- Email: [email protected]
Photo-crosslinkable, bone marrow-derived mesenchymal stem cells-encapsulating hydrogel based on collagen for osteogenic differentiation
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
Contents lists available at ScienceDirect
Colloids and Surfaces B: Biointerfaces journal homepage: www.elsevier.com/locate/colsurfb
Photo-crosslinkable, bone marrow-derived mesenchymal stem cellsencapsulating hydrogel based on collagen for osteogenic differentiation ⁎⁎
Tingting Zhanga,c, Hong Chenc, Yajie Zhanga,d, Yue Zanc, Tianyu Nia, Min Liub, , Renjun Peia,d,
T ⁎
a
CAS Key Laboratory for Nano-Bio Interface, Division of Nanobiomedicine, Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Suzhou, 215123, China b Institute for Interdisciplinary Research, Jianghan University, Wuhan, 430056, China c School of Pharmacy, Xi’an Jiaotong University, Xi’an, 710061, China d School of Nano Technology and Nano Bionics, University of Science and Technology of China, Hefei, 230026, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Photochemical cross-linking BMSCs-encapsulating hydrogel Collagen Osteogenic differentiation
Many patients suffer from bone injury and self-regeneration is not effective. Developing new strategies for effective bone injury repair is highly desired. Herein, collagen, an important component of the extracellular matrix, was modified with glycidyl methacrylate. The water solubility and photochemical cross-linking ability of the resulting collagen derivative was then improved. Thereafter, BMSC-laden hydrogel was fabricated using collagen modified with glycidyl methacrylate and hyaluronic acid modified with methacrylic anhydride under UV light in the presence of I 2959. The physicochemical properties were characterized suggesting that the hydrogel had great potential for enhancing cell adhesion and proliferation. Furthermore, without adding the bone morphogenetic protein-2, the collagen also promoted osteogenic differentiation of BMSCs within the hydrogel. Altogether, this hydrogel system provides a general strategy to fabricate cell-encapsulating hydrogel based on collagen and could be used as 3D scaffold for bone injury repair.
1. Introduction Stem cell regenerative medicine is a relatively new field of biomedicine and is of great value in clinical applications. It aims to promote the repair and treatment of diseases through stem cell transplantation, differentiation, and tissue regeneration, which will change traditional treatments for diseases and bring revolutionary changes to both research and clinical applications [1–3]. Typical two-dimensional (2D) cell culture systems are not able to mimic fully the in vivo microenvironment that naturally modulates stem cell behavior, whereas three-dimensional (3D) scaffolds could mimic the in vivo environment that interacts with the cells directly and maintains a dynamic regulatory system for tissue morphogenesis [4,5]. An ideal tissue-engineering scaffold is the most important factor in tissue engineering, especially in regenerative medicine. Many research efforts have already been directed towards developing natural materials for fabricating various cell-laden 3D scaffolds, such as chitosan [6], hyaluronic acid [7,8], alginate [9,10], silk protein [11], and collagen [12,13], which are the most common materials for
fabricating scaffolds. Among these biomaterials, collagen is the major component of the extracellular matrix and is widely studied in the biomedical field [14–16]. Due to the interaction of RGD (ArginineGlycine-Aspartic) sequences contained in its structure with stem cells, the 3D collagen scaffold can increase adhesion, proliferation, and differentiation of stem cells [16]. Meanwhile, the degraded components of the collagen scaffold can be reused by cells during new tissue formation [17]. For example, O'Brien et al. prepared a nanohydroxyapatite/collagen scaffold using a freeze-drying method and showed enhanced osteogenic potential both in vitro and in vivo [18]. Mahapatra et al. developed an alginate-chitosan-collagen scaffold for applications in bone tissue engineering [19]. These results demonstrate that collagen performs very well as a 3D scaffold. However, such collagen-based scaffolds were prepared through a freeze-drying process and cells were seeded into the porous 3D structure to form tissue-engineered constructs since collagen is insoluble in water, which greatly inhibits its application. Current strategies for tissue regeneration focus on biocompatibility and implantable scaffolds that could mimic natural tissues. Hydrogels
⁎
Corresponding author at: CAS Key Laboratory for Nano-Bio Interface, Division of Nanobiomedicine, Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Suzhou, 215123, China. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (M. Liu), [email protected] (R. Pei). https://doi.org/10.1016/j.colsurfb.2018.11.050 Received 11 June 2018; Received in revised form 15 November 2018; Accepted 20 November 2018 Available online 22 November 2018 0927-7765/ © 2018 Elsevier B.V. All rights reserved.
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
while the pH of the solution was maintained around 8 with NaOH (5 mol/L), and stirred at 4 °C overnight. Then, the mixture was precipitated in ethanol to remove the unreacted methacrylic anhydride. The final product (HA-MA) was obtained by centrifugation at 8000 rpm for 10 min and lyophilization. 1H NMR (D2O): δ 6.5-5.5 (2H, vinyl group), 4.8-4.2 (m, 2H, CH2OH), 4.0-3.0 (m, 10H, H of glucose ring), 2.0-1.80 (m, 6H, CH3).
and other scaffolds with an aqueous 3D environment are a great prospect for fabricating 3D tissue constructs through encapsulating living BMSCs into appropriate matrix materials [20–26]. Cell-encapsulating hydrogels are different from the conventional cell-laden 3D scaffolds or hydrogels since BMSCs-encapsulating hydrogels are fabricated in a single step. Therefore, the materials used to fabricate hydrogels must possess excellent biocompatibility since the cells will be suspended in the hydrogel precursor solution before gelation. Therefore, cell-encapsulating hydrogels have many more advantages compared to conventional hydrogels including the ability to be injected and better control over the cellular distribution [27]. There is an urgent need to develop water-soluble collagens suitable for constructing cell-encapsulating hydrogels. In this work, we fabricated a photochemically cross-linked BMSCencapsulating hydrogel based on collagen. The mechanical properties of the prepared hydrogel and the proliferation ability of BMSC within the hydrogel were then assessed. Furthermore, the osteogenic differentiation of BMSCs within the hydrogel was also investigated in the absence of bone morphogenetic protein 2 (BMP-2). This hydrogel system provides a general strategy for fabricating cell-encapsulating hydrogels based on collagen that could be used as 3D scaffold for bone injury repair.
2.3. Preparation of Col/HA and HA hydrogels HA-MA (40 mg) was dissolved in 1 mL PBS containing the I 2959 photo initiator (0.5% w/v). Next, Col-GMA (3 mg) was dissolved in the same solution. The Col/HA hydrogel was formed via UV cross-linking (365 nm, 7 mW/cm2, 5 min). BMSCs (3 × 106 cells/mL) were mixed with the solution before UV crosslinking to obtain the BMSCs-encapsulating hydrogel. HA hydrogel was prepared as mentioned above but without addition of Col-GMA. The hydrogels obtained were subsequently used for further experiments. 2.4. Proliferation of BMSCs within hydrogels The BMSCs-encapsulating hydrogels were cultured in complete DMEM while the medium was replaced every 3 days. Then, the hydrogels were taken out and transferred into a new 24-well plate at given time points. The absorbance at 450 nm was measured with a microplate reader. Furthermore, a Live/Dead staining assay was used to detect the viability of BMSCs within the hydrogels at different time points. All images were directly acquired using confocal laser scanning microscopy.
2. Materials and methods 2.1. Materials and instruments Hyaluronic acid (74 kDa) was purchased from Bloomage Freda Biopharm Co., Ltd. Methacrylic anhydride, glycidyl methacrylate, and L-ascorbic acid were purchased from Sigma. 2-hydroxy-4′-(2-hydroxyethoxy)-2-methylpropiophenone (I 2959) was purchased from BASF. Dulbecco’s Modified Eagle Medium, fetal bovine serum, and TrypLE™ express enzyme were purchased from Gibco. TRIzol and PrimeScript™RT Reagent Kit were purchased from Takara. WST-1, alkaline phosphatase assay kit, Alizarin red S and BCIP/NBT Alkaline Phosphatase Color Development Kit were purchased from Beyotime Biotechnology. Live/Dead Viability/Cytotoxicity kits and PicoGreen dsDNA Assay kits were purchased from Invitrogen. Rabbit polyclonal antibodies including Osteopontin, Bone Sialoprotein, and Osterix were obtained from Absin Bioscience, Inc. The primers for runt-related transcription factor 2 (Runx2), ALP, type I collagen (Col-I), and osteocalcin (OC) genes were purchased from Sangon Biotech (Shanghai) Co., Ltd. BMSCs were isolated according to the previous literature and passage 4–6 was used in all experiments [28]. Rat type I collagen was obtained in our lab. All other reagents were obtained from domestic suppliers and used as received. 1 H NMR spectra were recorded using a Varian NMR spectrometer at 400 MHz. WST assay was measured on BiotekCytation 3. The morphology of the hydrogel was observed using a scanning electron microscope (SEM, Quanta FEG 250). The cellular images were obtained with confocal laser scanning microscopy (CLSM, Nikon A1). The storage modulus (G') and loss modulus (G″) of hydrogels were measured using a Haake rotational rheometer (RS6000). RT-PCR was performed on an ABI-7500 real-time PCR cycler using a SYBR Green Ⅱ PCR Kit.
2.5. BMSCs osteogenic differentiation within hydrogels The BMSCs-encapsulating hydrogels were maintained in 2 mL osteoinductive medium containing 0.05 mM L-ascorbic acid, 10 mM βsodium glycerol phosphate, and 100 nM dexamethasone sodium phosphate. The medium was replaced every 2 days. The hydrogels were then taken out at given time points for further experiments. After taking them out from the culture medium, the hydrogels were rinsed with PBS three times. Next, the mRNA expression levels of osteogenesis related gene, including Runx2, ALP, Col-I and OC, were assessed at 1 and 2 weeks using RT-PCR. Total cellular RNA extraction from BMSCs-encapsulating hydrogels was performed via the TRIzol Plus RNA purification reagent according to manufacturer’s instruction at each time point, and BMSCs in 6-well plates were used as control. The purity of the RNA was assessed using absorbance at 260 and 280 nm. Then, 500 ng of the RNA was reverse transcribed into cDNA using the PrimeScript™ RT Reagent Kit for RT-PCR. RT-PCR was performed on an ABI-7500 real-time PCR cycler using a SYBR Green Ⅱ PCR Kit. The PCR cycling parameters consisted of an initial denaturation at 95 °C for 30 s, followed by 45 cycles at 95 °C for 10 s and 60 °C for 30 s. Data collection was performed during the elongation step at 60 °C in each cycle. The relative expressions for the target genes were normalized to that of the reference F-actin gene, and the primers for the RT-PCR are listed in Table 1. Alkaline phosphatase (ALP) is a glycoprotein located on the cell surface and is the major marker for osteogenic differentiation in the early stages. We therefore first measured ALP expression. After osteogenic induction for 1 and 2 weeks, the ALP activity of the BMSCs within the hydrogel was evaluated with an ALP assay kit according to the manufacturer’s protocol, while the total DNA content was determined by the PicoGreen dsDNA assay kit. The ALP level was normalized to the total DNA content. Meanwhile, osteocalcin (OC) also plays an important role during regulation of the bone calcium metabolism. It is a new biochemical marker for bone metabolism. After osteogenic induction for 1 and 2 weeks, OC activity for the BMSCs in the hydrogel was measured using an ELISA kit. Meanwhile, to further evaluate the
2.2. Synthesis of Col-GMA and HA-MA Collagen (300 mg) was stirred in a 1% acetic acid solution (60 mL) at room temperature until a clear solution was obtained. Then, triethylamine (1.5 mL) and tween-20 (545 μL) were added into the solution, followed by a dropwise addition of glycidyl methacrylate (1 mL). After overnight stirring, the mixture was precipitated in excess ethanol. The final product (Col-GMA) was obtained by centrifugation at 12,000 rpm for 5 min and lyophilization. Hyaluronic acid (1 g) was dissolved in deionized water (100 mL). Methacrylic anhydride (7.4 mL) was added dropwise into the solution 529
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
polyclonal antibodies as well as a β-actin mouse monoclonal antibody at 4 °C overnight, followed by the incubation with secondary antibodies conjugated with horseradish peroxidase. Protein expression levels were determined using a luminescent image analyzer (LAS4000EPUVmini). Image J software was used for the quantitative analysis of protein expression levels.
Table 1 RT-PCR primers for the Runx2, ALP, Col-I and OC genes. Genes
Primer sequence
F-actin
F-CACCCGCGAGTACAACCTTC R-CCCATACCCACCATCACACC F- TCTTCCCAAAGCCAGAGCG R- TGCCATTCGAGGTGGTCG F- CGTCTCCATGGTGGATTATGCT R- CCCAGGCACAGTGGTCAAG F- CTGCCCAGAAGAATATGTATCACC R- GAAGCAAAGTTTCCTCCAAGACC F- GCCCTGACTGCATTCTGCCTCT R- TCACCACCTTACTGCCCTCCTG
Runx2 ALP Col-I OC
2.6. Statistical analysis All experimental results are reported as mean ± standard deviation for in vitro studies. The statistical data analysis was conducted using the Origin Pro 8.5 software and p < 0.05 was considered statistically significant.
osteogenic differentiation of BMSCs in the Col-HA hydrogel, BMSCs in the Col-HA hydrogel were stained using a BCIP/NBT Alkaline Phosphatase Color Development Kit and alizarin red S according to the manufacturer’s instructions after a 2-week inductive culture. Finally, the expression level of osteogenic differentiation relevant proteins including osteopontin (OPN), bone sialoprotein (BSP), and osterix (OSX) were measured using western blotting. The total protein content was determined using a BCA Kit according to the manufacturer’s protocol. Next, proteins were loaded onto a 12% SDS/PAGE gel. The gel-isolated proteins were then transferred to a PVDF membrane at 100 V for 80 min and incubated with OSX, BSP, and OPN rabbit
3. Results and discussion 3.1. Synthesis and characterization of hydrogels Tissue engineering offers great opportunities to effectively repair damaged tissue, among which a biocompatible scaffold is the most important factor. In this work, we fabricated a photochemically crosslinked hydrogel based on functionalized collagen and hyaluronic acid. Briefly, collagen and hyaluronic acid were modified with glycidyl methacrylate and methacrylic anhydride according to previous work [29,30] (Scheme 1a). Then, the grafting ratios were calculated using 1H
Scheme 1. a. Synthesis route for functionalized collagen and hyaluronic acid. b. Preparation of the BMSCs-encapsulating hydrogel. 530
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
Fig. 1. 1H NMR spectra of HA-MA and Col-GMA.
0.47 for the HA hydrogel, respectively. As time increases, the optical density increased to 1.70 for Col/HA hydrogel and 1.44 for the HA hydrogel. This result suggests that both hydrogel systems offer a good microenvironment for cell survival and proliferation. The optical density for the Col/HA hydrogel is expectedly higher than the HA hydrogel, which illustrates that the addition of collagen could further improve BMSC adhesion and proliferation. The main reason is that collagen contains RGD sequences that interact with the integrin receptor on the BMSCs thereby promoting the adhesion and proliferation of BMSCs [32–34]. Furthermore, Live/Dead staining was carried out to observe the viability of the cells within the hydrogel directly at different time intervals. As shown in Fig. 3c and Fig. S1, the live cells were green fluorescent whereas the dead cells were stained in red. After the first day, many green fluorescent spots were observed in both the Col/HA and HA hydrogels and only a few red fluorescence dots, which illustrates that relatively few BMSCs died during the initial period. However, after 7 days, the number of green fluorescence dots greatly increased for both hydrogels. Meanwhile, the number of green fluorescence dots for the Col/HA hydrogel was expectedly larger than the HA hydrogel, which is in good agreement with the WST assay. Fig. 3b shows the spatial distribution of BMSCs in the 3D view. These results illustrate that the Col/HA hydrogel provides an excellent 3D structure and microenvironment for BMSCs adhesion and proliferation.
NMR spectroscopy. As shown in Fig. 1, the characteristic peaks between 5.5 and 6.5 demonstrates that double bonds were successfully grafted onto the hyaluronic acid backbone after reacting with excess methacrylic anhydride. The grafting ratio was determined to be 100%. For the collagen modification, GMA was at approximately a 75-molar ratio with respect to the collagen lysine. A similar result (Fig. 1) was also observed for the collagen modification, and a characteristic peak between 5.5 and 6.5 was measured. Next, the hydrogel was fabricated by mixing Col-GMA and HA-MA in a 96-well plate, and the final concentration of Col-GMA and HA-MA was about 0.3% (w/v) and 4% (w/v), respectively. This was followed by ultraviolet irradiation (365 nm, 7 mW/cm2) in the presence of I 2959 (0.5% w/v). The HA hydrogel was also prepared for comparison purposes. Pore size is an important parameter for scaffolds for BMSCs proliferation and differentiation, which facilitates cell migration, cell spatial distribution, as well as nutrient and waste exchange. As shown in Fig. 2a, a 3D structure with many pores with a mean size of 250–300 μm is observed for the Col/HA hydrogel and the HA hydrogel. In addition, a hydrogel with the proper pore size benefits osteogenic differentiation of BMSCs [31]. Furthermore, the mechanical strength of the hydrogels was investigated by monitoring the storage modulus (G′) and loss modulus (G″) (Fig. 2b and c). The storage modulus of Col/HA hydrogel was 350 Pa which was a litter higher than for the HA hydrogel (175 Pa).
3.3. Osteogenic differentiation of BMSCs in the hydrogels 3.2. BMSCs proliferation within the hydrogels Several experiments were designed to determine whether the Col/ HA hydrogel could effectively promote osteogenic differentiation of BMSCs compared to the HA hydrogel. First, real-time quantitative PCR (RT-PCR) analysis of osteogenesis-related genes, including Runx2, ALP, OC, and Col-I, was performed at weeks 1 and 2. The expression level in the HA hydrogel was defined as 1, as shown in Fig. 4. All markers
Another important parameter for BMSCs-encapsulating hydrogel is the microenvironment. It should be suitable for cell survival and proliferation. As shown in Fig. 3a, the cell survival ability within the hydrogel was evaluated through the WST method. The optical density of BMSCs within hydrogel was about 0.54 for the Col-HA hydrogel and 531
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
Fig. 2. a. SEM images of the Col/HA and HA hydrogels. Rheological data for the HA (a) and Col/HA (c) hydrogels.
Fig. 3. a. Proliferation of BMSCs within the hydrogels at different time points. n = 3, *p < 0.05, **p < 0.01. b. A 3D view of the viability of BMSCs within the Col/ HA hydrogel at day 7. c. Live/dead staining of BMSCs within the hydrogels at different time points.
showed a relatively low gene expression after the first week, while significant upregulation was observed after the second week. Meanwhile, the gene expression levels of the Col/HA group were
significantly higher than that of the HA group. For the Runx2 group, the gene expression level in Col/HA was about 4 times higher than for HA in the first week. It increased to 12-fold in the second week. Similar 532
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
Fig. 4. Osteogenic-related gene expressions of BMSCs in the Col-HA and the HA groups. a. Runx2, b. ALP, c. OC, d. Col-I. n = 3, *p < 0.05, **p < 0.01, ***p < 0.001.
Alkaline phosphatase (ALP) is an early marker which often presents high expression levels in osteoblasts before it is subsequently depleted [35]. We therefore measured the ALP activity of BMSCs within the hydrogel first. After incubation in the osteogenic inductive medium at different time intervals, the ALP expression was measured using an ALP kit. As shown in Fig. 5a, the value of ALP/DNA is about 3.40 for the Col/HA and the HA hydrogels after 7 days, but increases to about 12.11 for the Col/HA hydrogel and 9.51 for the HA hydrogel after 14 days, which is almost 3.6 times higher. This illustrates that ALP expression is relatively low in the initial week and no difference is observed between the Col/HA hydrogel and the HA hydrogels. However, the ALP expression significantly increased after 14 days and the ALP expression in the Col/HA hydrogel is slightly higher than in the HA hydrogel. Unlike ALP, osteocalcin (OC) is a new marker for osteogenic differentiation and is exclusively produced by mature osteoblast cells [35]. Therefore, osteocalcin plays an important role during the regulation of the bone calcium metabolism. After incubation in the osteogenic inductive medium for different time intervals, OC expression was measured using an ELISA kit. As shown in Fig. 5b, the value of OC/DNA is about 4.26 for the Col/HA hydrogel and 3.70 for the HA hydrogel after 7 days but increases to about 22.51 for the Col/HA hydrogel and 19.72 for the HA hydrogel after 14 days. Additionally, the OC expression in the Col/HA hydrogel is slightly higher than in the HA hydrogel. These results were in good agreement with the mRNA expressions obtained above. Finally, to evaluate further the osteogenic differentiation ability of BMSCs in the hydrogels, the level of proteins relevant to osteogenic differentiation, such as osteopontin (OPN), bone sialoprotein (BSP), and Osterix (OSX), were determined after 2 weeks of osteogenic induction via western blotting. As shown in Fig. 6a, BMSCs in both the Col/HA hydrogel and the HA hydrogel express OPN, bone BSP, OSX proteins, and the expression level in the Col/HA hydrogel group was significantly higher than that in the HA hydrogel group. Image J software was used to provide a semi-quantitative analysis of the gray levels (shown in Fig. 6b). For the OPN group, the protein expression levels in the Col/HA hydrogel group were 1.5 times higher than in the HA hydrogel group, and 2.8 times and 3.8 times higher in the OSX and BSP group,
Fig. 5. a. ALP activity of BMSCs in the Col/HA and HA hydrogels after osteogenic induction incubation for 1 and 2 weeks. b. OC activity of BMSCs in the Col/HA and HA hydrogels after osteogenic induction incubation for 2 weeks. n = 3, *p < 0.05, ***p < 0.001.
results were obtained for the ALP, OC, and Col-I groups. Overall, the gene expression levels of Runx2, ALP, OC, and Col-I in Col/HA group were all higher than that of HA group. 533
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
an osteogenic differentiation pathway, and ERK plays an important role in osteogenic differentiation of MSCs [39–41]. Therefore, the collagen hydrogels take some advantages over the other hydrogels, such as adhesion, proliferation and expression level of osteogenic factors. 4. Conclusions In this study, we fabricated a BMSCs-encapsulating hydrogel based on water-soluble collagen and hyaluronic acid through a photochemical cross-linking method. Additionally, the mechanical properties, the pore size, and cell survival within the hydrogel were investigated and the results suggested that the Col/HA hydrogel offers a more suitable microenvironment for BMSCs adhesion and proliferation. Furthermore, osteogenic differentiation of BMSCs within the Col/HA hydrogel and the HA hydrogel was also investigated in the absence of BMP-2. The results from ALP activity, OC activity, and the expression levels of osteogenic proteins further suggested that the Col/HA hydrogel could promote osteogenic differentiation. This study introduces and validates water-soluble collagens for fabricating BMSCs-encapsulating hydrogel in a single step, which will further improve the usage of collagen in 3D scaffolds. Conflict of interest There are no conflicts to declare. Acknowledgements This work was financially supported by the Strategic Priority Research Program of Chinese Academy of Sciences (XDA16020100), the Key Research Program of Chinese Academy of Sciences (ZDRW-ZS2016-2), the Science and Technology Foundation of Suzhou (SYG201747) and the CAS/SAFEA International Innovation Teams Program. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.colsurfb.2018.11.050. References
Fig. 6. a. Protein expression of BMSCs in Col/HA and HA hydrogels determined by western blotting after osteogenic induction for 2 weeks. b. Semi-quantitative analysis of protein expression levels normalized to beta-actin. n = 3, ***p < 0.001. c. ARS and ALP staining of BMSCs.
[1] W.C. Kenry, K.P. Lee, C.T. Loh, Lim, Biomaterials 155 (2018) 236–250. [2] W.L. Grayson, B.A. Bunnell, E. Martin, T. Frazier, B.P. Hung, J.M. Gimble, Nat. Rev. Endocrinol. 11 (2015) 140–150. [3] G. Cossu, M. Birchall, T. Brown, P. De Coppi, E. Culme-Seymour, S. Gibbon, J. Hitchcock, C. Mason, J. Montgomery, S. Morris, F. Muntoni, D. Napier, N. Owji, A. Prasad, J. Round, P. Saprai, J. Stilgoe, A. Thrasher, J. Wilson, Lancet 391 (2018) 883–910. [4] Z. Liu, M. Tang, J. Zhao, R. Chai, J. Kang, Adv. Mater. 30 (2018) 1–20. [5] G. Rijal, W. Li, Biomaterials 81 (2016) 135–156. [6] Y. Deng, S. Wei, L. Yang, W. Yang, M.S. Dargusch, Z.-G. Chen, Adv. Funct. Mater. 28 (2018) 1–17. [7] H. Knopf-Marques, M. Pravda, L. Wolfova, V. Velebny, P. Schaaf, N.E. Vrana, P. Lavalle, Regenerative medicine and immunomodulation, Adv. Healthc. Mater. 5 (2016) 2841–2855. [8] L. Pescosolido, W. Schuurman, J. Malda, P. Matricardi, F. Alhaique, T. Coviello, P.R. van Weeren, W.J. Dhert, W.E. Hennink, T. Vermonden, Biomacromolecules 12 (2011) 1831–1838. [9] A.G. Tabriz, M.A. Hermida, N.R. Leslie, W. Shu, Biofabrication 7 (2015) 045012. [10] Y. Morimoto, M. Onuki, S. Takeuchi, Adv. Healthc. Mater. 6 (2017) 1–5. [11] K. Schacht, T. Jungst, M. Schweinlin, A. Ewald, J. Groll, T. Scheibel, Angew. Chem. Int. Ed. Engl. 54 (2015) 2816–2820. [12] X. Yuan, Y. Wei, A. Villasante, J.J.D. Ng, D.E. Arkonac, P.G. Chao, G. VunjakNovakovic, Biomaterials 132 (2017) 59–71. [13] D.J. Munoz-Pinto, A.C. Jimenez-Vergara, T.P. Gharat, M.S. Hahn, Biomaterials 40 (2015) 32–42. [14] B.D. Walters, J.P. Stegemann, Acta Biomater. 10 (2014) 1488–1501. [15] W. Yang, L. Li, G. Su, Z. Zhang, Y. Cao, X. Li, Y. Shi, Q. Zhang, Biomater. Sci. 5 (2017) 1766–1776. [16] K.C. Kuo, R.Z. Lin, H.W. Tien, P.Y. Wu, Y.C. Li, J.M. Melero-Martin, Y.C. Chen, Acta Biomater. 27 (2015) 151–166. [17] C.S. Bahney, C.W. Hsu, J.U. Yoo, J.L. West, B. Johnstone, FASEB J. 25 (2011)
respectively. ARS and ALP staining were performed to evaluate the osteogenic differentiation level of BMSCs within the Col/HA hydrogel after 2 weeks of osteogenic incubation to directly observe the osteogenic differentiation of BMSCs in the Col/HA hydrogel. As shown in Fig. 6c, the Col/HA hydrogel was stained in dark blue and red after osteogenic induction for 2 weeks. These results illustrated that the Col/ HA hydrogel could effectively promote osteogenic differentiation of BMSCs. There are several possible reasons for the high expression level of osteogenic factors in the Col/HA hydrogel. On the one hand, collagen scaffold contains specific cell binding sites, particularly the RGD sequences, and the interaction between RGD and integrin receptors on the BMSC surface will stabilize the cytoskeleton onto the surface of the scaffold, avoid mechanical detachment, and promote BMSCs adhesion and proliferation within the hydrogels [34,36–38]. On the other hand, the previous work demonstrated that type I collagen induced independently the expression of the osteogenic differentiation markers ALP and OPN via FAK and ERK signaling pathways, respectively [32]. Similar results were also obtained by Plopper group, and their experimental results demonstrated that type I collagen could drive MSCs into
534
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
[29] L. Bian, M. Guvendiren, R.L. Mauck, J.A. Burdick, Proc. Natl. Acad. Sci. 110 (2013) 10117–10122. [30] K.A. Smeds, A. Pfister-Serres, D. Miki, K. Dastgheib, M. Inoue, D.L. Hatchell, M.W. Grinstaff, J. Biomed. Mater. Res. 54 (2001) 115–121. [31] C.A.B. Vissers, J.N. Harvestine, J.K. Leach, J. Mater. Chem. B 3 (2015) 8650–8658. [32] S. Viale-Bouroncle, M. Gosau, C. Morsczeck, Arch. Oral Biol. 59 (2014) 1249–1255. [33] A.K. Kundu, A.J. Putnam, Biochem. Biophys. Res. Commun. 347 (2006) 347–357. [34] W.T. Godbey, A. Atala, Ann. N. Y. Acad. Sci. 961 (2002) 10–26. [35] M.B. Oliveira, C.A. Custodio, L. Gasperini, R.L. Reis, J.F. Mano, Acta Biomater. 41 (2016) 119–132. [36] M. Mizuno, R. Fujisawa, Y. Kuboki, J. Cell. Physiol. 184 (2000) 207–213. [37] M.A. Schwartz, M.H. Ginsberg, Nat. Cell Biol. 4 (2002) E65–E68. [38] S. Gronthos, P.J. Simmons, S.E. Graves, P.G. Robey, Bone 28 (2001) 174–181. [39] R.M. Salasznyk, R.F. Klees, M.K. Hughlock, G.E. Plopper, Cell Commun. Adhes. 11 (2004) 137–153. [40] G. Xiao, R. Gopalakrishnan, D. Jiang, E. Reith, M.D. Benson, R.T. Franceschi, J. Bone Miner. Res. 17 (2002) 101–110. [41] G.S. Stein, J.B. Lian, Endocr. Rev. 14 (1993) 424–442.
1486–1496. [18] G.M. Cunniffe, C.M. Curtin, E.M. Thompson, G.R. Dickson, F.J. O’Brien, ACS Appl. Mater. Interfaces 8 (2016) 23477–23488. [19] K. Kolanthai, P.A. Sindu, D.K. Khajuria, S.C. Veerla, D. Kuppuswamy, L.H. Catalani, D. Roy Mahapatra, ACS Appl. Mater. Interfaces 10 (2018) 12441–12452. [20] S.V. Murphy, A. Atala, Nat. Biotechnol. 32 (2014) 773–785. [21] L. Moroni, J.A. Burdick, C. Highley, S.J. Lee, Y. Morimoto, S. Takeuchi, J.J. Yoo, Nat. Rev. Mater. 3 (2018) 21–37. [22] H.N. Chia, B.M. Wu, J. Biol. Eng. 9 (4) (2015) 1–14. [23] A. Kang, J. Park, J. Ju, G.S. Jeong, S.H. Lee, Biomaterials 35 (2014) 2651–2663. [24] M. Sepantafar, R. Maheronnaghsh, H. Mohammadi, S. Rajabi-Zeleti, N. Annabi, N. Aghdami, H. Baharvand, Biotechnol. Adv. 34 (2016) 362–379. [25] N.E. Fedorovich, J. Alblas, J.R. de Wijn, W.E. Hennink, A.J. Verbout, W.J. Dhert, Tissue Eng. 13 (2007) 1905–1925. [26] H. Wang, S.C. Heilshorn, Adv. Mater. 27 (2015) 3717–3736. [27] V. Crescenzi, L. Cornelio, C. Di Meo, S. Nardecchia, R. Lamanna, Biomacromolecules 8 (2007) 1844–1850. [28] M. Talmor, A. Mirza, S. Turley, I. Mellman, L.A. Hoffman, R.M. Steinman, Eur. J. Immunol. 28 (1998) 811–817.
535
Contents lists available at ScienceDirect
Colloids and Surfaces B: Biointerfaces journal homepage: www.elsevier.com/locate/colsurfb
Photo-crosslinkable, bone marrow-derived mesenchymal stem cellsencapsulating hydrogel based on collagen for osteogenic differentiation ⁎⁎
Tingting Zhanga,c, Hong Chenc, Yajie Zhanga,d, Yue Zanc, Tianyu Nia, Min Liub, , Renjun Peia,d,
T ⁎
a
CAS Key Laboratory for Nano-Bio Interface, Division of Nanobiomedicine, Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Suzhou, 215123, China b Institute for Interdisciplinary Research, Jianghan University, Wuhan, 430056, China c School of Pharmacy, Xi’an Jiaotong University, Xi’an, 710061, China d School of Nano Technology and Nano Bionics, University of Science and Technology of China, Hefei, 230026, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Photochemical cross-linking BMSCs-encapsulating hydrogel Collagen Osteogenic differentiation
Many patients suffer from bone injury and self-regeneration is not effective. Developing new strategies for effective bone injury repair is highly desired. Herein, collagen, an important component of the extracellular matrix, was modified with glycidyl methacrylate. The water solubility and photochemical cross-linking ability of the resulting collagen derivative was then improved. Thereafter, BMSC-laden hydrogel was fabricated using collagen modified with glycidyl methacrylate and hyaluronic acid modified with methacrylic anhydride under UV light in the presence of I 2959. The physicochemical properties were characterized suggesting that the hydrogel had great potential for enhancing cell adhesion and proliferation. Furthermore, without adding the bone morphogenetic protein-2, the collagen also promoted osteogenic differentiation of BMSCs within the hydrogel. Altogether, this hydrogel system provides a general strategy to fabricate cell-encapsulating hydrogel based on collagen and could be used as 3D scaffold for bone injury repair.
1. Introduction Stem cell regenerative medicine is a relatively new field of biomedicine and is of great value in clinical applications. It aims to promote the repair and treatment of diseases through stem cell transplantation, differentiation, and tissue regeneration, which will change traditional treatments for diseases and bring revolutionary changes to both research and clinical applications [1–3]. Typical two-dimensional (2D) cell culture systems are not able to mimic fully the in vivo microenvironment that naturally modulates stem cell behavior, whereas three-dimensional (3D) scaffolds could mimic the in vivo environment that interacts with the cells directly and maintains a dynamic regulatory system for tissue morphogenesis [4,5]. An ideal tissue-engineering scaffold is the most important factor in tissue engineering, especially in regenerative medicine. Many research efforts have already been directed towards developing natural materials for fabricating various cell-laden 3D scaffolds, such as chitosan [6], hyaluronic acid [7,8], alginate [9,10], silk protein [11], and collagen [12,13], which are the most common materials for
fabricating scaffolds. Among these biomaterials, collagen is the major component of the extracellular matrix and is widely studied in the biomedical field [14–16]. Due to the interaction of RGD (ArginineGlycine-Aspartic) sequences contained in its structure with stem cells, the 3D collagen scaffold can increase adhesion, proliferation, and differentiation of stem cells [16]. Meanwhile, the degraded components of the collagen scaffold can be reused by cells during new tissue formation [17]. For example, O'Brien et al. prepared a nanohydroxyapatite/collagen scaffold using a freeze-drying method and showed enhanced osteogenic potential both in vitro and in vivo [18]. Mahapatra et al. developed an alginate-chitosan-collagen scaffold for applications in bone tissue engineering [19]. These results demonstrate that collagen performs very well as a 3D scaffold. However, such collagen-based scaffolds were prepared through a freeze-drying process and cells were seeded into the porous 3D structure to form tissue-engineered constructs since collagen is insoluble in water, which greatly inhibits its application. Current strategies for tissue regeneration focus on biocompatibility and implantable scaffolds that could mimic natural tissues. Hydrogels
⁎
Corresponding author at: CAS Key Laboratory for Nano-Bio Interface, Division of Nanobiomedicine, Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Suzhou, 215123, China. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (M. Liu), [email protected] (R. Pei). https://doi.org/10.1016/j.colsurfb.2018.11.050 Received 11 June 2018; Received in revised form 15 November 2018; Accepted 20 November 2018 Available online 22 November 2018 0927-7765/ © 2018 Elsevier B.V. All rights reserved.
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
while the pH of the solution was maintained around 8 with NaOH (5 mol/L), and stirred at 4 °C overnight. Then, the mixture was precipitated in ethanol to remove the unreacted methacrylic anhydride. The final product (HA-MA) was obtained by centrifugation at 8000 rpm for 10 min and lyophilization. 1H NMR (D2O): δ 6.5-5.5 (2H, vinyl group), 4.8-4.2 (m, 2H, CH2OH), 4.0-3.0 (m, 10H, H of glucose ring), 2.0-1.80 (m, 6H, CH3).
and other scaffolds with an aqueous 3D environment are a great prospect for fabricating 3D tissue constructs through encapsulating living BMSCs into appropriate matrix materials [20–26]. Cell-encapsulating hydrogels are different from the conventional cell-laden 3D scaffolds or hydrogels since BMSCs-encapsulating hydrogels are fabricated in a single step. Therefore, the materials used to fabricate hydrogels must possess excellent biocompatibility since the cells will be suspended in the hydrogel precursor solution before gelation. Therefore, cell-encapsulating hydrogels have many more advantages compared to conventional hydrogels including the ability to be injected and better control over the cellular distribution [27]. There is an urgent need to develop water-soluble collagens suitable for constructing cell-encapsulating hydrogels. In this work, we fabricated a photochemically cross-linked BMSCencapsulating hydrogel based on collagen. The mechanical properties of the prepared hydrogel and the proliferation ability of BMSC within the hydrogel were then assessed. Furthermore, the osteogenic differentiation of BMSCs within the hydrogel was also investigated in the absence of bone morphogenetic protein 2 (BMP-2). This hydrogel system provides a general strategy for fabricating cell-encapsulating hydrogels based on collagen that could be used as 3D scaffold for bone injury repair.
2.3. Preparation of Col/HA and HA hydrogels HA-MA (40 mg) was dissolved in 1 mL PBS containing the I 2959 photo initiator (0.5% w/v). Next, Col-GMA (3 mg) was dissolved in the same solution. The Col/HA hydrogel was formed via UV cross-linking (365 nm, 7 mW/cm2, 5 min). BMSCs (3 × 106 cells/mL) were mixed with the solution before UV crosslinking to obtain the BMSCs-encapsulating hydrogel. HA hydrogel was prepared as mentioned above but without addition of Col-GMA. The hydrogels obtained were subsequently used for further experiments. 2.4. Proliferation of BMSCs within hydrogels The BMSCs-encapsulating hydrogels were cultured in complete DMEM while the medium was replaced every 3 days. Then, the hydrogels were taken out and transferred into a new 24-well plate at given time points. The absorbance at 450 nm was measured with a microplate reader. Furthermore, a Live/Dead staining assay was used to detect the viability of BMSCs within the hydrogels at different time points. All images were directly acquired using confocal laser scanning microscopy.
2. Materials and methods 2.1. Materials and instruments Hyaluronic acid (74 kDa) was purchased from Bloomage Freda Biopharm Co., Ltd. Methacrylic anhydride, glycidyl methacrylate, and L-ascorbic acid were purchased from Sigma. 2-hydroxy-4′-(2-hydroxyethoxy)-2-methylpropiophenone (I 2959) was purchased from BASF. Dulbecco’s Modified Eagle Medium, fetal bovine serum, and TrypLE™ express enzyme were purchased from Gibco. TRIzol and PrimeScript™RT Reagent Kit were purchased from Takara. WST-1, alkaline phosphatase assay kit, Alizarin red S and BCIP/NBT Alkaline Phosphatase Color Development Kit were purchased from Beyotime Biotechnology. Live/Dead Viability/Cytotoxicity kits and PicoGreen dsDNA Assay kits were purchased from Invitrogen. Rabbit polyclonal antibodies including Osteopontin, Bone Sialoprotein, and Osterix were obtained from Absin Bioscience, Inc. The primers for runt-related transcription factor 2 (Runx2), ALP, type I collagen (Col-I), and osteocalcin (OC) genes were purchased from Sangon Biotech (Shanghai) Co., Ltd. BMSCs were isolated according to the previous literature and passage 4–6 was used in all experiments [28]. Rat type I collagen was obtained in our lab. All other reagents were obtained from domestic suppliers and used as received. 1 H NMR spectra were recorded using a Varian NMR spectrometer at 400 MHz. WST assay was measured on BiotekCytation 3. The morphology of the hydrogel was observed using a scanning electron microscope (SEM, Quanta FEG 250). The cellular images were obtained with confocal laser scanning microscopy (CLSM, Nikon A1). The storage modulus (G') and loss modulus (G″) of hydrogels were measured using a Haake rotational rheometer (RS6000). RT-PCR was performed on an ABI-7500 real-time PCR cycler using a SYBR Green Ⅱ PCR Kit.
2.5. BMSCs osteogenic differentiation within hydrogels The BMSCs-encapsulating hydrogels were maintained in 2 mL osteoinductive medium containing 0.05 mM L-ascorbic acid, 10 mM βsodium glycerol phosphate, and 100 nM dexamethasone sodium phosphate. The medium was replaced every 2 days. The hydrogels were then taken out at given time points for further experiments. After taking them out from the culture medium, the hydrogels were rinsed with PBS three times. Next, the mRNA expression levels of osteogenesis related gene, including Runx2, ALP, Col-I and OC, were assessed at 1 and 2 weeks using RT-PCR. Total cellular RNA extraction from BMSCs-encapsulating hydrogels was performed via the TRIzol Plus RNA purification reagent according to manufacturer’s instruction at each time point, and BMSCs in 6-well plates were used as control. The purity of the RNA was assessed using absorbance at 260 and 280 nm. Then, 500 ng of the RNA was reverse transcribed into cDNA using the PrimeScript™ RT Reagent Kit for RT-PCR. RT-PCR was performed on an ABI-7500 real-time PCR cycler using a SYBR Green Ⅱ PCR Kit. The PCR cycling parameters consisted of an initial denaturation at 95 °C for 30 s, followed by 45 cycles at 95 °C for 10 s and 60 °C for 30 s. Data collection was performed during the elongation step at 60 °C in each cycle. The relative expressions for the target genes were normalized to that of the reference F-actin gene, and the primers for the RT-PCR are listed in Table 1. Alkaline phosphatase (ALP) is a glycoprotein located on the cell surface and is the major marker for osteogenic differentiation in the early stages. We therefore first measured ALP expression. After osteogenic induction for 1 and 2 weeks, the ALP activity of the BMSCs within the hydrogel was evaluated with an ALP assay kit according to the manufacturer’s protocol, while the total DNA content was determined by the PicoGreen dsDNA assay kit. The ALP level was normalized to the total DNA content. Meanwhile, osteocalcin (OC) also plays an important role during regulation of the bone calcium metabolism. It is a new biochemical marker for bone metabolism. After osteogenic induction for 1 and 2 weeks, OC activity for the BMSCs in the hydrogel was measured using an ELISA kit. Meanwhile, to further evaluate the
2.2. Synthesis of Col-GMA and HA-MA Collagen (300 mg) was stirred in a 1% acetic acid solution (60 mL) at room temperature until a clear solution was obtained. Then, triethylamine (1.5 mL) and tween-20 (545 μL) were added into the solution, followed by a dropwise addition of glycidyl methacrylate (1 mL). After overnight stirring, the mixture was precipitated in excess ethanol. The final product (Col-GMA) was obtained by centrifugation at 12,000 rpm for 5 min and lyophilization. Hyaluronic acid (1 g) was dissolved in deionized water (100 mL). Methacrylic anhydride (7.4 mL) was added dropwise into the solution 529
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
polyclonal antibodies as well as a β-actin mouse monoclonal antibody at 4 °C overnight, followed by the incubation with secondary antibodies conjugated with horseradish peroxidase. Protein expression levels were determined using a luminescent image analyzer (LAS4000EPUVmini). Image J software was used for the quantitative analysis of protein expression levels.
Table 1 RT-PCR primers for the Runx2, ALP, Col-I and OC genes. Genes
Primer sequence
F-actin
F-CACCCGCGAGTACAACCTTC R-CCCATACCCACCATCACACC F- TCTTCCCAAAGCCAGAGCG R- TGCCATTCGAGGTGGTCG F- CGTCTCCATGGTGGATTATGCT R- CCCAGGCACAGTGGTCAAG F- CTGCCCAGAAGAATATGTATCACC R- GAAGCAAAGTTTCCTCCAAGACC F- GCCCTGACTGCATTCTGCCTCT R- TCACCACCTTACTGCCCTCCTG
Runx2 ALP Col-I OC
2.6. Statistical analysis All experimental results are reported as mean ± standard deviation for in vitro studies. The statistical data analysis was conducted using the Origin Pro 8.5 software and p < 0.05 was considered statistically significant.
osteogenic differentiation of BMSCs in the Col-HA hydrogel, BMSCs in the Col-HA hydrogel were stained using a BCIP/NBT Alkaline Phosphatase Color Development Kit and alizarin red S according to the manufacturer’s instructions after a 2-week inductive culture. Finally, the expression level of osteogenic differentiation relevant proteins including osteopontin (OPN), bone sialoprotein (BSP), and osterix (OSX) were measured using western blotting. The total protein content was determined using a BCA Kit according to the manufacturer’s protocol. Next, proteins were loaded onto a 12% SDS/PAGE gel. The gel-isolated proteins were then transferred to a PVDF membrane at 100 V for 80 min and incubated with OSX, BSP, and OPN rabbit
3. Results and discussion 3.1. Synthesis and characterization of hydrogels Tissue engineering offers great opportunities to effectively repair damaged tissue, among which a biocompatible scaffold is the most important factor. In this work, we fabricated a photochemically crosslinked hydrogel based on functionalized collagen and hyaluronic acid. Briefly, collagen and hyaluronic acid were modified with glycidyl methacrylate and methacrylic anhydride according to previous work [29,30] (Scheme 1a). Then, the grafting ratios were calculated using 1H
Scheme 1. a. Synthesis route for functionalized collagen and hyaluronic acid. b. Preparation of the BMSCs-encapsulating hydrogel. 530
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
Fig. 1. 1H NMR spectra of HA-MA and Col-GMA.
0.47 for the HA hydrogel, respectively. As time increases, the optical density increased to 1.70 for Col/HA hydrogel and 1.44 for the HA hydrogel. This result suggests that both hydrogel systems offer a good microenvironment for cell survival and proliferation. The optical density for the Col/HA hydrogel is expectedly higher than the HA hydrogel, which illustrates that the addition of collagen could further improve BMSC adhesion and proliferation. The main reason is that collagen contains RGD sequences that interact with the integrin receptor on the BMSCs thereby promoting the adhesion and proliferation of BMSCs [32–34]. Furthermore, Live/Dead staining was carried out to observe the viability of the cells within the hydrogel directly at different time intervals. As shown in Fig. 3c and Fig. S1, the live cells were green fluorescent whereas the dead cells were stained in red. After the first day, many green fluorescent spots were observed in both the Col/HA and HA hydrogels and only a few red fluorescence dots, which illustrates that relatively few BMSCs died during the initial period. However, after 7 days, the number of green fluorescence dots greatly increased for both hydrogels. Meanwhile, the number of green fluorescence dots for the Col/HA hydrogel was expectedly larger than the HA hydrogel, which is in good agreement with the WST assay. Fig. 3b shows the spatial distribution of BMSCs in the 3D view. These results illustrate that the Col/HA hydrogel provides an excellent 3D structure and microenvironment for BMSCs adhesion and proliferation.
NMR spectroscopy. As shown in Fig. 1, the characteristic peaks between 5.5 and 6.5 demonstrates that double bonds were successfully grafted onto the hyaluronic acid backbone after reacting with excess methacrylic anhydride. The grafting ratio was determined to be 100%. For the collagen modification, GMA was at approximately a 75-molar ratio with respect to the collagen lysine. A similar result (Fig. 1) was also observed for the collagen modification, and a characteristic peak between 5.5 and 6.5 was measured. Next, the hydrogel was fabricated by mixing Col-GMA and HA-MA in a 96-well plate, and the final concentration of Col-GMA and HA-MA was about 0.3% (w/v) and 4% (w/v), respectively. This was followed by ultraviolet irradiation (365 nm, 7 mW/cm2) in the presence of I 2959 (0.5% w/v). The HA hydrogel was also prepared for comparison purposes. Pore size is an important parameter for scaffolds for BMSCs proliferation and differentiation, which facilitates cell migration, cell spatial distribution, as well as nutrient and waste exchange. As shown in Fig. 2a, a 3D structure with many pores with a mean size of 250–300 μm is observed for the Col/HA hydrogel and the HA hydrogel. In addition, a hydrogel with the proper pore size benefits osteogenic differentiation of BMSCs [31]. Furthermore, the mechanical strength of the hydrogels was investigated by monitoring the storage modulus (G′) and loss modulus (G″) (Fig. 2b and c). The storage modulus of Col/HA hydrogel was 350 Pa which was a litter higher than for the HA hydrogel (175 Pa).
3.3. Osteogenic differentiation of BMSCs in the hydrogels 3.2. BMSCs proliferation within the hydrogels Several experiments were designed to determine whether the Col/ HA hydrogel could effectively promote osteogenic differentiation of BMSCs compared to the HA hydrogel. First, real-time quantitative PCR (RT-PCR) analysis of osteogenesis-related genes, including Runx2, ALP, OC, and Col-I, was performed at weeks 1 and 2. The expression level in the HA hydrogel was defined as 1, as shown in Fig. 4. All markers
Another important parameter for BMSCs-encapsulating hydrogel is the microenvironment. It should be suitable for cell survival and proliferation. As shown in Fig. 3a, the cell survival ability within the hydrogel was evaluated through the WST method. The optical density of BMSCs within hydrogel was about 0.54 for the Col-HA hydrogel and 531
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
Fig. 2. a. SEM images of the Col/HA and HA hydrogels. Rheological data for the HA (a) and Col/HA (c) hydrogels.
Fig. 3. a. Proliferation of BMSCs within the hydrogels at different time points. n = 3, *p < 0.05, **p < 0.01. b. A 3D view of the viability of BMSCs within the Col/ HA hydrogel at day 7. c. Live/dead staining of BMSCs within the hydrogels at different time points.
showed a relatively low gene expression after the first week, while significant upregulation was observed after the second week. Meanwhile, the gene expression levels of the Col/HA group were
significantly higher than that of the HA group. For the Runx2 group, the gene expression level in Col/HA was about 4 times higher than for HA in the first week. It increased to 12-fold in the second week. Similar 532
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
Fig. 4. Osteogenic-related gene expressions of BMSCs in the Col-HA and the HA groups. a. Runx2, b. ALP, c. OC, d. Col-I. n = 3, *p < 0.05, **p < 0.01, ***p < 0.001.
Alkaline phosphatase (ALP) is an early marker which often presents high expression levels in osteoblasts before it is subsequently depleted [35]. We therefore measured the ALP activity of BMSCs within the hydrogel first. After incubation in the osteogenic inductive medium at different time intervals, the ALP expression was measured using an ALP kit. As shown in Fig. 5a, the value of ALP/DNA is about 3.40 for the Col/HA and the HA hydrogels after 7 days, but increases to about 12.11 for the Col/HA hydrogel and 9.51 for the HA hydrogel after 14 days, which is almost 3.6 times higher. This illustrates that ALP expression is relatively low in the initial week and no difference is observed between the Col/HA hydrogel and the HA hydrogels. However, the ALP expression significantly increased after 14 days and the ALP expression in the Col/HA hydrogel is slightly higher than in the HA hydrogel. Unlike ALP, osteocalcin (OC) is a new marker for osteogenic differentiation and is exclusively produced by mature osteoblast cells [35]. Therefore, osteocalcin plays an important role during the regulation of the bone calcium metabolism. After incubation in the osteogenic inductive medium for different time intervals, OC expression was measured using an ELISA kit. As shown in Fig. 5b, the value of OC/DNA is about 4.26 for the Col/HA hydrogel and 3.70 for the HA hydrogel after 7 days but increases to about 22.51 for the Col/HA hydrogel and 19.72 for the HA hydrogel after 14 days. Additionally, the OC expression in the Col/HA hydrogel is slightly higher than in the HA hydrogel. These results were in good agreement with the mRNA expressions obtained above. Finally, to evaluate further the osteogenic differentiation ability of BMSCs in the hydrogels, the level of proteins relevant to osteogenic differentiation, such as osteopontin (OPN), bone sialoprotein (BSP), and Osterix (OSX), were determined after 2 weeks of osteogenic induction via western blotting. As shown in Fig. 6a, BMSCs in both the Col/HA hydrogel and the HA hydrogel express OPN, bone BSP, OSX proteins, and the expression level in the Col/HA hydrogel group was significantly higher than that in the HA hydrogel group. Image J software was used to provide a semi-quantitative analysis of the gray levels (shown in Fig. 6b). For the OPN group, the protein expression levels in the Col/HA hydrogel group were 1.5 times higher than in the HA hydrogel group, and 2.8 times and 3.8 times higher in the OSX and BSP group,
Fig. 5. a. ALP activity of BMSCs in the Col/HA and HA hydrogels after osteogenic induction incubation for 1 and 2 weeks. b. OC activity of BMSCs in the Col/HA and HA hydrogels after osteogenic induction incubation for 2 weeks. n = 3, *p < 0.05, ***p < 0.001.
results were obtained for the ALP, OC, and Col-I groups. Overall, the gene expression levels of Runx2, ALP, OC, and Col-I in Col/HA group were all higher than that of HA group. 533
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
an osteogenic differentiation pathway, and ERK plays an important role in osteogenic differentiation of MSCs [39–41]. Therefore, the collagen hydrogels take some advantages over the other hydrogels, such as adhesion, proliferation and expression level of osteogenic factors. 4. Conclusions In this study, we fabricated a BMSCs-encapsulating hydrogel based on water-soluble collagen and hyaluronic acid through a photochemical cross-linking method. Additionally, the mechanical properties, the pore size, and cell survival within the hydrogel were investigated and the results suggested that the Col/HA hydrogel offers a more suitable microenvironment for BMSCs adhesion and proliferation. Furthermore, osteogenic differentiation of BMSCs within the Col/HA hydrogel and the HA hydrogel was also investigated in the absence of BMP-2. The results from ALP activity, OC activity, and the expression levels of osteogenic proteins further suggested that the Col/HA hydrogel could promote osteogenic differentiation. This study introduces and validates water-soluble collagens for fabricating BMSCs-encapsulating hydrogel in a single step, which will further improve the usage of collagen in 3D scaffolds. Conflict of interest There are no conflicts to declare. Acknowledgements This work was financially supported by the Strategic Priority Research Program of Chinese Academy of Sciences (XDA16020100), the Key Research Program of Chinese Academy of Sciences (ZDRW-ZS2016-2), the Science and Technology Foundation of Suzhou (SYG201747) and the CAS/SAFEA International Innovation Teams Program. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.colsurfb.2018.11.050. References
Fig. 6. a. Protein expression of BMSCs in Col/HA and HA hydrogels determined by western blotting after osteogenic induction for 2 weeks. b. Semi-quantitative analysis of protein expression levels normalized to beta-actin. n = 3, ***p < 0.001. c. ARS and ALP staining of BMSCs.
[1] W.C. Kenry, K.P. Lee, C.T. Loh, Lim, Biomaterials 155 (2018) 236–250. [2] W.L. Grayson, B.A. Bunnell, E. Martin, T. Frazier, B.P. Hung, J.M. Gimble, Nat. Rev. Endocrinol. 11 (2015) 140–150. [3] G. Cossu, M. Birchall, T. Brown, P. De Coppi, E. Culme-Seymour, S. Gibbon, J. Hitchcock, C. Mason, J. Montgomery, S. Morris, F. Muntoni, D. Napier, N. Owji, A. Prasad, J. Round, P. Saprai, J. Stilgoe, A. Thrasher, J. Wilson, Lancet 391 (2018) 883–910. [4] Z. Liu, M. Tang, J. Zhao, R. Chai, J. Kang, Adv. Mater. 30 (2018) 1–20. [5] G. Rijal, W. Li, Biomaterials 81 (2016) 135–156. [6] Y. Deng, S. Wei, L. Yang, W. Yang, M.S. Dargusch, Z.-G. Chen, Adv. Funct. Mater. 28 (2018) 1–17. [7] H. Knopf-Marques, M. Pravda, L. Wolfova, V. Velebny, P. Schaaf, N.E. Vrana, P. Lavalle, Regenerative medicine and immunomodulation, Adv. Healthc. Mater. 5 (2016) 2841–2855. [8] L. Pescosolido, W. Schuurman, J. Malda, P. Matricardi, F. Alhaique, T. Coviello, P.R. van Weeren, W.J. Dhert, W.E. Hennink, T. Vermonden, Biomacromolecules 12 (2011) 1831–1838. [9] A.G. Tabriz, M.A. Hermida, N.R. Leslie, W. Shu, Biofabrication 7 (2015) 045012. [10] Y. Morimoto, M. Onuki, S. Takeuchi, Adv. Healthc. Mater. 6 (2017) 1–5. [11] K. Schacht, T. Jungst, M. Schweinlin, A. Ewald, J. Groll, T. Scheibel, Angew. Chem. Int. Ed. Engl. 54 (2015) 2816–2820. [12] X. Yuan, Y. Wei, A. Villasante, J.J.D. Ng, D.E. Arkonac, P.G. Chao, G. VunjakNovakovic, Biomaterials 132 (2017) 59–71. [13] D.J. Munoz-Pinto, A.C. Jimenez-Vergara, T.P. Gharat, M.S. Hahn, Biomaterials 40 (2015) 32–42. [14] B.D. Walters, J.P. Stegemann, Acta Biomater. 10 (2014) 1488–1501. [15] W. Yang, L. Li, G. Su, Z. Zhang, Y. Cao, X. Li, Y. Shi, Q. Zhang, Biomater. Sci. 5 (2017) 1766–1776. [16] K.C. Kuo, R.Z. Lin, H.W. Tien, P.Y. Wu, Y.C. Li, J.M. Melero-Martin, Y.C. Chen, Acta Biomater. 27 (2015) 151–166. [17] C.S. Bahney, C.W. Hsu, J.U. Yoo, J.L. West, B. Johnstone, FASEB J. 25 (2011)
respectively. ARS and ALP staining were performed to evaluate the osteogenic differentiation level of BMSCs within the Col/HA hydrogel after 2 weeks of osteogenic incubation to directly observe the osteogenic differentiation of BMSCs in the Col/HA hydrogel. As shown in Fig. 6c, the Col/HA hydrogel was stained in dark blue and red after osteogenic induction for 2 weeks. These results illustrated that the Col/ HA hydrogel could effectively promote osteogenic differentiation of BMSCs. There are several possible reasons for the high expression level of osteogenic factors in the Col/HA hydrogel. On the one hand, collagen scaffold contains specific cell binding sites, particularly the RGD sequences, and the interaction between RGD and integrin receptors on the BMSC surface will stabilize the cytoskeleton onto the surface of the scaffold, avoid mechanical detachment, and promote BMSCs adhesion and proliferation within the hydrogels [34,36–38]. On the other hand, the previous work demonstrated that type I collagen induced independently the expression of the osteogenic differentiation markers ALP and OPN via FAK and ERK signaling pathways, respectively [32]. Similar results were also obtained by Plopper group, and their experimental results demonstrated that type I collagen could drive MSCs into
534
Colloids and Surfaces B: Biointerfaces 174 (2019) 528–535
T. Zhang et al.
[29] L. Bian, M. Guvendiren, R.L. Mauck, J.A. Burdick, Proc. Natl. Acad. Sci. 110 (2013) 10117–10122. [30] K.A. Smeds, A. Pfister-Serres, D. Miki, K. Dastgheib, M. Inoue, D.L. Hatchell, M.W. Grinstaff, J. Biomed. Mater. Res. 54 (2001) 115–121. [31] C.A.B. Vissers, J.N. Harvestine, J.K. Leach, J. Mater. Chem. B 3 (2015) 8650–8658. [32] S. Viale-Bouroncle, M. Gosau, C. Morsczeck, Arch. Oral Biol. 59 (2014) 1249–1255. [33] A.K. Kundu, A.J. Putnam, Biochem. Biophys. Res. Commun. 347 (2006) 347–357. [34] W.T. Godbey, A. Atala, Ann. N. Y. Acad. Sci. 961 (2002) 10–26. [35] M.B. Oliveira, C.A. Custodio, L. Gasperini, R.L. Reis, J.F. Mano, Acta Biomater. 41 (2016) 119–132. [36] M. Mizuno, R. Fujisawa, Y. Kuboki, J. Cell. Physiol. 184 (2000) 207–213. [37] M.A. Schwartz, M.H. Ginsberg, Nat. Cell Biol. 4 (2002) E65–E68. [38] S. Gronthos, P.J. Simmons, S.E. Graves, P.G. Robey, Bone 28 (2001) 174–181. [39] R.M. Salasznyk, R.F. Klees, M.K. Hughlock, G.E. Plopper, Cell Commun. Adhes. 11 (2004) 137–153. [40] G. Xiao, R. Gopalakrishnan, D. Jiang, E. Reith, M.D. Benson, R.T. Franceschi, J. Bone Miner. Res. 17 (2002) 101–110. [41] G.S. Stein, J.B. Lian, Endocr. Rev. 14 (1993) 424–442.
1486–1496. [18] G.M. Cunniffe, C.M. Curtin, E.M. Thompson, G.R. Dickson, F.J. O’Brien, ACS Appl. Mater. Interfaces 8 (2016) 23477–23488. [19] K. Kolanthai, P.A. Sindu, D.K. Khajuria, S.C. Veerla, D. Kuppuswamy, L.H. Catalani, D. Roy Mahapatra, ACS Appl. Mater. Interfaces 10 (2018) 12441–12452. [20] S.V. Murphy, A. Atala, Nat. Biotechnol. 32 (2014) 773–785. [21] L. Moroni, J.A. Burdick, C. Highley, S.J. Lee, Y. Morimoto, S. Takeuchi, J.J. Yoo, Nat. Rev. Mater. 3 (2018) 21–37. [22] H.N. Chia, B.M. Wu, J. Biol. Eng. 9 (4) (2015) 1–14. [23] A. Kang, J. Park, J. Ju, G.S. Jeong, S.H. Lee, Biomaterials 35 (2014) 2651–2663. [24] M. Sepantafar, R. Maheronnaghsh, H. Mohammadi, S. Rajabi-Zeleti, N. Annabi, N. Aghdami, H. Baharvand, Biotechnol. Adv. 34 (2016) 362–379. [25] N.E. Fedorovich, J. Alblas, J.R. de Wijn, W.E. Hennink, A.J. Verbout, W.J. Dhert, Tissue Eng. 13 (2007) 1905–1925. [26] H. Wang, S.C. Heilshorn, Adv. Mater. 27 (2015) 3717–3736. [27] V. Crescenzi, L. Cornelio, C. Di Meo, S. Nardecchia, R. Lamanna, Biomacromolecules 8 (2007) 1844–1850. [28] M. Talmor, A. Mirza, S. Turley, I. Mellman, L.A. Hoffman, R.M. Steinman, Eur. J. Immunol. 28 (1998) 811–817.
535