- Email: [email protected]
Porcine repeat element DNA: In situ detection of xenotransplanted cells
Cell Transplantation, Vol. 4, No. 2, pp. 253-256, 1995 Copyright © 1995 Elsevier Science Ltd Printed in the USA. All rights reserved 0963-6897/95 $9.50 + .00
Pergamon
0963-6897(94)00049-2
Original Contribution P O R C I N E REPEAT E L E M E N T DNA: IN SITU D E T E C T I O N OF X E N O T R A N S P L A N T E D CELLS HENRY F. OETT1NGER1, AM/~LIERODRIGUE-WAY, JOYCE J. BOUSQUET, AND ALBERT S.B. EDGE Department of Molecular and Cellular Biology,Diacrin, Inc., Bldg. 96 13th St., Charlestown, MA 02129 a variety of cell- or tissue-specific transcripts (2), but has not been widely used for transplantation studies. The detection of donor cells or tissue in recipients is a critical challenge in transplantation biology. As assays for determinants unique to donor cells can require sizable quantities of antigen and can be technically complex, methods are needed for simple, rapid detection of transplanted cells. Taking advantage of the sequence specificity of a porcine repeat element, we demonstrate here use of in situ hybridization to detect porcine islet cells and hepatocytes transplanted into mouse tissues. We discuss the benefits and potential applications to transplant biology.
[ ] Abstract - Using a digoxygenin-labelled D N A probe derived from the porcine repeat element PRE-1, we have developed a protocol for the detection of transplanted porcine islets and hepatocytes against a background of murine host tissue. Analysis of this probe by Southern blotting indicated that PRE-1 hybridizes to pig genomic D N A but not to human or mouse DNA. On tissue sections, hybridizing probe was detected using alkaline phosphatase-conjugated antidigoxygenin antibody visualized with 5-bromo-4-chloro-3indolyl-phosphate/4-nitro-blue tetrazolium chloride (BCIP/ NBT) substrate. We have demonstrated sensitive and highly specific staining of porcine nuclei in fixed, paraffin embedded tissue sections, and have applied the technique to detect porcine pancreatic islets and hepatocytes transplanted into murine kidney and spleen. Applications of this technique include detection of transplanted cells or organs across a variety of xenogeneic barriers.
MATERIALS AND METHODS
[ ] Keywords - D N A repeat element; In s~tu hybridization; Porcine; Transplant; Islets; Hepatocytes.
PRE-1 Cloning A 234 bp repeat element identified within the SLA (swine lymphocyte antigen) gene locus (8) was amplified and cloned by PCR using the following primers: (5'): agggagttcccatcgtggctcag, (3'): agggcc(gatc)cacccgcggcatatggag. The 234 bp product was cloned into Ttailed vector (6) and insert size was verified by restriction analysis. To check reactivity of this probe, genomic DNA from pig, mouse and human was digested using a panel of restriction enzymes, electrophoresed on 1% agarose gels and transferred onto nylon membranes. Following blocking and hybridization using 32p-labelled probe, hybrids were detected by autoradiography (9). For labelling of plasmid DNA with digoxygenin, a commercial kit was used (Digoxygenin DNA Label Kit, Boehringer Mannheim, Indianapolis, IN) employing digoxygenin-labelled random hexamers and the large fragment of DNA polymerase I to synthesize labelled probe. Target DNA was linearized prior to labelling to enhance specific activity. Following labelling, probe
Abbreviations: SLA, swine lymphocyte antigen; BCIP, 5-bromo-4-chloro-3-indolyl-phosphate; NBT, 4-nitroblue tetrazolium chloride; DAB, 3,3'-diamino-benzidine tetrahydrochloride; HP, hepatocyte. INTRODUCTION
Repetitive DNA elements such as Alu sequences have been identified in many species, including mouse and man (7). Due to the unique nature of these sequences, in situ hybridization employing repetitive element DNA probes can be utilized for analysis of specific segments of the genome (chromosomes or specific loci), or for identification of species-specific sequences within a heterogeneous population of cell types. In situ hybridization has been used to identify vitally infected cells (3), to identify regions of individual chromosomes (4) as well as to demonstrate localization and levels of Accepted 9/15/94.
1To whom correspondence should be addressed. 253
254
Cell Transplantation • Volume 4, Number 2, 1995
activity was checked by dot blot assay to determine relative labelling efficiency compared to supplied control DNA.
In Situ Hybridization. In situ hybridization was performed manually using 4/~ sections previously fixed in Bouin's fixative and heat-dried for one hour onto SuperfrostPlus slides (Fisher). Sections were de-parraffinized and treated for 30 min. with 2.5 mg/mL proteinase K (Amresco, Urban, IL) at 37°C. Slides were rinsed twice in 2X SSC (1X SSC is 150 mM NaC1, 300 mM sodium citrate at pH 7.0), dehydrated through an ethanol series, and air dried. For hybridization, plasmid probes were used at 200-500 ng/mL in 50% formamide, 2X SSC, containing dextran sulfate and sheared, salmon sperm DNA to block nonspecific sites (Oncor, Inc., Gaithersburg, MD). Following addition of 20 ul of hybridization cocktail to each section, coverslips were added and target DNA was denatured by placing the slides at 100°C for 10 min. Hybridization continued at 37°C overnight. To remove coverslips, slides were soaked in 2X SSC, followed by washing three times for 10 min each in 50°7o formamide, 2X SSC at room temp. To equilibrate sections for antibody staining, slides were soaked in 0.1 M Tris HCI, pH 7.4 twice for 10 min each. For detection of digoxygenin-labeled DNA, sections were incubated with an alkaline phosphatase-conjugated sheep polyclonal antibody directed against digoxygenin (BoehringerMannheim, Indianapolis, IN)diluted 1:500 in common antibody dilutent (BioGenex, Gaithersburg, MD) for 60 min. at room temperature. Sections were washed with 0.1 M Tris pH 7.4, 0.5°7o Triton-X 100 and developed with freshly prepared BCIP/NBT.
was removed, sectioned, and processed for histochemistry or in situ hybridization. Hepatocytes were isolated from porcine livers by a two step perfusion protocol (1) and cultured for three days in DMEM/Weymouth (3:1) medium containing 1% fetal calf serum. After trypsinization and washing, cells (2 x 106) were injected into the spleens of BALB/c mice in 50 ul of PBS. Spleens were obtained following sacrifice of the animal four days posttransplantation and were processed for histochemistry or in situ hybridization. RESULTS
To check for reactivity of the DNA probe PRE-1, genomic DNA from pig, mouse and human was ana-
Immunohistochemistry To identify porcine islets by immunohistochemical methods, we employed a guinea pig anti-insulin antibody followed by a link antibody (swine anti-rabbit) and peroxidase-rabbit anti-peroxidase. Antibody complex was detected using hydrogen peroxide and DAB according to manufacturer's instructions (Dako, Carpinteria, CA) and counterstained with Mayer's hematoxylin. To identify hepatocytes, we employed a biotinylated mouse anti-SLA monoclonal antibody (MoAb #9-3, manuscript in preparation). Antibody complex was detected using streptavidin-AP and new fuschin, and sections were counterstained as above.
Porcine Cell Transplantation Approximately 8000 porcine islet equivalents (IEs) were isolated by a method similar to that of Marchetti, et al. (5) and transplanted beneath the kidney capsule of a 6 wk-old athymic BALB/c (nu/nu) mouse. Two hundred and fifteen days posttransplant, the kidney
Fig. 1. Nuclear localization and tissue specificityof porcine probe PRE-1. The large, light structure in the center of each section contains islet tissue. (a) porcine pancreas; (b) monkey pancreas; (c) human pancreas. Note specific staining of nuclei (arrows) in porcine, but not human or monkey, pancreatic islets.
Porcine repeat element DNA • H.F. OETTINGERET AL.
255
Fig. 2. Porcine islets transplanted into a BALB/c (nu/nu) mouse kidney and detected 215 days posttransplant. (a) H & E staining of transplanted islet (islet is surrounded by arrows). (b) Adjacent section, using probe PRE-1. (c) Adjacent section stained using a polyclonal antibody against insulin. Note the absence of signal in murine tissue (b,c,) and strong hybridization of PRE-1 probe with transplanted islets (b, arrows).
lyzed by Southern blotting. Autoradiography revealed strong reactivity with porcine D N A while both murine and h u m a n D N A showed negative reactivity (data not shown). To test whether our PRE-1 clone would be useful in nonisotopic in situ hybridization of porcine cells, we labelled the D N A with digoxygenin. P RE-1, when used for in situ hybridization, reacted specifically with porcine nuclear DNA. As seen in Fig. la, nuclei in sections of porcine pancreas (islet in center of field) showed
blue-purple staining due to hybridization of D N A and reaction with the alkaline phosphatase labelled anti-digoxygenin antibody. Note in particular the subcellular localization over the nucleus, the known site of repetitive PRE-1 D N A (arrows). Adjacent sections subjected to hybridization conditions without addition of D N A probe showed no staining (data not shown). As seen in Fig. lb,c no reactivity was seen with either monkey or human pancreas. The light brown staining in these panels represents background found follow-
Fig. 3. Porcine hepatocytes (HPs) transplanted into a BALB/c mouse spleen and detected four days posttransplant. (a) H & E staining of transplanted HPs (pink staining, outlined by arrows). (b) Adjacent section using probe PRE-1. (c) Adjacent section stained using a monoclonal antibody against swine lymphocyte antigen. Note, as in Fig. 2, highly specific staining of porcine nuclei, lack of reactivity with murine splenic tissue, and confirmation of porcine antigens by standard immunohistochemistry.
256
Cell Transplantation • Volume 4, Number 2, 1995
ing the longer development time used for these control tissues. To use probe PRE-1 for the detection of transplanted tissues, we performed in situ hybridization on murine kidney sections transplanted with porcine pancreatic islets and on murine spleens transplanted with porcine hepatocytes. A single, multicellular transplanted islet is visible following standard H & E staining (Fig. 2a, islet is surrounded by arrows). This islet, in an adjacent section Fig. 2b reacts specifically with digoxygeninlabelled PRE-1. Note the deep purple staining of individual nuclei within the islet. No hybridization was observed in the surrounding murine tissue. To verify the identity and health of the transplant, we performed standard immunohistochemistry using an anti-insulin antibody. As seen in Fig. 2c, the islet detected by PRE-1 also stained positively for insulin, confirming its identity as an insulin-containing structure. As seen in Fig. 3a, a group of porcine hepatocytes (containing both uni- and multi-nucleated cells) is visible by H & E staining (HPs surrounded by arrows). These HPs, seen in an adjacent section (Fig. 3b) also react strongly and specifically with PRE-1. As in the case of islet staining, nuclei of the transplanted HPs stain deep purple while surrounding murine tissue does not react with PRE-1. To confirm the porcine origin o f these transplanted cells, we employed a biotinylated anti-class I monoclonal antibody (9-3) followed by streptavidin-AP and development with new fuschin. Note in Fig. 3c the deep red staining within and on the surface of the porcine hepatocytes. DISCUSSION AND CONCLUSION The high sensitivity of in situ hybridization coupled with the specificity of the DNA repeat element PRE- 1 has allowed us to assess the presence of single porcine ceils transplanted into murine tissue. We have shown our digoxygenin-labelled DNA probe will not crossreact with human, monkey or mouse tissues using the hybridization conditions described herein. The possibility exists, however, for reactivity with other species; in this event we recommend screening by Southern blot analysis prior to application of this technique to such sections. Our side-by-side analysis using both in situ hybridization and immunohistochemistry suggest at least four important features of this technique. First, the absolute detection limit of in situ hybridization appears equal or better than that of traditional immunohistochemistry. Second, this method of detection of transplanted cells does not rely on expression of endogenous or transgenic sequences, either of which can decrease or even disappear with time. Third, the use of digox-
ygenin remains preferable to other labels such as biotin, due to the high specificity of the anti-digoxygenin antibody and the lack of endogenous digoxygenin in mammalian tissues (the same is not true of biotin). Fourth, this technique is superior to other DNA methodologies like in situ PCR in that no enzymatic (DNA polymerase) steps are required to visualize target DNA. In conclusion, we feel PRE-1 represents a valuable reagent for detection of any transplanted porcine cell and is not restricted by virtue of tissue of origin. Our success using this repetitive element as an in situ probe suggests the possibility of other, species-specific DNA probes for use in transplantation biology. Acknowledgments-We would like to thank the Process Development and Hepatocyte Biologygroups for their contributions of cells and L. Beaulieu for animal surgery. REFERENCES
1. Berry, M.N.; Friend, D.S. High yield preparation of isolated rat liver parenchymal cells. J. Cell Biol. 43:506-520; 1969. 2. Cox, K.H.; DeLeon, D.V.; Angerer, L.M.; Angerer, R.C. Detection of mRNAs in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev. Biol. 101:485-502; 1984. 3. Heiles, H.B.J.; Genersch, E.; Kessler, C.; Neumann, R.; Eggers, H.J. In situ hybridization with digoxygeninlabelled DNA of human papilloma viruses in HeLa and SiHa cells. BioTechniques 6:978-981; 1988. 4. Lichter, P; Chang-Tang, C; Call, K.; Hermanson, G.; Evans, G.A.; Housman, D.; Ward, D.C. High resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247:64-669; 1990. 5. Marchetti, P.; Finke, E.H.; Gerasimidi-Vazeou, A.; Falqui, L.; Scharp, D.W.; Lacey, P.E. Automated large-scale isolation, in vitro function, and xenotransplantation of porcine islets of Langerhans. Transplantation 52:209-213; 1991. 6. Marchuck, D.; Drumm, M.; Saulino, A.; Collins, F.S. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19:1154; 1990. 7. Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T. Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. 86:66866690; 1989. 8. Singer, D.S.; Parent, L.J.; Ehrlich, R. Identification and DNA sequence of an interspersed repetitive DNA element in the genome of the miniature swine. Nucleic Acids Res. 15:2780; 1987. 9. Southern, E.M. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517; 1975.
Pergamon
0963-6897(94)00049-2
Original Contribution P O R C I N E REPEAT E L E M E N T DNA: IN SITU D E T E C T I O N OF X E N O T R A N S P L A N T E D CELLS HENRY F. OETT1NGER1, AM/~LIERODRIGUE-WAY, JOYCE J. BOUSQUET, AND ALBERT S.B. EDGE Department of Molecular and Cellular Biology,Diacrin, Inc., Bldg. 96 13th St., Charlestown, MA 02129 a variety of cell- or tissue-specific transcripts (2), but has not been widely used for transplantation studies. The detection of donor cells or tissue in recipients is a critical challenge in transplantation biology. As assays for determinants unique to donor cells can require sizable quantities of antigen and can be technically complex, methods are needed for simple, rapid detection of transplanted cells. Taking advantage of the sequence specificity of a porcine repeat element, we demonstrate here use of in situ hybridization to detect porcine islet cells and hepatocytes transplanted into mouse tissues. We discuss the benefits and potential applications to transplant biology.
[ ] Abstract - Using a digoxygenin-labelled D N A probe derived from the porcine repeat element PRE-1, we have developed a protocol for the detection of transplanted porcine islets and hepatocytes against a background of murine host tissue. Analysis of this probe by Southern blotting indicated that PRE-1 hybridizes to pig genomic D N A but not to human or mouse DNA. On tissue sections, hybridizing probe was detected using alkaline phosphatase-conjugated antidigoxygenin antibody visualized with 5-bromo-4-chloro-3indolyl-phosphate/4-nitro-blue tetrazolium chloride (BCIP/ NBT) substrate. We have demonstrated sensitive and highly specific staining of porcine nuclei in fixed, paraffin embedded tissue sections, and have applied the technique to detect porcine pancreatic islets and hepatocytes transplanted into murine kidney and spleen. Applications of this technique include detection of transplanted cells or organs across a variety of xenogeneic barriers.
MATERIALS AND METHODS
[ ] Keywords - D N A repeat element; In s~tu hybridization; Porcine; Transplant; Islets; Hepatocytes.
PRE-1 Cloning A 234 bp repeat element identified within the SLA (swine lymphocyte antigen) gene locus (8) was amplified and cloned by PCR using the following primers: (5'): agggagttcccatcgtggctcag, (3'): agggcc(gatc)cacccgcggcatatggag. The 234 bp product was cloned into Ttailed vector (6) and insert size was verified by restriction analysis. To check reactivity of this probe, genomic DNA from pig, mouse and human was digested using a panel of restriction enzymes, electrophoresed on 1% agarose gels and transferred onto nylon membranes. Following blocking and hybridization using 32p-labelled probe, hybrids were detected by autoradiography (9). For labelling of plasmid DNA with digoxygenin, a commercial kit was used (Digoxygenin DNA Label Kit, Boehringer Mannheim, Indianapolis, IN) employing digoxygenin-labelled random hexamers and the large fragment of DNA polymerase I to synthesize labelled probe. Target DNA was linearized prior to labelling to enhance specific activity. Following labelling, probe
Abbreviations: SLA, swine lymphocyte antigen; BCIP, 5-bromo-4-chloro-3-indolyl-phosphate; NBT, 4-nitroblue tetrazolium chloride; DAB, 3,3'-diamino-benzidine tetrahydrochloride; HP, hepatocyte. INTRODUCTION
Repetitive DNA elements such as Alu sequences have been identified in many species, including mouse and man (7). Due to the unique nature of these sequences, in situ hybridization employing repetitive element DNA probes can be utilized for analysis of specific segments of the genome (chromosomes or specific loci), or for identification of species-specific sequences within a heterogeneous population of cell types. In situ hybridization has been used to identify vitally infected cells (3), to identify regions of individual chromosomes (4) as well as to demonstrate localization and levels of Accepted 9/15/94.
1To whom correspondence should be addressed. 253
254
Cell Transplantation • Volume 4, Number 2, 1995
activity was checked by dot blot assay to determine relative labelling efficiency compared to supplied control DNA.
In Situ Hybridization. In situ hybridization was performed manually using 4/~ sections previously fixed in Bouin's fixative and heat-dried for one hour onto SuperfrostPlus slides (Fisher). Sections were de-parraffinized and treated for 30 min. with 2.5 mg/mL proteinase K (Amresco, Urban, IL) at 37°C. Slides were rinsed twice in 2X SSC (1X SSC is 150 mM NaC1, 300 mM sodium citrate at pH 7.0), dehydrated through an ethanol series, and air dried. For hybridization, plasmid probes were used at 200-500 ng/mL in 50% formamide, 2X SSC, containing dextran sulfate and sheared, salmon sperm DNA to block nonspecific sites (Oncor, Inc., Gaithersburg, MD). Following addition of 20 ul of hybridization cocktail to each section, coverslips were added and target DNA was denatured by placing the slides at 100°C for 10 min. Hybridization continued at 37°C overnight. To remove coverslips, slides were soaked in 2X SSC, followed by washing three times for 10 min each in 50°7o formamide, 2X SSC at room temp. To equilibrate sections for antibody staining, slides were soaked in 0.1 M Tris HCI, pH 7.4 twice for 10 min each. For detection of digoxygenin-labeled DNA, sections were incubated with an alkaline phosphatase-conjugated sheep polyclonal antibody directed against digoxygenin (BoehringerMannheim, Indianapolis, IN)diluted 1:500 in common antibody dilutent (BioGenex, Gaithersburg, MD) for 60 min. at room temperature. Sections were washed with 0.1 M Tris pH 7.4, 0.5°7o Triton-X 100 and developed with freshly prepared BCIP/NBT.
was removed, sectioned, and processed for histochemistry or in situ hybridization. Hepatocytes were isolated from porcine livers by a two step perfusion protocol (1) and cultured for three days in DMEM/Weymouth (3:1) medium containing 1% fetal calf serum. After trypsinization and washing, cells (2 x 106) were injected into the spleens of BALB/c mice in 50 ul of PBS. Spleens were obtained following sacrifice of the animal four days posttransplantation and were processed for histochemistry or in situ hybridization. RESULTS
To check for reactivity of the DNA probe PRE-1, genomic DNA from pig, mouse and human was ana-
Immunohistochemistry To identify porcine islets by immunohistochemical methods, we employed a guinea pig anti-insulin antibody followed by a link antibody (swine anti-rabbit) and peroxidase-rabbit anti-peroxidase. Antibody complex was detected using hydrogen peroxide and DAB according to manufacturer's instructions (Dako, Carpinteria, CA) and counterstained with Mayer's hematoxylin. To identify hepatocytes, we employed a biotinylated mouse anti-SLA monoclonal antibody (MoAb #9-3, manuscript in preparation). Antibody complex was detected using streptavidin-AP and new fuschin, and sections were counterstained as above.
Porcine Cell Transplantation Approximately 8000 porcine islet equivalents (IEs) were isolated by a method similar to that of Marchetti, et al. (5) and transplanted beneath the kidney capsule of a 6 wk-old athymic BALB/c (nu/nu) mouse. Two hundred and fifteen days posttransplant, the kidney
Fig. 1. Nuclear localization and tissue specificityof porcine probe PRE-1. The large, light structure in the center of each section contains islet tissue. (a) porcine pancreas; (b) monkey pancreas; (c) human pancreas. Note specific staining of nuclei (arrows) in porcine, but not human or monkey, pancreatic islets.
Porcine repeat element DNA • H.F. OETTINGERET AL.
255
Fig. 2. Porcine islets transplanted into a BALB/c (nu/nu) mouse kidney and detected 215 days posttransplant. (a) H & E staining of transplanted islet (islet is surrounded by arrows). (b) Adjacent section, using probe PRE-1. (c) Adjacent section stained using a polyclonal antibody against insulin. Note the absence of signal in murine tissue (b,c,) and strong hybridization of PRE-1 probe with transplanted islets (b, arrows).
lyzed by Southern blotting. Autoradiography revealed strong reactivity with porcine D N A while both murine and h u m a n D N A showed negative reactivity (data not shown). To test whether our PRE-1 clone would be useful in nonisotopic in situ hybridization of porcine cells, we labelled the D N A with digoxygenin. P RE-1, when used for in situ hybridization, reacted specifically with porcine nuclear DNA. As seen in Fig. la, nuclei in sections of porcine pancreas (islet in center of field) showed
blue-purple staining due to hybridization of D N A and reaction with the alkaline phosphatase labelled anti-digoxygenin antibody. Note in particular the subcellular localization over the nucleus, the known site of repetitive PRE-1 D N A (arrows). Adjacent sections subjected to hybridization conditions without addition of D N A probe showed no staining (data not shown). As seen in Fig. lb,c no reactivity was seen with either monkey or human pancreas. The light brown staining in these panels represents background found follow-
Fig. 3. Porcine hepatocytes (HPs) transplanted into a BALB/c mouse spleen and detected four days posttransplant. (a) H & E staining of transplanted HPs (pink staining, outlined by arrows). (b) Adjacent section using probe PRE-1. (c) Adjacent section stained using a monoclonal antibody against swine lymphocyte antigen. Note, as in Fig. 2, highly specific staining of porcine nuclei, lack of reactivity with murine splenic tissue, and confirmation of porcine antigens by standard immunohistochemistry.
256
Cell Transplantation • Volume 4, Number 2, 1995
ing the longer development time used for these control tissues. To use probe PRE-1 for the detection of transplanted tissues, we performed in situ hybridization on murine kidney sections transplanted with porcine pancreatic islets and on murine spleens transplanted with porcine hepatocytes. A single, multicellular transplanted islet is visible following standard H & E staining (Fig. 2a, islet is surrounded by arrows). This islet, in an adjacent section Fig. 2b reacts specifically with digoxygeninlabelled PRE-1. Note the deep purple staining of individual nuclei within the islet. No hybridization was observed in the surrounding murine tissue. To verify the identity and health of the transplant, we performed standard immunohistochemistry using an anti-insulin antibody. As seen in Fig. 2c, the islet detected by PRE-1 also stained positively for insulin, confirming its identity as an insulin-containing structure. As seen in Fig. 3a, a group of porcine hepatocytes (containing both uni- and multi-nucleated cells) is visible by H & E staining (HPs surrounded by arrows). These HPs, seen in an adjacent section (Fig. 3b) also react strongly and specifically with PRE-1. As in the case of islet staining, nuclei of the transplanted HPs stain deep purple while surrounding murine tissue does not react with PRE-1. To confirm the porcine origin o f these transplanted cells, we employed a biotinylated anti-class I monoclonal antibody (9-3) followed by streptavidin-AP and development with new fuschin. Note in Fig. 3c the deep red staining within and on the surface of the porcine hepatocytes. DISCUSSION AND CONCLUSION The high sensitivity of in situ hybridization coupled with the specificity of the DNA repeat element PRE- 1 has allowed us to assess the presence of single porcine ceils transplanted into murine tissue. We have shown our digoxygenin-labelled DNA probe will not crossreact with human, monkey or mouse tissues using the hybridization conditions described herein. The possibility exists, however, for reactivity with other species; in this event we recommend screening by Southern blot analysis prior to application of this technique to such sections. Our side-by-side analysis using both in situ hybridization and immunohistochemistry suggest at least four important features of this technique. First, the absolute detection limit of in situ hybridization appears equal or better than that of traditional immunohistochemistry. Second, this method of detection of transplanted cells does not rely on expression of endogenous or transgenic sequences, either of which can decrease or even disappear with time. Third, the use of digox-
ygenin remains preferable to other labels such as biotin, due to the high specificity of the anti-digoxygenin antibody and the lack of endogenous digoxygenin in mammalian tissues (the same is not true of biotin). Fourth, this technique is superior to other DNA methodologies like in situ PCR in that no enzymatic (DNA polymerase) steps are required to visualize target DNA. In conclusion, we feel PRE-1 represents a valuable reagent for detection of any transplanted porcine cell and is not restricted by virtue of tissue of origin. Our success using this repetitive element as an in situ probe suggests the possibility of other, species-specific DNA probes for use in transplantation biology. Acknowledgments-We would like to thank the Process Development and Hepatocyte Biologygroups for their contributions of cells and L. Beaulieu for animal surgery. REFERENCES
1. Berry, M.N.; Friend, D.S. High yield preparation of isolated rat liver parenchymal cells. J. Cell Biol. 43:506-520; 1969. 2. Cox, K.H.; DeLeon, D.V.; Angerer, L.M.; Angerer, R.C. Detection of mRNAs in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev. Biol. 101:485-502; 1984. 3. Heiles, H.B.J.; Genersch, E.; Kessler, C.; Neumann, R.; Eggers, H.J. In situ hybridization with digoxygeninlabelled DNA of human papilloma viruses in HeLa and SiHa cells. BioTechniques 6:978-981; 1988. 4. Lichter, P; Chang-Tang, C; Call, K.; Hermanson, G.; Evans, G.A.; Housman, D.; Ward, D.C. High resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247:64-669; 1990. 5. Marchetti, P.; Finke, E.H.; Gerasimidi-Vazeou, A.; Falqui, L.; Scharp, D.W.; Lacey, P.E. Automated large-scale isolation, in vitro function, and xenotransplantation of porcine islets of Langerhans. Transplantation 52:209-213; 1991. 6. Marchuck, D.; Drumm, M.; Saulino, A.; Collins, F.S. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19:1154; 1990. 7. Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T. Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. 86:66866690; 1989. 8. Singer, D.S.; Parent, L.J.; Ehrlich, R. Identification and DNA sequence of an interspersed repetitive DNA element in the genome of the miniature swine. Nucleic Acids Res. 15:2780; 1987. 9. Southern, E.M. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517; 1975.