In situ detection of tandem DNA repeat length

Genetic

ELSEVIER

Analysis: Biomolecular Engineering 13 (1996) 113-118

In situ detection of tandem DNA repeat length Ron Yaar, F’rzemyslaw Pharmacology

Szafranski,

Charles

R. Cantor,

Cassandra

L. Smith*

Center for Advanced Biotechnology and Departments of Biomedical Engineering, Biology, and Experimental Therapeutics Boston University 36 Cummington St., 2nd Floor Boston MA 02215 USA

Received 20 April 1996; accepted 15 July 1996

Abstract A simple method for scoring short tandem DNA repeats is presented. An oligonucleotide target, containing tandem repeats embedded in a unique sequence, was hybridized to a set of complementary probes, containing tandem repeats of known lengths. Single-stranded loop structures formed on duplexes containing a mismatched (different) number of tandem repeats. No loop structure formed on duplexes containing a matched (identical) number of tandem repeats. The matched and mismatched loop structures were enzymatically distinguished and differentially labeled by treatment with Sl nuclease and the Klenow fragment of DNA polymerase. Copyright 0 1996 Elsevier Science B.V. Keywords:

Tandem DNA repeats; Oligonucleotides;

Sl nuclease; Klenow fragment

1. Introduction

2. Materials and methods

Short, tandemly repeating sequences are useful genetic mapping tools, becaus’e they are widespread in the human genome and highly polymorphic in length [l]. Moreover, an increasing number of neurodegenerative diseases, e.g. myotonic dy:strophy and fragile X syndrome, are associated with an abnormal expansion of a specific trinucleotide repea.t length [2]. Conventional methods for detecting differences in repeat lengths use expensive, time consuming electrophoretic fractionation steps [7]. The advent of methods for efficient coupling of DNA to solid surfaces have paved the way for the development of new assays capable of determining the length of these tandem DNA repeats in a quick and accurate manner without an electrophoretic separation step. Here, we present a new procedure for measuring tandem DNA repeat lengths in situ.

2.1. Oligonucleotides

*Correspondingauthor.

Tel.:

+617

353 8500; fax:

+ 617 353

8501. 1050-3862/96/$15.00 Copyright PI1 SlOSO-3862(96)00155-6

0 1996 Elsevier

Science B.V. All rights

Synthetic oligonucleotides were obtained from Operon Technologies, Inc. (Alameda, CA; Table 1). Oligonucleotides Tl and T2 were purified by fractionation on a denaturing polyacrylamide (12% acrylamide, 8 M Urea) gel. The DNA was visualized by UV shadowing and bands corresponding to the highest molecular weight product were cut out of the gel. Gel slices were submerged in two volumes of 10 mM Tris-Cl (pH 8.0), 5 mM ethylenediaminetetraacetic acid (EDTA), and oligonucleotides were eluted for 48 h at 4°C. Samples were then purified by ethanol precipitation and resuspended in 10 mM TrisCl (pH 8.0). Oligonucleotide CTG6 was purified by Operon Technologies, Inc. using high performance liquid chromatography. The concentration of each stock solution was determined by absorption at 260 nm. reserved

114

R. Yaar et al. 1 Genetic

Table 1 Oligonucleotides

Analysis:

Biomolecular

Engineering

I3 (1996)

113-l

18

used in this study

Name

Sequence

Size (residues)

Tl

CCAGATCTGATGCGTCGGATCATCCAGCAGCAGCAGCAGCAGCAGCAGTCACGCTAACCGAATCCCTGGTCAGATCTT AAGATCTGACCAGGGATTCGGTTAGCGTGACTGCTGCTGCTGCTGCTGCTGCTGGATGATCCGACGCATCAGATCTGG AAGATCTGACCAGGGATTCGGTTAGCGTGACTGCTGCTGCTGCTGCTGGATGATCCGACGCATCAGATCTGG

78

T2 CTG6

2.2. Kinase labeling of oligonucleotides

78 72

columns from CLONTECH (Palo Alto, CA) were used to purify the labeled oligonucleotide from unincorporated ATP.

Oligonucleotide T 1 (3.5 ,DM) and T4 polynucleotide kinase (New England Biolabs, Beverly, MA; 0.35 Units of enzyme per picomole oligonucleotide) were incubated for 45 min at 37°C in kinase buffer (70 mM Tris-Cl (pH 7.6) 10 mM MgCl,, 5 mM dithiothreitol) containing 6.4 PM [y3*P]-labeled adenosine triphosphate (ATP; 60 Ci/mmol). CHROMA-SPINTM + TE 10

2.3. Oligonucleotide hybridization Oligonucleotide Tl (1 PM) was annealed, in a 50 PL volume of 100 mM Tris-Cl (pH S.O), to T2 or CTG6 (3 PM). The samples were denatured at 96°C for 4 min

TICTGG Temp. Sl Cont. (Wpmole)

--

0

24

-

Tl-T2

37

0.1 0.2 0.4 0.5 0.1 0.2 0.4 0.5 0.1 0.2 0.4 0.5 0

0 0

M

0

-

24

37

0.1 0.2 0.4 0.5 0.1 0.2 0.4 0.5 0.1 0.2 0.4 0.5

+78bp

Lane 1 2 3 4 5 6 7 8 9

101112131415

."_ 18171819202122232425262728

12%NON-DENATURINGGEL M = ~X1741HinfIdigest Fig. 1. Effect of temperature and Sl nuclease concentration on cleavage of DNA duplexes containing Tl was hybridized to oligonucleotide T2 or CTG6, forming a duplex containing perfectly matched a loop structure (lanes 16-28) respectively. Samples were incubated with varying concentrations nuclease control samples in lanes 13, 14 and 17 were incubated at 37°C. Of the bands appearing corresponds to undigested Tl .CTG6. The lower bands (arrow heads) correspond to Tl .CTG6 in

bulge loops. 32P end-labeled oligonucleotide repeats (lanes 1~ 14) and a duplex containing of Sl nuclease, at 0°C 24°C and 37’C. Sl in lanes 1 through 12, the top band (arrow) various stages of loop degradation.

R. Yaar et al. / Genetic Analysis: Biomolecular Engineering

and then slowly cooled from 80°C to 30°C over 2 h, to ensure specific annealing. This temperature profile was used to anneal all oligonucleotides in the experiments detailed below, although subsequent experiments indicate that sufficient specificrty can be achieved simply by mixing the two oligonuckotides at room temperature.

13 (1996) 113-I 18

115

HOMO- HETERODUPLEX DUPLEX

2.4. Sl nuclease digestion DNA samples were incubated with Sl nuclease (Promega, Madison, WI), in Sl nuclease buffer (200 mM NaCl, 50 mM Sodium Acetate (pH 4.5), 1 mM ZnS04, 0.5% glycerol). The ratio of enzyme to duplex ranged from 0.1 to 0.5 Units per picomole. Three different incubation temperatures were used (O‘C, 24°C and 37”C), and all samples were equilibrated at the reaction temperature befo:re the addition of Sl nuclease. After a 30-min incubation, reactions were stopped by adding EDTA to a final concentration of 12 mM, or by passing the sample,s through a CHROMASPINTM + TE 10 column (CLONTECH).

118 100 81

48 42 40

2.5. Strand displacement with Klenow fragment of DNA polymerase I

DNA samples were incubated for 15 min, at room temperature, with the Klenow fragment of DNA polymerase I (New England Biolabs; 0.08 Units of enzyme per picomole of duplex), in Klenow buffer (50 mM KCl, 10 mM Tris-Cl (pH 83) 1.5 mM MgC12, 0.001% gelatin) containing 30 PM of each of the required deoxynucleotide triphosphates (dNTPs), and 32P-dCTP (1.74 Ci/mmole) in a total volume of 50 pL. Reactions were stopped by addition of sodium dodecyl sulfate to a final concentration of 0.05%.

3. Results A model system was used to develop a method for scoring tandem repeat length in the absence of electrophoretic size fractionation. The model system used synthetic oligonucleotides conatining a trinucleotide repeating sequence flanked by unique sequences. The target oligonucleotide, Tl, contained 8 CAG repeats. The probe oligonucleotides, T2 and CTG6, contained 8 and 6 CTG repeats, respectively. The unique sequence portions of oligonucleotides CTG6 and T2 were complementary to the unique sequence portions of oligonucleotide Tl. Oligonucleotide Tl was annealed, separately, to oligonucleotides T2 and CTG6. The matched repeats of oligonucleotides Tl and T2 formed a perfectly matched double-stranded DNA duplex. The mismatched repeats of oligonucleotides Tl and CTG6 formed a duplex containing a 6-base single-stranded loop structure on

Lane

1

2

34

M

12% NON-DENATURING

GEL

M = @X174 / Hinf I digest Fig. 2. DNA Polymerase labeling of mismatched duplexes cleaved by Sl nuclease. Unlabeled target oligonucleotide, Tl, was annealed to probe oligonucleotide T2 or CTG6, forming a duplex containing matched repeats (lanes 1 and 2) and a duplex containing a loop structure (lanes 3 and 4), respectively. Oligonucleotide duplexes were incubated with ( + ) and without ( - ) Sl nuclease (0.6 units per picomole duplex). Only the Tl CTG6 complex was efficiently labeled (arrow).

the Tl strand. The two duplexes, Tl . T2 and Tl . CTG6, were distinguished enzymatically using Sl nuclease and DNA polymerase. 3.1. Sl nuclease cleaves single-stranded loops formed by mismatched short tandem repeats The efficiency at which Sl nuclease differentially cleaved DNA duplexes with, and without, a 6-base single-stranded loop was analyzed, using 32P end-labeled target (Tl; Fig. 1). While more than 60% of the Tl . CTG6 duplexes incubated at 0°C with Sl nuclease (0.5 Units of enzyme per picomole of duplex) were cleaved, no cleavage of the perfectly matched Tl .T2 duplex was observed. Multiple DNA cleavage products were detected in the Sl-treated Tl . CTG6 duplex. Multiple products are seen because the Sl nuclease-sensitive bulge loops can be cleaved and subsequently degraded in several ways.

R. Yaar et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 113-l 18

116

At higher decreased in plex samples likely due to

temperatures, the 32P target end label both the matched and mismatched dutreated with Sl nuclease. This was most Sl nuclease removing the 32P end label

3.2. The Klenow enzyme strand displaces Sl -cleaved loop structure

B

the

4

+ TARGET A

of the target oligo as the duplex ends transiently denatured. The non-specific loss of label was not proat 0°C. These nounced in samples incubated experiments confirm that S 1 nuclease preferentially cleaves the single-stranded loops.

PROBES ANNEALING

C

LOOP CLEAVAGE

Unlabeled, S l-cleaved duplexes were incubated with the Klenow enzyme in the presence of [a32P]-labeled dCTP. Incorporation of 32P-dCMP into the duplex containing mismatched repeats, Tl . CTG6, was extensive, whereas little label was incorporated into the duplex containing matched repeats, i.e. Tl .T2 duplex (Fig. 2). Polyacrylamide gel electrophoresis revealed that the 32P-dCMP, incorporated into the mismatched duplex, was localized in a single, distinct band. Some non-specific labeling of the perfectly matched duplex, Tl . T2, as well as some labeling in the mismatched duplex, Tl . CTG6, was probably due to Sl nuclease introducing nicks in double-stranded DNA [3]. It has been previously shown, and confirmed here, that the loop-cutting activity of Sl nuclease is much stronger than its ability to introduce nicks into perfectly matched double-stranded DNA [41.

4. Discussion

The experiments detailed here are a preliminary step toward the development of an automated, fluorescent based assay for determining the exact number of short tandem DNA repeats at specific genomic locations. An

STRAND DISPLACEMENT J

/i

E

FLUORESCENT

GREEN YELLOW RED

Fig. 3. Outline of one mismatch detection scheme using anchored, single-stranded oligonucleotide probes. (A) An array of singlestranded probes, containing a variable number of repeats, is attached to a streptavidin coated surface via a 5’ biotin linker. Probes are labeled at the 3’ end with rhodamine. (B) Target DNA sequences are labeled at the 3’ end with fluorescein. Target DNA is denatured and annealed to the DNA probes. (C) DNA duplexes containing a mismatched number of repeats form a bulge loop structure on the strand containing the larger number of repeats. No loop structure is formed in duplexes containing a matched number of repeats. (D) Duplexes containing loop structures are cleaved by a mismatch detection enzyme, while duplexes containing perfectly matched repeats remain intact. (E) The cleaved strand is removed by a DNA polymerase exhibiting strand displacement (or 5’-3’ exonuclease) activity. The fluorescent label of the cleaved strand is removed from the surface and washed away. (F) In this system, the DNA structures are differentially labeled: green if the probe was longer than the target DNA, red if the probe was shorter than the target DNA, and yellow if the probe matched the target DNA.

R. Yaar et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 113-118

117

.

A

I PROBE! LENGTH 10

II

12

13

14

15

16

17

C PROBE LENGTH

I 18

IQ

20

I

10

II

12

13

14

15

18

17

18

IQ

20

I ALLELE

I I

SMALL ALLELE

LARGE ALLELE

I I I I I

I PROBE LENGTH

I

PROBE LENGTH

Fig. 4. Analysis of tandem DNA repeat length in homozygous and heterozygous samples. Probes containing different numbers of repeats are fixed in wells, on a silicon chip, by order of their size, and labeled at their 3’ends with a rhodaminetag. Target DNA, labeledat the 3’end with a fluorescein tag, is annealed to the probe array. A mismatch detection enzyme cleaves the loop structures formed on mismatched repeat-containing duplexes. Then, DNA polymerase is used to displace the cleaved strand. Fluorescent analysis of the polymerase products reveals the target DNA repeat length. Potential results for a homozygous (A, B) and a heterozygous (C, D) sample are shown. In the case of a homozygous sample, probes with fewer repeats than the target allele will appear red. Wells containing probes with more repeats than the target allele will appear green. The well which contains probes with the same number of repeats as the target allele will appear yellow. In this example, the target DNA contains 15 repeats. In the case of a heterozygous sample, wells containing probes with fewer repeats than both the target alleles will appear red. Wells containing probes with more repeats than both the target alleles will appear green. Wells containing probes with an intermediate number of repeats will appear yellow. In this example, the target DNA contains a 12-repeat allele and a larger allele, containing 18 repeats.

outline of one such assay is presented (Fig. 3). Implementation of the assay involves labeling target DNA on the 3’ end with a fluorescein tag. Target DNA is then annealed to an array of synthetic oligonucleotide probes containing varying lengths of a tandem repeat, labeled at the 3’end with a rhodamine tag. The probes are attached to a streptavidin surface through a 5’ biotin end, and are segregal:ed by the number of repeats they contain. Target DNA and probes colitaining a matched number of repeats form perfect doublestranded DNA duplexes. Target DNA and probes containing a mismatched number of repeats form duplexes with a loop structure on the longer strand. The target-probe duplexes are then incubated with one or more mismatch recognition enzymes, which cleave the loop structures. After cleavage with the designated enzyme, a DNA polymerase with 5’-3’ exonuclease and/or strand displacement activity is added

to selectively degrade the cleaved strand (Fig. 3). In this case, rather than adding label, the polymerase removes label from the cleaved strand. Since the target DNA and probe are marked with different fluorescent markers, each possible duplex results in a different color. If fluorescein and rhodamine markers are used, a red color will appear in the case where the target DNA is longer than the probe. A green color will appear in the case where the probe is longer than the target DNA. A yellow color will appear in the case where the probe is the same length as the target DNA. Quick and accurate determination of repeat length should be possible using standard fluorescent analysis of the polymerization products. Most short tandem repeats found in the human genome are polymorphic. This means most human samples will be heterozygous. Avoiding laborious separations of these different species is crucial for rapid

II8

R. Yaar et al. / Genetic Analysis: Biomolecular Engineering

analysis of repeat length. Although the method described above has tested exclusively homozygous samples, this procedure can also be used to determine the repeat lengths present in a heterozygous sample. The procedure for analyzing a heterozygous sample would be the same as for a homozygous sample. However, a heterozygous mixture will produce a different flourescent pattern than a homozygous sample (Fig. 4). Probes containing fewer repeats than both targets will result in loop formation only on the target strands. After cleavage with a mismatch detection enzyme and strand displacement with a DNA polymerase, only fluorescent label on the probe will remain. Conversely, probes containing more repeats than both targets will lead to loop formation only on the probe strand. After cleavage and strand displacement, only fluorescent label on the target will remain. Finally, probes containing repeat lengths intermediate to those of the targets, will result in loop formation on both the template and the probe strands. In this case, cleavage and strand displacement will result in a mixture of both fluorescent probes. The transition from one color to the next will correspond to repeat length of each of the targets in the heterozygous sample. The transition from red to yellow will coincide with the repeat length of the smaller allele, while the transition from yellow to green will coincide with the repeat length of the larger allele. The anchoring of this assay onto a solid support and standardizing of reaction conditions will greatly facilitate its automation. In the proposed final configuration of this method, the previously described synthetic oligonucleotides would be arrayed onto a solid surface in order of repeat length. A two-dimensional silicon or glass chip could be easily designed to contain hundreds of probes, one for each repeat length. Sample DNA would be hybridized to the array, and the above reactions would be carried out en masse on all of the DNA duplexes in all of the wells. Finally, it should be noted

13 (1996) 113-118

that there are multiple formats, i.e. varying labeling positions and types, as well as enzymes which may be applied to distinguish duplexes with bulge loops from those without. Currently, a variety of formats are being tested using immobilized probes.

Acknowledgements

This work was supported by grants from DOE ( # DE-FG02-93ER61609) to Charles R. Cantor and DOA ( # AIBS2154) and NIH ( # NHlP50-HL5500101) to Cassandra L. Smith.

References

111Benson G, Waterman MS. A method for fast database search for all k-nucleotide repeats. Nucleic Acids Res 1994; 22(22): 48284836. 121Brook JD, McCurrach ME, Harley HG, Buckler AJ, Church D, Aburatani H, Hunter K, Stanton VP, Thirion J, Hudson T, Sohn R, Zemelman B, Snell RG, Rundle SA, Crow S, Davies J, Shelbourne P, Buxton J, Jones C, Juvonen V, Johnson K, Harper PS, Shaw DJ, Housman DE. Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3’ end of a transcript encoding a protein kinase family member. Cell Apr 1992; 69(2): 385. [31Germond JE, Vogt VM, Hirt B. Characterization of the singlestrand-specific nuclease Sl activity on double-stranded supercoiled polyoma DNA. Eur J Biochem 43; 1974: 591-600. [41Linn SM, Roberts RJ, eds. Nucleases, Cold Spring Harbor Laboratory, 1982; 156- 158. [51Sutherland GR, Richards RI. Simple tandem DNA repeats and human genetic disease. Proc Nat Acad Sci USA 1995; 92(9): 363663641. WI Wehnert MS, Matson RS, Rampal JB, Coassin PJ, Caskey CT. A rapid scanning strip for tri- and dinucleotide short tandem repeats. Nucleic Acids Res 1994; 22(9): 1701- 1704. [71White MB, Carvalho M, Derse D, O’Brien SJ, Dean M. Detecting single base substitutions as heteroduplex polymorphisms. Genomics 1992; 12(2): 301-306.