Detection of a novel X-chromosomal short tandem repeat marker in Xq28 in four ethnic groups

Legal Medicine 19 (2016) 43–46

Contents lists available at ScienceDirect

Legal Medicine journal homepage: www.elsevier.com/locate/legalmed

Short Communication

Detection of a novel X-chromosomal short tandem repeat marker in Xq28 in four ethnic groups Takeki Nishi a,⇑, Takako Nakamura b, Katuya Honda b a b

Department of Forensic Medicine, The Jikei University School of Medicine, 3-25-8 Nishi-shinbashi, Minato-ku, 105-8461 Tokyo, Japan Department of Legal Medicine, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575, Japan

a r t i c l e

i n f o

Article history: Received 28 July 2015 Received in revised form 28 December 2015 Accepted 27 January 2016 Available online 27 January 2016 Keywords: X chromosome Short tandem repeat X-STR STR sequence Population

a b s t r a c t DNA testing of X-chromosomal short tandem repeat (X-STR) polymorphisms has been the focus of attention in several studies, mainly due to its applicability in the investigation of complex kinship cases. Studies of X-STR in analyses of DNA sequences, population studies and DNA testing applications have been reported. We performed detection and population genetic study of a novel tetranucleotide X-STR locus in the present study. We identified a unique X-STR locus consisting of two tetranucleotides in Xq28. Although the STR is a simple tetranucleotide, its polymorphism was comparatively high [polymorphism information content (PIC) = 0.7140] in Japanese subjects. In addition, the STR varied in structure among ethnic groups. We conclude that this locus will be useful for forensic DNA testing and anthropological studies. Ó 2016 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Several autosomal and gonosomal short tandem repeats (STRs) are useful tools for determining individual identities. Currently, forensic DNA testing with autosomal STR and Y-chromosomal STR (Y-STR) is commonly used to identify individuals. Commercially available kits for both chromosomal STRs are commonly used in forensic DNA testing. There are many reports of population and comparative studies using Identifiler (Applied Biosystems, Foster City, CA, USA) [1–3], PowerPlex (Promega Corporation, Madison, WI, USA) [2,3], Globalfiler (Applied Biosystems) [4,5], Yfiler (Applied Biosystems) [6,7] and Powerplex Y (Promega) [7]. DNA testing of X-chromosomal STR (X-STR) polymorphisms has been the focus of attention in several studies, mainly due to its applicability in the investigation of complex kinship cases, such as deficient-paternity cases [8,9]. Analyses of DNA sequences [10–13], population genetic studies and multiplex polymerase chain reactions (PCR) for application in DNA testing [14–16] continue to be reported. Recently, some studies of X-STR linkage groups have been reported. A commercially available kit for X-STR multiplex PCR, investigator Argus X-12 kit (Qiagen GmbH, Hilden, Germany), contains X-STR linkage groups. As for linkage groups carrying X-STR, five regions, p22, centromere, q12, q26 and q28, have been reported [9,17–19]. In this study, we ⇑ Corresponding author. E-mail address: [email protected] (T. Nishi). http://dx.doi.org/10.1016/j.legalmed.2016.01.010 1344-6223/Ó 2016 Elsevier Ireland Ltd. All rights reserved.

performed the detection of a novel tetranucleotide X-STR locus in Xq28 and a population genetic study of four ethnic groups. 2. Materials and methods 2.1. Sample and DNA extraction With the approval of an ethics committee of the University of Tsukuba, samples were collected from 610 unrelated individuals of four nationalities. They included 249 Japanese (150 males and 99 females), 93 Mongolians (81 males and 12 females), 88 Caucasian-Americans (33 males and 55 females) and 180 native American Colombians (87 males and 93 females). DNA was extracted with a Maxwell 16 Instrument (Promega). The extracted DNA was quantitated with a UV spectrophotometer (DU Series 700; Beckman Coulter, CA, USA). This study involving human material or human data was approved by the Institutional Review Board of the University of Tsukuba. 2.2. Detection, sequence analysis and PCR products For the sequence analysis, the study adopted 100 Japanese (100 males), 93 Mongolians (81 males and 12 females), 88 CaucasianAmericans (33 males and 55 females), and 180 native American Colombians (87 males and 93 females). A heterozygote DNA samples from females were analyzed after separating it with polyacrylamide electrophoresis.

44

T. Nishi et al. / Legal Medicine 19 (2016) 43–46

We used the University of California, Santa Cruz (UCSC) Genome Browser (http://www.genome.ucsc.edu/) for the detection of several tetranucleotide repeats on the X chromosome. New primers were designed using PRIMER3 (http://www.genome.wi.mit. edu/cgi-bin/primer/primer3) software. PCR reactions were performed in a volume of 20 ll with a reaction mix containing 5–15 ng of genomic DNA, 2
AmpliTaq GoldÒ 360 Master Mix (Applied Biosystems) and a primer set. Primer sequences are listed in Table 1. The amplification conditions were optimised in a Veriti 96-well Thermal Cycler (Applied Biosystems) and consisted of initial denaturation at 95 °C for 10 min, followed by 28 cycles of denaturing at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s and a final extension at 72 °C for 7 min. PCR for sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Primers used for sequence analysis were the same as those used for PCR. Excessive dye was removed using the BigDye XTerminator Purification Kit (Applied Biosystems). The product was sequenced using the ABI 3130 Genetic Analyser (Applied Biosystems). 2.3. Base length analysis For the base length analysis, the study adopted 249 Japanese (150 males 99 females), 93 Mongolians (81 males and 12 females), 88 Caucasian-Americans (33 males and 55 females), and 180 native American Colombians (87 males and 93 females). PCR products were separated using an ABI 3130 Genetic Analyser (Applied Biosystems) in which 1 ll of PCR product was mixed with 14.5 ll of Hi-Di formamide and 0.5 ll of GeneScan-600LIZ size standard (Applied Biosystems). Gene Mapper ID software v3.2 (Applied Biosystems) was used to analyse the data. K562(8–13) and 9947(7–11/7–13) of human cell line DNA with alreadyknown repetition number confirmed by the sequence analysis were used as control. 2.4. Statistical analysis We calculated several forensic statistical parameters using previously described methods: polymorphism information content (PIC), homozygosity (h), heterozygosity (Het), power of exclusion (PE), power of discrimination (PD) in females and males and mean

Table 1 Primer sequences used in this study.

a

3. Results We identified a new tetranucleotide locus approximately 100 kbp downstream from DXS10011, which is located in the USCG Genome Browser GRCh38 X-chromosome 151,866,487 bp (accession number LC050343-LC50360). It was a combination of two tetranucleotide repeats, TGCC and TTCC. In four ethnic groups, this unique repeat showed 5–9 TGCC and 10–22 TTCC repeat units. The control sample, K562, carried (TGCC)8(TTCC)13 (Table 2) and 9947 carried (TGCC)7(TTCC)11 and (TGCC)7(TTCC)13. The analysis of DNA sequences and allele frequencies of four ethnic groups is shown in Table 3. The highest allele frequency for TGCC was of allele 8 in all ethnic groups. Allele 5 of TGCC was observed in Mongolians, Americans and Colombians but not in Japanese, and allele 9 was observed in Americans and Colombians. The frequencies of alleles 6, 7 and 8 of TGCC in Japanese, Americans and Colombians were approximately the same. In contrast, in Mongolians, the frequency of allele 6 was 0.2095 and that of allele 7 was 0.2857. TTCC in Japanese, Mongolians and Americans showed the highest frequency of approximately 0.5 for allele 15. The second highest frequency was 0.2 for allele 14. However, the allele frequencies of TTCC in Colombians differed sharply: 0.4249 for allele 14 and 0.3479 for allele 15. The TTCC allele numbers in Japanese and Mongolians widely ranged from 10 to 21. In contrast, it ranged in Americans from 10 to 18 and in Colombians from 12 to 16. Haplotype analysis of TGCC and TTCC is described in Table 4. (TGCC)8(TTCC)15 (0.27) showed the highest frequency in Japanese, followed by (TGCC)8(TTCC)14 (0.14), (TGCC)6(TTCC)15 (0.12) and (TGCC)7(TTCC)15 (0.11). The frequencies of TGCC-TTCC in Mongolians were (TGCC)8(TTCC)15 (0.2285), (TGCC)8(TTCC)14 (0.1333) and (TGCC)7(TTCC)15 (0.1142). These results of haplotype analysis were rarely different from each allele frequency. In Americans, (TGCC)8(TTCC)15 (0.2447) showed the highest frequency, followed by (TGCC)6(TTCC)15 (0.1258), (TGCC)6(TTCC)14 (0.0839). The combination of allele 8 with the highest frequency of TGCC and allele 14 with the second highest frequency of TTCC occurred in low frequency, 0.0559. The frequencies for TGCC–TTCC in Colombians were (TGCC)6(TTCC)14 (0.2454), (TGCC)8(TTCC)15 (0.2344) and (TGCC)8(TTCC)14 (0.1392). These exceeded the frequency of Table 3 Allele frequency of tetranucleotides in four ethnic populations.

Primers

Primer sequence

Position of the primer (bp)a

Forward Reverse

50 -TCTGACTACAGCACTTATCAAAGACA-30 50 -AAGGAGTTCACTTTCATCACGTC-30

15,18,66,358 15,18,66,658

Location on X-chromosome (USCG genome browser, GRCh38).

Table 2 Sequence of K562 control sample. Accession number LC050358 TCTGACTACAGCACTTATCAAAGACACTAGTTTCAGACTT TTAAACAAGATTCAGTCAGATTTTCTATGTAGATTATAAT AATGTCTGCAAATAAAGGGTTTTTATTTTTCTTTTTCAATC TACATGCTTGCCTGCCTGCCTGCCTGCCTGCCTGCCTGCC TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT CCTTCCTTCCTTCTTCTTCCCTTATTTTTCTTCTGGCTTTA TTGCAGTGGTTAGAATCTCTAGTACAATGTTAAATAGACG TGATGAAAGTGAACTCCTTATCTT

exclusion chance (MEC) for trios involving daughters and for father/ daughter duos lacking maternal genotype information [20–24].

Japanese n = 100 TGCC allele 5 6 0.280 7 0.180 8 0.540 9 TTCC allele 10 11 0.010 12 0.020 13 0.030 14 0.200 15 0.500 16 0.160 17 0.020 18 19 0.010 20 0.040 21 0.010

Mongolians n = 93

Americans n = 88

Columbians n = 180

0.038 0.210 0.286 0.467

0.014 0.287 0.182 0.490 0.028

0.004 0.315 0.168 0.484 0.029

0.010

0.007 0.014 0.028 0.077 0.210 0.462 0.126 0.056 0.021

0.011 0.088 0.425 0.348 0.121

0.010 0.019 0.257 0.438 0.171 0.010 0.010 0.019 0.038 0.019

0.004 0.004

45

T. Nishi et al. / Legal Medicine 19 (2016) 43–46 Table 4 Haplotype frequency. Japanese n = 100

Mongolians n = 93

Americans n = 88

Columbians n = 180

(TGCC)

(TTCC)

Frequency

(TGCC)

(TTCC)

Frequency

(TGCC)

(TTCC)

Frequency

(TGCC)

(TTCC)

Frequency

6 6 6 6 6 6 6 6 6 7 7 7 7 8 8 8 8 8 8

11 12 13 14 15 16 17 20 21 14 15 16 19 12 13 14 15 16 17

0.010 0.010 0.010 0.040 0.120 0.030 0.010 0.040 0.010 0.020 0.110 0.040 0.010 0.010 0.020 0.140 0.270 0.090 0.010

5 5 6 6 6 6 6 6 6 6 7 7 7 7 8 8 8 8 8 8 8

15 16 12 13 14 15 16 19 20 21 10 14 15 16 13 14 15 16 17 18 19

0.029 0.010 0.010 0.010 0.038 0.067 0.019 0.010 0.038 0.019 0.010 0.086 0.114 0.076 0.010 0.133 0.229 0.067 0.010 0.010 0.010

5 5 6 6 6 6 6 7 7 7 7 7 7 7 7 8 8 8 8 8 8 8 9 9

15 16 13 14 15 16 17 10 11 12 13 14 15 16 17 12 13 14 15 16 17 18 14 15

0.007 0.007 0.014 0.084 0.126 0.056 0.007 0.007 0.014 0.007 0.014 0.056 0.070 0.007 0.007 0.021 0.049 0.056 0.245 0.056 0.042 0.021 0.014 0.014

5 6 6 6 6 6 7 7 7 7 7 8 8 8 8 8 9 9

14 13 14 15 16 20 12 13 14 15 16 13 14 15 16 18 14 15

0.004 0.022 0.245 0.018 0.026 0.004 0.011 0.051 0.018 0.084 0.004 0.015 0.139 0.234 0.092 0.004 0.018 0.011

Table 5 Allele frequencies in four ethnic populations. Alleles

17 18 19 20 21 22 23 24 25 26 27

Japanese

Mongolians

Male n = 150

Female n = 99

All n = 249

Male n = 81

0.0067 0.0267

0.0029 0.0172

0.0123

0.0101

0.0667 0.1067 0.2000 0.4133 0.1267 0.0067 0.0333 0.0133

0.0707 0.0960 0.2222 0.4192 0.1465 0.0051 0.0303

Polymorphism information content (PIC) Homozygotie (h) Heterozygotie (HET) Power of Exclusion (PE) Paternity Index (PI) PD female PD male MEC Krüger MEC Kishida MEC Desmarais MEC Desmarais Duo

0.0690 0.1006 0.2126 0.4167 0.1379 0.0057 0.0316 0.0057

Americans Female n = 12 0.0417

0.0123 0.0617 0.1728 0.2593 0.2963 0.0864 0.0123 0.0617 0.0247

0.0833 0.1667 0.2917 0.3333 0.0417 0.0417

0.7140 0.2541 0.7459 0.5028 0.1271 0.9035 0.7459 0.5402 0.7139 0.7140 0.5778

(TGCC)6(TTCC)14, although (TGCC)6 and (TTCC)14 showed the highest frequency for each repeats TGCC and TTCC. The frequency of (TGCC)6(TTCC)15 was only 0.018, whereas (TGCC)6 and (TTCC)15 showed the second highest frequency for each repeats TGCC and TTCC. Although linkage disequilibrium was not confirmed among Japanese and Mongolians, it was observed among Americans and Columbians. Some special sequences were identified. The 12th TTCC of (TGCC)6(TTCC)20 in two samples was substituted by TCCC. The 13th TTCC of (TGCC)7(TTCC)19 in one sample was substituted by TCCC. We performed length analysis to apply this locus to DNA testing. The STR was found to be a simple tetranucleotide,

All n = 93 0.0095 0.0095 0.0095 0.0667 0.1714 0.2667 0.3048 0.0667 0.0190 0.0476 0.0286

Columbians

Male n = 33

Female n = 55

All n = 88

Male n = 87

Female n = 93

All n = 180

0.0909 0.2727 0.1212 0.3333 0.0909 0.0606 0.0303

0.0091 0.0182 0.0273 0.1364 0.2273 0.2000 0.2545 0.0727 0.0364 0.0182

0.0070 0.0140 0.0210 0.1259 0.2378 0.1818 0.2727 0.0769 0.0420 0.0210

0.0460 0.3103 0.0345 0.1839 0.3448 0.0805

0.0323 0.2903 0.0591 0.2796 0.2151 0.1129

0.0366 0.2967 0.0513 0.2491 0.2564 0.1026

0.0108

0.0073

0.7661 0.2060 0.7940 0.5879 0.1030 0.9297 0.7940 0.6057 0.7661 0.7661 0.6410

0.7860 0.1886 0.8114 0.6204 0.0943 0.9390 0.8114 0.6306 0.7860 0.7860 0.6651

0.7326 0.2304 0.7696 0.5439 0.1152 0.9099 0.7696 0.5530 0.7326 0.7326 0.5989

but its polymorphism was comparatively high. The results of base length analysis are shown in Table 5. 4. Discussion Although the TGCC–TTCC repeat sequence in the q28 region of the X chromosome is a simple tetranucleotide repeat, it exhibits considerable polymorphisms and is thus likely to be exceptionally useful for DNA testing. In addition, we found differences in DNA repeat numbers at this locus among ethnic groups. The difference at this locus, relative to other ethnic groups, was the increased

46

T. Nishi et al. / Legal Medicine 19 (2016) 43–46

frequency of the TGCC sequence in allele 7 for the Mongolians versus an increased frequency of the TTCC sequence in allele 14 for the Colombians. Additionally, there were differences in haplotype analysis of TGCC and TTCC polymorphisms among ethnic groups. Linkage disequilibrium was observed for the Americans and Colombians but not for the Japanese and Mongolians. Among all ethnic groups, the greatest differences in haplotype and allele frequency analyses were exhibited by the Colombians. Americans of Caucasian descent are classified as Caucasoid, and Japanese, Mongolians and native American Colombians are classified as Mongoloid in anthropology [25]. Colombians and Japanese are both Mongoloids but their allele frequencies and frequencies of haplotype groups differed greatly. With respect to the Columbians, considerable linkage disequilibrium was found and polymorphisms of the TTCC allele showed little spread, indicating a strong bias in allele frequency. This is because native Americans Columbian themselves may not have had much contact with other groups or more interbred with closely related relatives. Differences were found in the frequencies of both TGCC and TTCC among the four ethnic groups. However, (TGCC)8(TTCC)15 was common, indicating the possibility that the frequency of this polymorphism is high among all ethnic groups. Base length analysis revealed relatively large differences between polymorphisms and ethnicity-dependent frequencies, which could also be because of the linkage between the two repetitive sequences. Therefore that the novel X-STR locus described here will be useful for DNA testing and anthropological studies.

[6]

[7]

[8]

[9]

[10]

[11] [12]

[13]

[14]

[15]

[16]

[17]

Acknowledgement This work was supported by JSPS KAKENHI Grant Number 15H06632.

[18]

[19]

References [1] I. Ali, A. Rasheed, M.M. Saleem, A. Saeed, H. Rasheed, A. Nasih, et al., Allele frequencies of 15 STR loci using AmpF/STR Identifiler kit in the Maldivian population, Forensic Sci. Int. Genet. 6 (2012) e136. [2] O. Garcia, J. Alonso, J.A. Cano, R. Garcia, G.M. Luque, P. Martin, et al., Population genetic data and concordance study for the kits identifiler, NGM, PowerPlex ESX 17 system and investigator ESSplex in Spain, Forensic Sci. Int. Genet. 6 (2012) e78–e79. [3] N. Laurin, E. Milot, Population genetic data of the AmpFlSTR(R) Identifiler(R) Plus and PowerPlex(R) 16 HS STR loci in four Canadian populations, Int. J. Legal Med. 128 (2014) 277–278. [4] S. Flores, J. Sun, J. King, A. Eisenberg, B. Budowle, Allele frequencies for 15 autosomal STR loci and haplotype data for 17 Y-STR loci in a population from Belize, Int. J. Legal Med. (2014). [5] L.K. Hennessy, N. Mehendale, K. Chear, S. Jovanovich, S. Williams, C. Park, et al., Developmental validation of the GlobalFiler((R)) express kit, a 24-marker STR

[20]

[21]

[22]

[23]

[24] [25]

assay, on the RapidHIT((R)) system, Forensic Sci. Int. Genet. 13 (2014) 247– 258. L. Bing, W. Liang, J. Pi, D. Zhang, D. Yong, H. Luo, et al., Population genetics for 17 Y-STR loci(AmpFISTR(R)Y-filerTM) in Luzhou Han ethnic group, Forensic Sci. Int. Genet. 7 (2013) e23–e26. A.M. Gross, P. Berdos, J. Ballantyne, Y-STR concordance study between Y-Plex5, Y-Plex6, Y-Plex12, PowerplexY, Y-Filer, MPI, and MPII, J. Forensic Sci. 51 (2006) 1423–1428. J. Edelmann, S. Hering, C. Augustin, S. Kalis, R. Szibor, Validation of six closely linked STRs located in the chromosome X centromere region, Int. J. Legal Med. 124 (2010) 83–87. A. Zidkova, P. Capek, A. Horinek, P. Coufalova, Investigator(R) Argus X-12 study on the population of Czech Republic: comparison of linked and unlinked XSTRs for kinship analysis, Electrophoresis 35 (2014) 1989–1992. J. Edelmann, S. Hering, C. Augustin, R. Szibor, Characterisation of the STR markers DXS10146, DXS10134 and DXS10147 located within a 79.1 kb region at Xq28, Forensic Sci Int Genet 2 (2008) 41–46. J. Edelmann, R. Szibor, The X-linked STRs DXS7130 and DXS6803, Forensic Sci. Int. 136 (2003) 73–75. S. Hering, C. Augustin, J. Edelmann, M. Heidel, J. Dressler, H. Rodig, et al., DXS10079, DXS10074 and DXS10075 are STRs located within a 280-kb region of Xq12 and provide stable haplotypes useful for complex kinship cases, Int. J. Legal Med. 120 (2006) 337–345. T. Hundertmark, S. Hering, J. Edelmann, C. Augustin, I. Plate, R. Szibor, The STR cluster DXS10148-DXS8378-DXS10135 provides a powerful tool for Xchromosomal haplotyping at Xp22, Int. J. Legal Med. 122 (2008) 489–492. Q.L. Liu, H. Zhao, J.D. Chen, X.G. Wang, D.J. Lu, L. Quan, Development and population study of the 12 X-STR loci multiplexes PCR systems, Int. J. Legal Med. 126 (2012) 665–670. M. Israr, A.A. Shahid, Z. Rahman, M.S. Zar, M.S. Shahzad, T. Husnain, et al., Development and characterization of a new 12-plex ChrX miniSTR system, Int. J. Legal Med. 128 (2014) 595–598. T. Nishi, A. Kurosu, Y. Sugano, J. Kaminiwa, Y. Sekine, S. Yano, et al., Application of a novel multiplex polymerase chain reaction system for 12 X-chromosomal short tandem repeats to a Japanese population study, Leg. Med. (Tokyo) 15 (2013) 43–46. S. Elakkary, S. Hoffmeister-Ullerich, C. Schulze, E. Seif, A. Sheta, S. Hering, et al., Genetic polymorphisms of twelve X-STRs of the investigator Argus X-12 kit and additional six X-STR centromere region loci in an Egyptian population sample, Forensic Sci. Int. Genet. 11 (2014) 26–30. M. Samejima, Y. Nakamura, P. Nambiar, K. Minaguchi, Genetic study of 12 XSTRs in Malay population living in and around Kuala Lumpur using Investigator Argus X-12 kit, Int. J. Legal Med. 126 (2012) 677–683. C. Tomas, V. Pereira, N. Morling, Analysis of 12 X-STRs in Greenlanders, Danes and Somalis using Argus X-12, Int. J. Legal Med. 126 (2012) 121–128. D. Botstein, R.L. White, M. Skolnick, R.W. Davis, Construction of a genetic linkage map in man using restriction fragment length polymorphisms, Am. J. Hum. Genet. 32 (1980) 314–331. D. Desmarais, Y. Zhong, R. Chakraborty, C. Perreault, L. Busque, Development of a highly polymorphic STR marker for identity testing purposes at the human androgen receptor gene (HUMARA), J. Forensic Sci. 43 (1998) 1046–1049. T. Kishida, W. Wang, M. Fukuda, Y. Tamaki, Duplex PCR of the Y-27H39 and HPRT loci with reference to Japanese population data on the HPRT locus, Nihon Hoigaku Zasshi 51 (1997) 67–69. J. Kruger, W. Fuhrmann, K.H. Lichte, C. Steffens, On the utilization of erythrocyte acid phosphatase polymorphism in paternity evaluation, Dtsch. Z. Gesamte Gerichtl. Med. 64 (1968) 127–146. M. Nei, A.K. Roychoudhury, Sampling variances of heterozygosity and genetic distance, Genetics 76 (1974) 379–390. J.Z. Li, D.M. Absher, H. Tang, A.M. Southwick, A.M. Casto, S. Ramachandran, et al., Worldwide human relationships inferred from genome-wide patterns of variation, Science 319 (2008) 1100–1104.