 and 66.9% ± 4.5, respectively) and the natural abundance 13 C-labelling of C-4 of 2-oxoglutarate (1.1% ± 0.4 in both cases) indicated that [1-13 C]acetate is activated and fuelled into the TCA cycle without 13 C-label scrambling indicating that the carbon skeleton of acetate is conserved when acetyl-CoA is formed from acetate. Using the 13 C-labelling data, the rates of biomass formation and the consumption rates of acetate and glucose, the in vivo carbon metabolite fluxes within the central metabolism of C. glutamicum were quantified as described previously for C. glutamicum WT (Wendisch et al., 2000). The fluxes determined for C. glutamicum IN-ack and IN-pta are summarized in Fig. 1 and are compared to those for C. glutamicum WT cultured under the same conditions (Wendisch et al., 2000). In C. glutamicum IN-ack and IN-pta growing on a mixture of acetate and glucose, the consumption rates of acetate were 218 mU (mg protein)−1 and 203 mU (mg protein)−1 , respectively, and thus lower than the acetate consumption rate of 270 mU (mg protein)−1 determined for C. glutamicum WT (Wendisch et al., 2000). The glucose consumption rates were 126 mU (mg protein)−1 and 120 mU (mg protein)−1 , respectively, in C. glutamicum IN-ack and IN-pta (Fig. 1), while in C. glutamicum WT glucose was consumed with a rate of 72 mU (mg protein)−1 (Wendisch et al., 2000). Whereas the anaplerotic demand was fulfilled by the glyoxylate cycle in C. glutamicum WT (Wendisch et al., 2000), the glyoxylate cycle was (nearly) not active in C. glutamicum IN-ack and IN-pta, but the TCA cycle was replenished by PEP carboxylase and/or pyruvate carboxylase (Fig. 1). The low glyoxylate cycle flux in C. glutamicum IN-ack and IN-pta is commensurate with the finding of low glyoxylate cycle gene expression in strains lacking functional acetate kinase or phosphotransacetylase (Wendisch et al., 1997b). In C. glutamicum IN-ack and IN-pta, fluxes in the Embden–Meyerhof–Parnas pathway from glyceraldehyde3-phosphate to PEP/pyruvate and by the pyruvate dehydrogenase complex to acetyl-CoA were two- to threefold higher than in C. glutamicum WT (Fig. 1). While acetyl-CoA formation from acetate was reduced, acetyl-CoA formation from pyruvate was increased in C. glutamicum IN-ack and IN-pta as compared to C. glutamicum WT, so that the combined flux towards acetyl-CoA was comparable in

the three strains (286–304 mU (mg protein)−1 ). However, the partitioning between fluxes from acetyl-CoA into the TCA cycle and into glyoxylate cycle differed between WT (50/219) and the ACK- and PTA-deficient strains (4/265 and 0/252). The fluxes of acetyl-CoA into the TCA cycle were higher in C. glutamicum IN-ack and IN-pta than in C. glutamicum WT and exceeded the acetate consumption rate (Fig. 1). Taken together, the central metabolism of C. glutamicum IN-ack and IN-pta growing on acetate plus glucose is similar to each other and in comparison to C. glutamicum WT is characterized by an increased conversion rate of glucose to PEP/pyruvate, (nearly) no activity of the glyoxylate cycle, anaplerosis by PEP carboxylase and/or pyruvate carboxylase and an increased activity of the TCA cycle. 3.5. Global gene expression monitoring in C. glutamicum IN-pta Based on the hypothesis that gene(s) responsible for acetate activation in the absence of the AK-PTA pathway might be induced in C. glutamicum IN-pta grown on glucose plus acetate, the transcriptomes of C. glutamicum IN-pta grown either on glucose alone or on glucose plus acetate were compared. Global gene expression analysis using whole-genome C. glutamicum DNA microarrays (Polen and Wendisch, 2004; Wendisch, 2003) revealed average gene expression changes of a factor of three or more in two biological replicates for only four genes (cg0160, cg1553, argF and cg2558). The mRNA level of cg0160, which encodes a hypothetical protein, increased fourfold and the mRNA levels of the ornithine carbamoyltransferase gene argF, of cg1553 and of cg2558, which encodes a putative nucleoside-diphosphate-sugar epimerase, decreased fourto fivefold in C. glutamicum IN-pta during growth on glucose plus acetate as compared to glucose (data not shown). Thus, although acetate activation occurred in vivo with a high specific activity of about 200 mU (mg protein)−1 in the absence of the AK-PTA pathway during growth on glucose–acetate mixtures, no genes putatively encoding enzymes for alternative acetate activation were found to be induced under these conditions. Therefore, we hypothesized that such gene(s) might be among the constitutively and highly expressed genes of C. glutamicum.

80

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83

Fig. 1. Metabolite fluxes in the central metabolism of C. glutamicum strains WT, IN-pta and IN-ack during growth on acetate plus glucose. Fluxes in mU (mg protein)−1 of C. glutamicum strains WT, IN-pta and IN-ack are given in the first, second and third row, respectively. Exchange fluxes are given in ovals. Fluxes from metabolites to biomass are indicated by arrows facing away from the biomass precursor metabolites.

3.6. Identification of highly abundant transcripts in LB- and glucose-grown C. glutamicum To identify highly expressed C. glutamicum genes, we hybridized C. glutamicum DNA microarrays with green-fluorescently labelled cDNA derived from mRNA of glucose- or LB-grown cells and as a reference with red-fluorescently labelled genomic DNA. Among the 100 genes for which the highest mRNA levels were estimated, 32 genes for ribosomal proteins, ten genes for enzymes of the respiratory chain and the proton-pumping ATPase, nine genes for enzymes of the central carbon metabolism and 48 other genes were found (Table 3).

One of the genes, cg2840, that exhibited high transcript levels (Table 3) was annotated to encode a putative acetyl-CoA hydrolase (COG0427) (Kalinowski et al., 2003). An independent proteome analysis revealed a high abundance of the cg2840 gene product in glucose-grown C. glutamicum (Schaffer et al., 2001). The deduced protein sequence of 502 amino acids shares 91% and 75% identical amino acids with CE2460 and CE0520 from C. efficiens, respectively, 78% with jk0384 from C. jeikeium, 75% with DIP1920 from C. diphtheriae and 51% with the acetic acid resistance protein AarC from Acetobacter aceti (Fukaya et al., 1990). The biochemically characterized succinyl-CoA:acetate CoA transferase from Clostridium kluyveri (Sohling and Gottschalk, 1996) and propionyl-CoA:succinate CoA

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83

81

Table 3 Genes showing high transcript abundance in C. glutamicum WTa . Ribosomal and related proteins Carbon metabolism Energy metabolism Others

Genes encoding L1, L2, L3, L4, L5, L6, L10, L11, L13, L14, L16, L18, L22, L24, L28, L29, L30, L31, L35, S3, S4, S5, S6, S7, S10, S11, S13, S14, S16, S17, S19, EF-TS, IF-3, ribosome-associated protein Y pyc, gltA, eno, ptsG, acn, tkt, pyk, sucB, fba, gpm, dtsR1, dtsR2, glgP1, odhI atpB, atpE, atpF, atpH, atpA, atpG, ctaD, ctaC, ctaE, qcrC, qcrA, ndh rpoA, rpoB, leuA, oppA, dnaK, sod, mopA, ssb, nlpC, cg0350, cg0571, cg0651, cg0705, cg0737, cg0756, cg0825, cg0878, cg0898, cg0952, cg0953, cg0957, cg1001, cg1227, cg1476, cg1514, cg1763, cg1764, cg1810, cg1911, cg2052, cg2177, cg2195, cg2196, cg2413, cg2704, cg2828, cg2840, cg3014, cg3138, cg3186, cg3260, cg3422

a The 100 genes listed showed the highest transcript abundances during growth of C. glutamicum WT on glucose minimal medium as detected in DNA microarray hybridizations. Green-fluorescent labelled genomic DNA and red-fluorescent labelled cDNA generated from RNA of C. glutamicum WT during exponential growth on glucose minimal medium. Genes given in bold also showed high transcript levels scoring among the 100 most abundant transcripts during growth on LB.

transferase (YgfH) from E. coli (Haller et al., 2000) share 47% and 46%, respectively, identical amino acids with C. glutamicum cg2840. Therefore, we hypothesized that the enzyme encoded by C. glutamicum cg2840 might be a CoA transferase generating acetyl-CoA. 3.7. Overproduction, purification and characterization of His-tagged cg2840 gene product In order to test whether cg2840 encodes acetate CoA transferase, the gene was overexpressed using the IPTG-inducible C. glutamicum/E. coli shuttle vector pXMJ19 (Jakoby et al., 1999). After growth on LB and 0.5 mM IPTG crude extracts of E. coli MG1655 or of MG1655(pXMJ19) showed <0.01 U (mg protein)−1 succinylCoA:acetate CoA transferase activity while 0.10 U (mg protein)−1 was measured in crude extracts of MG1655(pXMJ19-cat). Thus, cg2840 codes for an enzyme with succinyl-CoA:acetate CoA transferase activity and was named cat. In order to determine the substrate specificity of the CoA transferase Cat encoded by C. glutamicum cat, the gene was expressed in E. coli BL21(DE3) using pET28a to generate an N-terminally His-tagged protein. From a 1 l culture grown in LB, about 1 mg of protein was purified by Ni-NTA chromatography (data not shown). With acetate and succinyl-CoA, the enzyme preparation showed a specific activity of 22.5 U (mg protein)−1 . Gel permeation chromatography revealed that the enzyme is active as a homodimer (∼110 kDa) with a predicted molecular mass for the monomer of 55.4 kDa (data not shown). To determine the substrate specificity of the C. glutamicum CoA transferase, the rate of enzyme-catalyzed formation of acetyl-CoA from various potential CoA donors was measured. With acetate as acceptor, butyryl-CoA, palmitoyl-CoA, stearyl-CoA, malonyl-CoA and acetoacetyl-CoA were not significant substrates of the C. glutamicum CoA transferase. On the other hand, succinyl-CoA and propionyl-CoA served as CoA donors in the reaction with acetate as CoA acceptor. Half-maximal reaction rates were observed with 0.14 mM acetate, 0.16 mM succinyl-CoA and 0.15 mM propionyl-CoA, respectively. Thus, C. glutamicum cat codes for a CoA transferase that catalyzes the reversible transfer of a CoA moiety between donor and acceptor carboxyl functions of acetate, propionate and succinate.

growth phase indicating growth phase-dependent control of this enzyme. The absence of the cat gene did neither influence growth of C. glutamicum on glucose and/or acetate nor on LB, ribose, llactate or pyruvate as strains WT and cat grew comparably on these substrates (Table 1 and data not shown). To study the consequence of the absence of the cat gene for the co-utilization of acetate or propionate with glucose, the double mutant C. glutamicum IN-ptacat lacking the cat gene as well as the AK-PTA pathway was constructed. As C. glutamicum INpta, the double mutant IN-ptacat could not grow on acetate as sole carbon source confirming the absence of the AK-PTA pathway. Complementation of IN-ptacat with pJU2 allowed growth on acetate as sole carbon source, while IN-ptacat(pJC1) carrying the empty vector could not grow on acetate (data not shown). On minimal medium containing 50 mM glucose and 50 mM acetate C. glutamicum strains WT, cat and IN-pta co-utilized acetate with glucose and reached comparable biomass concentrations (Table 1). However, the double mutant C. glutamicum IN-ptacat only used glucose, while acetate remained in the medium, and formed 70–80% of the biomass as compared to strains WT, C. glutamicum IN-pta and cat (Table 1). Complementation of IN-ptacat with pXMJ19-cat resulted in specific activities of succinyl-CoA:acetate CoA transferase as high as in C. glutamicum WT and allowed biomass formation in medium with acetate plus glucose as high as observed for C. glutamicum WT (data not shown). Similarly, on media with a glucose-propionate mixture C. glutamicum IN-ptacat only used glucose and formed only 70–80% of the biomass as compared to C. glutamicum strains WT, IN-pta and cat, which co-utilized both carbon sources (Table 1). Thus, in the absence of a functional AKPTA kinase pathway co-utilization of either acetate or propionate with glucose by C. glutamicum requires CoA transferase encoded by the cat gene.

3.8. Role of CoA transferase Cat for growth of C. glutamicum on different carbon sources The cat gene was deleted in C. glutamicum WT to yield strain cat. C. glutamicum cat showed low specific activities of succinylCoA:acetate CoA transferase of about 0.10 U (mg protein)−1 during growth on a glucose–acetate mixture (Fig. 2). In contrast, the specific activities of succinyl-CoA:acetate CoA transferase of C. glutamicum WT varied during growth on a glucose–acetate mixture between 0.18 U (mg protein)−1 and 0.58 U (mg protein)−1 (Fig. 2). The highest specific activity was observed in the early exponential

Fig. 2. Growth (squares) and specific succinyl-CoA:acetate CoA transferase activities (circles) in crude extracts of C. glutamicum strains WT (filled symbols) and cat (open symbols) during growth on minimal medium with glucose and acetate.

82

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83

4. Discussion Previous work demonstrated that AK from C. glutamicum is able to phosphorylate propionate to propionylphosphate (Reinscheid et al., 1999) and here it was shown that PTA from C. glutamicum converts propionylphosphate to propionyl-CoA. Moreover, we here found that the ack-pta operon is required for growth of C. glutamicum on propionate as sole carbon source. These results indicate that the AK-PTA pathway in C. glutamicum catalyzes in vivo activation of acetate and propionate to acetyl-CoA and propionyl-CoA, respectively. Similar to PTA from C. glutamicum, PTA enzymes from other microorganisms accept propionylphosphate besides acetylphosphate and the PTAs from Thermotoga maritima, Clostridium kluyveri and B. subtilis also convert butyrylphosphate to its CoA ester (Bock et al., 1999; Rado and Hoch, 1973; Stadtman, 1955). In contrast, PTAs from enteric bacteria do not accept propionylphosphate as substrate, which is formed by phosphorylation of propionate by AckA, TdcD or PduW (Palacios et al., 2003). Growth of enteric bacteria on propionate requires either propionyl-CoA synthetase PrpE or acetyl-CoA synthetase Acs as a prpE acs double mutant could not grow with propionate as sole carbon source, while both single mutants did (Horswill and Escalante-Semerena, 1999). In the absence of the AK-PTA pathway, C. glutamicum could only utilize acetate and propionate for biomass formation, when a cosubstrate such as glucose was present. The cg2840 gene product Cat was shown to transfer CoA between acetate, propionate and succinate. A mutant lacking both the AK-PTA pathway and the CoA transferase Cat was unable to utilize acetate or propionate even when glucose was present (Table 1). Thus, the AK-PTA pathway and the CoA transferase Cat are the only pathways for activation of acetate and propionate in C. glutamicum. This result is corroborated by the fact that the genome of this bacterium does not harbor a gene homologous to acs or prpE. The single mutant cat did not show an observable phenotype. In C. glutamicum R, a strain known to produce succinate and llactate under oxygen-deprivation conditions, deletion of ldhA, the gene for the fermentative l-lactate dehydrogenase, resulted in production of acetate rather than l-lactate under oxygen-deprivation conditions (Yasuda et al., 2007). Acetate formation by this mutant was not affected by additional deletion of the pta-ack operon or the CoA transferase gene and even a mutant carrying deletions of ldhA, pta-ack and the CoA transferase gene still produced acetate under oxygen-deprivation conditions. As the acetate yield was reduced to about one third in this mutant the AK-PTA pathway and CoA transferase appear to be involved in fermentative acetate formation (Yasuda et al., 2007). In C. glutamicum WT, the activity profile of succinyl-CoA:acetate CoA transferase, which peaked in the early exponential phase during aerobic growth on a acetate–glucose mixture (Fig. 2), indicated that Cat is important during exponential growth. In C. glutamicum WT growing exponentially on glucose minimal medium Cat was identified to be phosphorylated as detected by in vivo radio-labelling using 33 P-phosphoric acid with subsequent autoradiography and by immunostaining with phosphoserine-specific monoclonal antibodies (Bendt et al., 2003), however, it is not known whether phosphorylation affects the activity of Cat. As the single mutant cat showed comparable maximal growth rates as C. glutamicum WT on minimal medium with glucose, acetate, glucose + acetate, ribose, l-lactate or pyruvate or on LB medium, it is currently unknown what role the CoA transferase Cat might have in C. glutamicum besides its function as a backup system for the AK-PTA pathway. Organic acids other than acetate, propionate and succinate may also be physiologically relevant substrates of Cat from C. glutamicum. Proteins sharing more than 75% identical amino acids with Cat from C. glutamicum are encoded in the genomes of other corynebacteria (CE2460 and CE520 in C. efficiens, cu1605 in C.

urealyticum, jk0384 in C. jeikeium and DIP1902 in C. diphtheria), but are absent from the genomes of mycobacteria. M. tuberculosis is likely to encounter glucose and lipids in the lung of an infected patient and the glyoxylate cycle is important for its persistence (Munoz-Elias and McKinney, 2005). While the pta-ack operon is conserved between corynebacteria and mycobacteria, only mycobacteria possess acetyl-CoA synthetase (e.g. Rv3667 from M. tuberculosis). This is due to a deletion in the genomes of corynebacteria as the genes cg0355-cg0356-cg0358-cg0359/cg0360-cg0362 are collinear with Rv3672c-Rv3671c-Rv3670-Rv3669/Rv3661Rv3660c, but the genes Rv3668c-acs (Rv3667)-dppABCD (Rv3666cRv3663c)-Rv3662c are absent from the region between cg0359 and cg0360. Thus, corynebacteria and mycobacteria clearly differ from each other with respect to enzymes for acetate activation. The identification of acetate activation via the CoA transferase Cat is relevant to lysine production by C. glutamicum. Acetate has been described as sole and combined substrate for lysine and glutamate production (Kinoshita and Tanaka, 1972; Paegle and Ruklisha, 2003; Shiio and Miyajima, 1969). The CoA transfer from succinylCoA to acetate catalyzed by Cat in vitro may bypass the succinyl-CoA synthetase reaction in the TCA cycle in vivo with concomitant acetate activation. Therefore, Cat may provide a direct link between acetate activation and TCA cycle flux and, thus, affecting precursor supply for production of glutamate and lysine. Acetate–auxotrophic lysine and valine producer strains have been engineered by inactivation of the pyruvate dehydrogenase complex (Blombach et al., 2008, 2007a, b). These strains produce valine or lysine from glucose in the stationary phase, but require co-utilization of acetate and glucose for growth likely involving CoA transfer catalyzed by Cat. Although the hypothesis has not yet been tested experimentally, Cat might be a candidate to improve amino acid production by these strains. Acknowledgements We thank Hermann Sahm for support. Work in the labs of VFW and BJE was supported by the German Ministry of Science and Education (BMBF) within the GenoMik(-plus) programs through grants 031U213D, 0313105, 0313805I and 0313805G. References Arndt, A., Auchter, M., Ishige, T., Wendisch, V.F., Eikmanns, B.J., 2008. Ethanol catabolism in Corynebacterium glutamicum. J. Mol. Microbiol. Biotechnol. 15, 222–233, http://dx.doi.org/10.1159/000107370. Arndt, A., Eikmanns, B.J., 2007. The alcohol dehydrogenase gene adhA in Corynebacterium glutamicum is subject to carbon catabolite repression. J. Bacteriol. 189, 7408–7416. Arndt, A., Eikmanns, B.J., 2008. Regulation of carbon metabolism in Corynebacterium glutamicum. In: Burkovski, A. (Ed.), Corynebacteria: Genomics and Molecular Biology. Caister Academic Press, Wymondham, UK, pp. 155–182. Bendt, A.K., Burkovski, A., Schaffer, S., Bott, M., Farwick, M., Hermann, T., 2003. Towards a phosphoproteome map of Corynebacterium glutamicum. Proteomics 3, 1637–1646. Blombach, B., Schreiner, M.E., Bartek, T., Oldiges, M., Eikmanns, B.J., 2008. Corynebacterium glutamicum tailored for high-yield l-valine production. Appl. Microbiol. Biotechnol. 79, 471–479. Blombach, B., Schreiner, M.E., Holatko, J., Bartek, T., Oldiges, M., Eikmanns, B.J., 2007a. l-valine production with pyruvate dehydrogenase complex-deficient Corynebacterium glutamicum. Appl. Environ. Microbiol. 73, 2079–2084. Blombach, B., Schreiner, M.E., Moch, M., Oldiges, M., Eikmanns, B.J., 2007b. Effect of pyruvate dehydrogenase complex deficiency on l-lysine production with Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 76, 615–623. Bock, A.K., Glasemacher, J., Schmidt, R., Schönheit, P., 1999. Purification and characterization of two extremely thermostable enzymes, phosphate acetyltransferase and acetate kinase, from the hyperthermophilic eubacterium Thermotoga maritima. J. Bacteriol. 181, 1861–1867. Claes, W.A., Pühler, A., Kalinowski, J., 2002. Identification of two prpDBC gene clusters in Corynebacterium glutamicum and their involvement in propionate degradation via the 2-methylcitrate cycle. J. Bacteriol. 184, 2728–2739. Cremer, J., Eggeling, L., Sahm, H., 1990. Cloning of the dapA dapB cluster of the lysine-secreting bacterium Corynebacterium glutamicum. Mol. Gen. Genet. 220, 478–480.

A. Veit et al. / Journal of Biotechnology 140 (2009) 75–83 Dominguez, H., et al., 1993. Modified carbon flux during oxygen limited growth of Corynebacterium glutamicum and the consequences for amino acid overproduction. Biotechnol. Lett. 15, 449–454. Dominguez, H., Rollin, C., Guyonvarch, A., Guerquin-Kern, J.L., Cocaign-Bousquet, M., Lindley, N.D., 1998. Carbon-flux distribution in the central metabolic pathways of Corynebacterium glutamicum during growth on fructose. Eur. J. Biochem. 254, 96–102. Ebbighausen, H., Weil, B., Krämer, R., 1991. Carrier-mediated acetate uptake in Corynebacterium glutamicum. Arch. Microbiol. 155, 505–510. Eikmanns, B.J., Metzger, M., Reinscheid, D., Kircher, M., Sahm, H., 1991. Amplification of three threonine biosynthesis genes in Corynebacterium glutamicum and its influence on carbon flux in different strains. Appl. Microbiol. Biotechnol. 34, 617–622. Fukaya, M., Takemura, H., Okumura, H., Kawamura, Y., Horinouchi, S., Beppu, T., 1990. Cloning of genes responsible for acetic acid resistance in Acetobacter aceti. J. Bacteriol. 172, 2096–2104. Gerstmeir, R., Wendisch, V.F., Schnicke, S., Ruan, H., Farwick, M., Reinscheid, D., Eikmanns, B.J., 2003. Acetate metabolism and its regulation in Corynebacterium glutamicum. J. Biotechnol. 104, 99–122. Gornall, A.G., Bardawill, C.J., David, M.M., 1949. Determination of serum proteins by means of biuret reaction. J. Biol. Chem. 177, 751–766. Haller, T., Buckel, T., Retey, J., Gerlt, J.A., 2000. Discovering new enzymes and metabolic pathways: conversion of succinate to propionate by Escherichia coli. Biochemistry 39, 4622–4629. Horswill, A.R., Escalante-Semerena, J.C., 1999. The prpE gene of Salmonella typhimurium LT2 encodes propionyl-CoA synthetase. Microbiology 145, 1381–1388. Ishige, T., Krause, M., Bott, M., Wendisch, V.F., Sahm, H., 2003. The phosphate starvation stimulon of Corynebacterium glutamicum determined by DNA microarray analyses. J. Bacteriol. 185, 4519–4529. Jakoby, M., Ngouto-Nkili, C.E., Burkovski, A., 1999. Construction and application of new Corynebacterium glutamicum vectors. Biotechnol. Tech. 13, 437–441. Jolkver, E., Emer, D., Ballan, S., Krämer, R., Eikmanns, B.J., Marin K. 2008. Identification and Characterization of a Bacterial Transport System for the Uptake of Pyruvate, Propionate, and Acetate in Corynebacterium glutamicum. J. Bacteriol. Nov 21. [Epub ahead of print]. Kalinowski, J., Bathe, B., Bartels, D., Bischoff, N., Bott, M., Burkovski, A., Dusch, N., Eggeling, L., Eikmanns, B.J., Gaigalat, L., et al., 2003. The complete Corynebacterium glutamicum ATCC 13032 genome sequence and its impact on the production of l-aspartate-derived amino acids and vitamins. J. Biotechnol. 104, 5–25. Kinoshita, S., Tanaka, K., 1972. Glutamic acid. In: Yamada, K., Kinoshita, S., Tsunoda, T., Aida, K. (Eds.), The microbial production of amino acids. Halsted Press, New York, NY, USA, pp. 263–324. Krämer, R., Lambert, C., 1990. Uptake of glutamate in Corynebacterium glutamicum. 2. Evidence for a primary active transport system. Eur. J. Biochem. 194, 937–944. Lange, C., Rittmann, D., Wendisch, V.F., Bott, M., Sahm, H., 2003. Global expression profiling and physiological characterization of Corynebacterium glutamicum grown in the presence of l-valine. Appl. Environ. Microbiol. 69, 2521–2532. Lin, E.C.C., 1996. Dissimilatory pathways for sugars, polyols and carboxylates. In: Neidhardt, F.C., Curtiss III, R., Ingraham, J.L., Lin, E.C.C., Low, K.B., Magasanik, B., Reznikoff, W.S., Riley, M., Schaechter, M., Umbarger, H.E. (Eds.), Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd ed. ASM Press, Washington, DC, pp. 307–342. Marx, A., de Graaf, A.A., Wiechert, W., Eggeling, L., Sahm, H., 1996. Determination of the fluxes in the central metabolism of Corynebacterium glutamicum by nuclear magnetic resonance spetroscopy combined with metabolite balancing. Biotechnol. Bioeng. 49, 111–129. Merkens, H., Beckers, G., Wirtz, A., Burkovski, A., 2005. Vanillate metabolism in Corynebacterium glutamicum. Curr. Microbiol. 51, 59–65. Munoz-Elias, E.J., McKinney, J.D., 2005. Mycobacterium tuberculosis isocitrate lyases 1 and 2 are jointly required for in vivo growth and virulence. Nat. Med. 1, 638–644. Netzer, R., Peters-Wendisch, P., Eggeling, L., Sahm, H., 2004. Cometabolism of a nongrowth substrate: l-serine utilization by Corynebacterium glutamicum. Appl. Environ. Microbiol. 70, 7148–7155. Paegle, L., Ruklisha, M., 2003. Lysine synthesis control in Corynebacterium glutamicum RC 115 in mixed substrate (glucose–acetate) medium. J. Biotechnol. 104, 123–128. Palacios, S., Starai, V.J., Escalante-Semerena, J.C., 2003. Propionyl coenzyme A Is a common intermediate in the 1,2-propanediol and propionate catabolic pathways needed for expression of the prpBCDE operon during growth of Salmonella enterica on 1,2-propanediol. J. Bacteriol. 185, 2802–2810. Peters-Wendisch, P.G., Eikmanns, B.J., Thierbach, G., Bachmann, B., Sahm, H., 1993. Phosphoenolpyruvate carboxylase in Corynebacterium glutamicum is dispensable for growth and lysine production. FEMS Microbiol. Lett. 112, 269–274. Polen, T., Wendisch, V.F., 2004. Genomewide expression analysis in amino acidproducing bacteria using DNA microarrays. Appl. Biochem. Biotechnol. 118, 215–232. Rado, T.A., Hoch, J.A., 1973. Phosphotransacetylase from Bacillus subtilis: purification and physiological studies. Biochim. Biophys. Acta 321, 114–125.

83

Reinscheid, D.J., Eikmanns, B.J., Sahm, H., 1994a. Characterization of the isocitrate lyase gene from Corynebacterium glutamicum and biochemical analysis of the enzyme. J. Bacteriol. 176, 3474–3483. Reinscheid, D.J., Eikmanns, B.J., Sahm, H., 1994b. Malate synthase from Corynebacterium glutamicum: sequence analysis of the gene and biochemical characterization of the enzyme. Microbiology 140, 3099–3108. Reinscheid, D.J., Schnicke, S., Rittmann, D., Zahnow, U., Sahm, H., Eikmanns, B.J., 1999. Cloning, sequence analysis, expression and inactivation of the Corynebacterium glutamicum pta-ack operon encoding phosphotransacetylase and acetate kinase. Microbiology 145, 503–513. Riedel, C., Rittmann, D., Dangel, P., Möckel, B., Petersen, S., Sahm, H., Eikmanns, B.J., 2001. Characterization of the phosphoenolpyruvate carboxykinase gene from Corynebacterium glutamicum and significance of the enzyme for growth and amino acid production. J. Mol. Microbiol. Biotechnol. 3, 573–583. Rittmann, D., Schaffer, S., Wendisch, V.F., Sahm, H., 2003. Fructose-1,6bisphosphatase from Corynebacterium glutamicum: expression and deletion of the fbp gene and biochemical characterization of the enzyme. Arch. Microbiol. 180, 285–292. Sambrook, J., Russell, D., 2001. Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratoy Press, Cold Spring Harbor, NY. Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G., Pühler, A., 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69–73. Schaffer, S., Weil, B., Nguyen, V.D., Dongmann, G., Gunther, K., Nickolaus, M., Hermann, T., Bott, M., 2001. A high-resolution reference map for cytoplasmic and membrane-associated proteins of Corynebacterium glutamicum. Electrophoresis 22, 4404–4422. Scherf, U., Buckel, W., 1991. Purification and properties of 4-hydroxybutyrate coenzyme A transferase from Clostridium aminobutyricum. Appl. Environ. Microbiol. 57, 2699–2702. Schreiner, M.E., Eikmanns, B.J., 2005. Pyruvate:quinone oxidoreductase from Corynebacterium glutamicum: purification and biochemical characterization. J. Bacteriol. 187, 862–871. Shiio, I., Miyajima, R., 1969. Concerted inhibition and its reversal by end products of aspartate kinase in Brevibacterium flavum. J. Biochem. (Tokyo) 65, 849–859. Shimizu, H., Hirasawa, T., 2007. Production of Glutamate and Glutamate-Related Amino Acids: MolecularMechanism Analysis and Metabolic Engineering. In: Wendisch, V.F. (Ed.), Amino Acid Biosynthesis–Pathways, Regulation and Metabolic Engineering. Springer, Heidelberg, Germany, 10.1007/7171 2006 064. Sohling, B., Gottschalk, G., 1996. Molecular analysis of the anaerobic succinate degradation pathway in Clostridium kluyveri. J. Bacteriol. 178, 871–880. Sonntag, K., Eggeling, L., De Graaf, A.A., Sahm, H., 1993. Flux partitioning in the split pathway of lysine synthesis in Corynebacterium glutamicum. Quantification by 13C- and 1H-NMR spectroscopy. Eur. J. Biochem. 213, 1325–1331. Stadtman, E.R., 1955. Phosphotransacetylase from Clostridium kluyveri. In: Colowick, S.P., Kaplan, N.O. (Eds.), Methods in Enzymology, vol 1. Academic Press, New York, pp. pp.596–599. Tabuchi, T., Serizawa, N., Ohmono, S., 1974. Isolation and identification of (−)methylcitric acid and 2-methyl-cis-aconitic acid from the culture of Candida lipolytica. Agric. Biol. Chem. 38, 2565–2566. Textor, S., Wendisch, V.F., De Graaf, A.A., Müller, U., Linder, M.I., Linder, D., Buckel, W., 1997. Propionate oxidation in Escherichia coli: evidence for operation of a methylcitrate cycle in bacteria. Arch. Microbiol. 168, 428–436. Wendisch, V.F., 2003. Genome-wide expression analysis in Corynebacterium glutamicum using DNA microarrays. J. Biotechnol. 104, 273–285. Wendisch, V.F., 2006. Genetic regulation of Corynebacterium glutamicum metabolism. J. Microbiol. Biotechnol. 16, 999. Wendisch, V.F., de Graaf, A.A., Sahm, H., 1997a. Accurate determination of 13 C enrichments in nonprotonated carbon atoms of isotopically enriched amino acids by 1 H nuclear magnetic resonance. Anal. Biochem. 245, 196–202. Wendisch, V.F., de Graaf, A.A., Sahm, H., Eikmanns, B.J., 2000. Quantitative determination of metabolic fluxes during coutilization of two carbon sources: comparative analyses with Corynebacterium glutamicum during growth on acetate and/or glucose. J. Bacteriol. 182, 3088–3096. Wendisch, V.F., Spies, M., Reinscheid, D.J., Schnicke, S., Sahm, H., Eikmanns, B.J., 1997b. Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes. Arch. Microbiol. 168, 262–269. Wiechert, W., de Graaf, A.A., 1997. Bidirectional reaction steps in metabolic networks: I. modeling and simulation of carbon isotope labeling experiments. Biotechnol. Bioeng. 55, 101–111. Wiechert, W., Siefke, C., de Graaf, A.A., Marx, A., 1997. Bidirectional reaction steps in metabolic networks: II. flux estimation and staistical analysis. Biotechnol. Bioeng. 55, 118–135. Wittmann, C., Becker, J., 2007. The l-Lysine Story: From Metabolic Pathways to Industrial Production. In: Wendisch, V.F. (Ed.), Amino Acid Biosynthesis–Pathways, Regulation and Metabolic Engineering. Springer, Heidelberg, Germany, 10.1007/7171 2006 089. Yasuda, K., Jojima, T., Suda, M., Okino, S., Inui, M., Yukawa, H., 2007. Analyses of the acetate-producing pathways in Corynebacterium glutamicum under oxygendeprived conditions. Appl. Microbiol. Biotechnol. 77, 853–860.