Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a

+

MODEL

Journal of the Formosan Medical Association (2017) xx, 1e8

Available online at www.sciencedirect.com

ScienceDirect journal homepage: www.jfma-online.com

Original Article

Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a Min-Ching Wang a,b, Li-Yin Yeh c, Wen-Yu Shih a,b, Wan-Chun Li c, Kuo-Wei Chang a,b,c,*, Shu-Chun Lin c,** a

Department of Stomatology, Taipei Veterans General Hospital, Taipei, Taiwan Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan c Institute of Oral Biology, School of Dentistry, National Yang-Ming University, Taipei, Taiwan b

Received 29 March 2017; received in revised form 21 April 2017; accepted 25 April 2017

KEYWORDS Portland cement; Bioaggregate; miR-146a; Osteogenic differentiation; Periodontal ligament (PDL)

Abstract Background/Purpose: Bioaggregates such as Portland cement (PC) can be an economical alternative for mineral trioxide aggregate (MTA) with additional benefit of less discoloration. MTA has been known to induce differentiations of several dental cells. MicroRNAs are important regulators of biological processes, including differentiation, physiologic homeostasis, and disease progression. This study is to explore how PC enhances the differentiation of periodontal ligament (PDL) cells in microRNAs level. Methods: PDL cells were cultured in a regular PC- or MTA-conditioned medium or an osteoinduction medium (OIM). Alizarin red staining was used to evaluate the extent of mineralization. Transfection of microRNA mimics induced exogenous miR-31 and miR-146a expression. The expression of microRNAs and differentiation markers was assayed using reverse-transcriptase polymerase chain reaction. Results: PC enhanced the mineralization of PDL cells in a dose-dependent manner in the OIM. Exogenous miR-31 and miR-146a expression upregulated alkaline phosphatase (ALP), bone morphogenic protein (BMP), and dentin matrix protein 1 (DMP1) expression. However, miR31 and miR-146a modulates cementum protein 1 (CEMP1) expression in different ways. PC also enhanced ALP and BMP but attenuated CEMP1 in the OIM. Although the OIM or PC treatment upregulated miR-21, miR-29b, and miR-146a, only miR-146a was able to be induced by PC in combination with OIM.

* Corresponding author. Department of Dentistry, National Yang-Ming University, No. 155, Li-Nong St., Sec. 2, Taipei 112, Taiwan. Fax: þ886 2 28264053. ** Corresponding author. Institute of Oral Biology, National Yang-Ming University, No. 155, Li-Nong St., Sec. 2, Taipei 112, Taiwan. Fax: þ886 2 28264053. E-mail addresses: [email protected] (K.-W. Chang), [email protected] (S.-C. Lin). http://dx.doi.org/10.1016/j.jfma.2017.04.022 0929-6646/Copyright ª 2017, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022

+

MODEL

2

M.-C. Wang et al. Conclusion: This study demonstrated that PC enhances the differentiation of PDL cells, especially osteogenic through miR-146a upregulation. In order to control the ankylosis after regenerative endodontics with the usage of bioaggregates, further investigations to explore these differentiation mechanisms in the miRNA level may be needed. Copyright ª 2017, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).

Introduction

Methods

Bioaggregate such as mineral trioxide aggregate (MTA) and Portland cement (PC) has been proven to be an ideal obturation material because of the properties of excellent sealing ability and antimicrobial effect.1,2 Regenerative endodontics with bioaggregate application can help with the continuation of root development in immature permanent teeth with apical lesions. Therefore, bioaggregate may be not only biocompatible but also bioinductive. Growing roots have been proven to contain cementum and cementoblasts; therefore, bioaggregate might enhance the differentiation of periodontal tissue.3,4 Bioaggregate, like mineral trioxide aggregate (MTA) induces proliferation and migration and elevates osteogenic factors in dental pulp cells.5e7 It has been observed to affect the proliferation and adhesion of periodontal ligament fibroblast8,9 and induce the biomineralization of cementoblasts.10 MTA has also been proven to enhance the osteogenesis with Runx2 in osteoblasts.11 In addition, Runx2 mRNA expression was also detected in MTA-treated periodontal ligament fibroblasts.9 Nevertheless, the effects and mechanisms of MTA on modulating the differentiation of periodontal ligament (PDL) cells are unclear,12 and there are not enough studies to address these effects from other kinds of bioaggregate such as Portland cement (PC). PC has been demonstrated to show comparable results to MTC, which makes PC a less expensive alternative for the aforementioned regenerative endodontic procedure.13 Furthermore, MTA is known to cause discoloration, while Portland cement (PC) exhibits better color durability because it lacks bismuth ions and potassium ions.14e16 MicroRNA is a small noneprotein-coding RNA molecule that regulates physiologic homeostasis and disease progression by downregulating target genes in various cell types.17 MicroRNAs also regulate inflammatory or repair processes in several dental tissue types and may play a role in periodontal diseases.17e19 Our previous study specified that miR146a promotes the differentiation of PDL cells by controlling the NFkB regulatory circuit.20 miR-29b decreases the extracellular matrix of PDL cells.21 miR-21 is downregulated during the differentiation of PDL cells.22 Interestingly, the Runx2-miR-31-SATB2 regulatory loop regulates the osteogenic differentiation of dental follicle cells and other cells.23,24 Lipopolysaccharide elicits miR-146a upregulation in dental pulp cells.17 In addition, microRNA alters odontogenesis as let-7 targets dentine matrix protein 1 (DMP1) in dental pulp cells.25 However, to our knowledge, no literature exists regarding the relationships between these bioaggregates and microRNAs in dental mesenchymal cells. Therefore, this research was aimed to demonstrate how PC enhances the differentiation of PDL cells in miRNA level.

Cell culture PDL cells were isolated from PDL and cultured in low (1 mg/ mL) glucose Dulbecco’s Modified Eagle Medium (DMEM; Biological Industries, Kibbutz Beit Haemek, Israel) supplemented with 10% heat-inactivated fetal calf serum (Biological Industries), 1% L-glutamine, and penicillin G/ streptomycin sulfate/amphotericin B at 37  C in a humidified atmosphere of 5% CO2 incubator.20 To induce differentiation, cells were cultured in an osteoinduction medium (OIM, DMEM supplemented with 10 mM b-glycerophosphate, 50 mg/mL L-ascorbic acid, and 100 nM dexamethasone) for 7, 14, or 21 days.17 The medium was changed every 2 days. All the cells analyzed were grown within the 10th passage. This study was approved by the institutional review board (IRB approval number: 2012-08-009BCY).

Reagents MTA and PC were purchased from Dentsply (ProRoot toothcolored; Dentsply Endodontics, Tulsa OK) and Medcom GmbH (Weinfelden, Switzerland), respectively. MTA has been recognized insoluble material,26 but it has been demonstrated that MTA solution could be used to experiment the reaction between the bioactive component of MTA and the dental cells.10 Aliquots of a stock solution containing 20 mg/mL MTA and PC in serum-free DMEM were used for the experiments.10 MTA and PC powder was added to DMEM solution and then the solution was vortexed until completely suspended. In order to make the bioactive component release to the solution, the solution was incubated for 7 days at 37  C in a humidified atmosphere of 5% CO2 incubator. Then, the solution was filtered, and the supernatant was used for further cell culture.9 Chemically modified miR-31 and miR-146a mimic and scramble (Scr) controls were purchased from Applied Biosystems (Grand Island, NY). Cells were transfected with 60 nM microRNAs mimic for 2 or 5 days using transfectin (BioRad, Hercules, CA) to induce exogenous microRNA expression. Unless specified, all other materials were purchased from SigmaeAldrich (St. Louis, MO).

Cell viability For cell growth, we used a 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) assay (SigmaeAldrich).10,27 Briefly, cells were plated at a density of 4000 cells per well in the 96-well dish (Corning Incorporated, Corning, NY) for 1, 5, 7 or 14 days. 1 mg/mL MTT was added

Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022

+

MODEL

PC induces miR-146a and PDL differentiation to cultivated cells for 4 h until the purple precipitate was visible. Then, all reagents were removed, and 100 mL DMSO was added to dissolve the purple precipitate. After agitation for 5 min, the solution was transferred to 96-well plate (Corning) for further spectrophotometry evaluation. A colorimetric detection of 570 nm was assessed. The values were plotted as curves for comparing cell proliferation. The average of the three values obtained from the test solution was calculated for statistical analysis. Cells were also plated on 6-well plates (Corning) and grew for 0, 1 and 3 days to visualize their morphology.

Alizarin red staining Cells were fixed with 4% paraformaldehyde in PBS for 30 min and then stained with 500 mL 2% Alizarin red (SigmaeAldrich) for 30 min at room temperature. The cells were washed and dried to allow for the appearance of color.20,27 In addition, mineralization was measured by extracting calcified mineral using 100 mL 10% acetic acid and was neutralized with ammonium hydroxide. Then, 100 mL test solution was transferred to 96-well culture plate (Corning) to read the absorbance with three replicate. The result was statistically analyzed from the average value of the three replicate. The colorimetric detection was set at 405 nm.

3 dehydrogenase (GAPDH ) was used as control. The complementary DNA (cDNA) was synthesized from 1 mg total RNA using MMLV reverse transcriptase (Bioneer Corp., Daejeon, Korea). The primer pair sequences are listed in Table 1. The reaction without a cDNA input served as a negative control. PCR reaction was carried out at 95  C for 5 min followed 35 cycles of 95  C for 60 s, annealing temperature (GAPDH at 56  C, ALP at 48.9  C, BMP2 at 52.2  C, CEMP1 at 51.8  C, and DMP1 at 47.8  C) for 60 s, 72  C for 60 s followed via final extension at 72  C for 10 min. Following amplification, PCR products were separated 2% agarose gels and visualized using ethidium bromide fluorescence, the signals were detected using a transilluminator (Viber Loumat; Marne-la-Vallee, France). The expression level was designed using signal intensities for the tested genes that were normalized with a GAPDH signal.

Statistical analysis The ManneWhitney test and two-way ANOVA test were used to compare differences among variants, and differences were considered significant with a p of <0.05.

Results MTA and PC were not cytotoxic to PDL cells

qRT-PCR analysis The expression levels of miR-21, miR-29b, miR-31, and miR146a were determined by TaqMan microRNA quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) with the reagents supplied by Applied Biosystems. First, total RNAs were converted into cDNAs using by TaqMan microRNA reverse transcription kit. For each sample, a 7.5 mL reaction was set up on the ice having 5 mL of RT master mix (containing 0.075 mL dNTPs, 0.5 mL multiscribe RT enzyme, 0.75 mL 10X RT buffer, 0.095 mL RNase inhibitor), 1.5 mL of specific reverse primer and 2.5 mL of total RNA. Reaction tubes were incubated at 16  C for 30 min, 42  C for 30 min and at 85  C for 5 min. Next, 7.5 mL of the product from the RT reaction was combined with 2.2 mL of a 20X TaqMan MicroRNA Assay solution (containing forward primer, reverse primer, and probe), 22 mL of 2X TaqMan PCR Master Mix (TOYOBO, Osaka, Japan) and 12.3 mL of 3dH2O to a total volume of 44 mL. An aliquot of 20 mL mixture was then subjected to PCR reaction in duplicate. PCR reaction was performed following the standard TaqMan microRNA assays protocol. Cycling conditions at 95  C for 10 min, followed by a total of 40 cycles of 95  C for 15 s and 60  C for 60 s.28 RNU6B small RNA served as a control. The relative changes in expression were measured using a comparative threshold cycle (Ct) method; 2DDCt represented a fold change in expression.20

RT-PCR analysis The mRNA expression of Alkaline phosphatase (ALP), Bone morphogenetic protein 2 (BMP2), Cementum protein 1 (CEMP1), and Dentin matrix protein 1 (DMP1) was determined using RT-PCR analysis. Glyceraldehyde 3-phosphate

In the PDL9-1 and PDL14 primary periodontal ligaments, DMEM had no adverse effect on growth for 14 days, specifically between cells treated with 2 mg/mL MTA or PC and control cells (Fig. 1A). Similarly, in cells cultivated in OIM for 3 days, neither MTA nor PC had an influence on the viability or morphology of PDL9-1 cells (Fig. 1B). The vast majority of cells were attached to cell culture plates, and only a few cells floated in the medium. The morphology of PDL14 cells was not shown. The results suggested that both MTA and PC were not cytotoxic to PDL cells in the tested concentrations.

Portland cement enhanced the mineralization of PDL cells To identify the effects of PC on PDL cells, we continuously cultivated PDL9-1 cells in OIM containing 0e2 mg/mL PC for 7, 14, or 21 days. On day 7, PDL cells had differentiated and had less of a spindle shape, with a more flattened morphology and more intimate cell contact following an increase in PC concentration (Fig. 2A). On day 14, there was a remarkable increase in mineralized structures following an increase in PC concentration (Fig. 2B). To quantitate the mineralization effect of PC, we utilized an Alizarin red staining assay. The calcified minerals increased with the PC concentration and cultivation duration (Fig. 2C). Although the 21-day cultivation in the OIM medium was able to increase mineralization, the 14-day cultivation was not sufficient to induce mineralization. However, in the presence of PC, we observed significantly increased mineralization in the PDL cell on day 14. Furthermore, the increased PC concentration increased the mineralization in a dosedependent manner.

Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022

+

MODEL

4

M.-C. Wang et al. Table 1

Primers used in the present study.

Genes

Direction

Sequence

ALP (Alkaline phosphatase) ENSG00000162551 BMP2 (Bone morphogenetic protein 2) ENSG00000125845 CEMP1 (Cementum protein 1) ENSG00000205923 DMP1 (Dentin matrix protein 1) ENSG00000152592 GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) ENSG00000111640

F R F R F R F R F R

GCACCGCCACCGCCTACC CCACAGATTTCCCAGCGTCCTTG CACTGTGCGCAGCTTCC CCTCCGTGGGGATAGAACTT ATGGGCACATCAAGCACTGA CCCCATTAGTGTCATCCTGC AAAATTCTTTGTGAACTACGGAGG GAGCACAGGATAATCCCCAA TGGTATCGTGGAAGGACTCATGAC ATGCCAGTGAGCTTCCCGTTCAGC

Figure 1 The growth and morphology of PDL cells treated with MTA or PC. (A) Cell proliferation in DMEM assessed using an MTT assay. Upper, PDL9-1; Lower, PDL14. The data shown are mean  SE. ns, not significant; two-way ANOVA test. (B) The morphology of PDL9-1 cultured with OIM, OIM plus 2 mg/mL PC, or OIM plus 2 mg/mL MTA for 0, 1, and 3 days. Bar, 100 mm, 50. D, day; MTA, mineral trioxide aggregate; OIM, osteoinduction medium; PC, Portland cement.

miR-31 and miR-146a expression increased the expression of differentiation markers miR-21, miR-29b, miR-31, and miR-146a are involved in the osteogenic differentiation and mineralization of dental mesenchymal cells.20e22,24 We investigated if these microRNAs could contribute to the expression of differentiation markers if PDL cells were cultured in a regular medium. Two days after the transfection of microRNA mimics, we noted a drastic increase in miR-31 and miR-146a expression in the PDL9-1 cells (Fig. 3A). Fig. 3B illustrates the mRNA expression of various markers on days 2 and 5 following microRNAs induction. The quantification revealed that both miR-31 and miR-146a consistently increased the expression of ALP, which peaked on day 5. Both miR-31 and miR-146a increased BMP2 on day 5, but the BMP2 expression was not

changed on day 2. miR-31 induced the expression of cementum marker CEMP1 and dentine marker DMP1 that peaked on day 5. However, miR-146a expression reduced CEMP1 on day 5 and slightly increased DMP1 (Fig. 3C). The data implicate that different microRNAs may modulate the expression of markers through different regulatory cascades in PDL cells.

Portland cement induced PDL cell differentiation by upregulating miR-146a PDL9-1 and PDL14 cells cultivated in a regular medium were treated with 1 mg/mL PC for 1 or 2 days. qRT-PCR analysis revealed that miR-21, miR-29b, and miR-146a were upregulated to different extents in both cells (Fig. 4A).

Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022

+ PC induces miR-146a and PDL differentiation

MODEL

5

Figure 2 Portland cement enhances the mineralization of PDL cells. (A) The morphology of PDL9-1 cells cultivated in DMEM, OIM, or OIM plus PC for 7 days or 14 days. Bar, 100 mm, (B) Pictures of PDL9-1 cells stained with Alizarin red in culture dishes. Cells are cultured in DMEM, OIM, or OIM plus PC for 14 days or 21 days. A duplicate analysis of each setting in a 12-well dish is shown. (C) Quantitation of Alizarin red staining in (B) using a spectrophotometer. The data shown are mean  SE. ns, not significant; ***, p < 0.001; ManneWhitney test. D, day; OIM, osteoinduction medium; PC; Portland cement.

Figure 3 Exogenous miR-31 and miR-146a expression modulate the expression of differentiation markers. (A) qRT-PCR analysis. Treatment with microRNA mimics tremendously induces miR-31 and miR-146a expression in relation to scramble (Scr) control. The data shown are mean  SE. ***, p < 0.001; ManneWhitney test. (B) RT-PCR analysis to detect the mRNA expression of ALP, BMP2, CEMP1, and DMP1 in PDL9-1 cells following exogenous miR-31 and miR-146a expression for 2 or 5 days. (C) The quantitation of the normalized values in (B). D, day; Scr, scramble control. Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022

+

MODEL

6

M.-C. Wang et al.

Figure 4 Portland cement enhances PDL cell differentiation by upregulating miR-146a. (A) qRT-PCR analysis of the microRNA expression in PDL9-1 cell and PDL14 cell following 2 mg/mL PC treatment for 2 days in DMEM. (B) RT-PCR analysis detected the mRNA expression of ALP, BMP2, CEMP1, and DMP1 in PDL9-1 cells with the treatment of DMEM, OIM or OIM plus PC for 14 or 21 days. (C) The quantitation of normalized values in (B). (D, E) A qRT-PCR analysis detected miR-21, miR-29b, miR-31 and miR-146a expression. (D) Comparison between PDL9-1 cells cultured in DMEM and OIM for 21 days. (E) Comparison between PDL9-1 cells cultured in OIM for 21 days with PC or without PC. Data in (A, D, E) are mean  SE. ns, not significant; *, p < 0.05; **, p < 0.01; ***, p < 0.001; ManneWhitney test. D, day; OIM, osteoinduction medium; PC; Portland cement.

However, the expression of miR-31 was not affected by the PC treatment. PDL9-1 cells were continuously cultured in OIM or OIM plus PC for 14 or 21 days to induce differentiation (Fig. 4B). On days 14 and 21, OIM increased ALP expression, and it was further increased if combined with PC. OIM slightly increased BMP2 expression, which was also mildly increased by PC (Fig. 4C). OIM increased CEMP1 expression that was then decreased by PC. PC drastically increased DMP1 expression if cells were cultured in OIM for 21 days. Cultivating the cells in OIM for 21 days significantly increased miR-21, miR-29b, miR-31, and miR-146a expression (Fig. 4D). However, the presence of PC in OIM significantly decreased miR-21 and miR-29b expression. PC did not affect miR-31 expression, but it significantly increased miR-146a expression (Fig. 4E). Therefore, with PC treatment, miR-146a could be a mediator of cell differentiation in PDL cells.

Discussion Previously, it has been shown that there is a lack of discrepancy between PC and MTA regarding their influence on cell growth and cytotoxicity in PDL cells.8 The current study demonstrated that the effect of PC to enhance PDL

cell differentiation and the induction of miR-146a drove such effects. A previous study revealed that MTA provided a better environment for periodontal fibroblast survival and growth in an experimental root perforation, as compared with Amalgam, IRM, and other materials.9 In this study, PC showed similar effects with MTA on cell viability. The proliferation of cells following the treatment with both materials was stable, and no morphology change was noted. The MTT assay further quantified the result of the proliferation at different time points, and the growth curves of both MTA and PC showed comparable trends. Alizarin red can be used to demonstrate the mineralization potential of the materials like MTA29 and mineral nodule formation has been observed in MTA-treated cementoblasts.10 There is similar mineral nodule formation in PC-treated PDL cells being notified in this study. With a higher concentration of PC, higher amount of mineralization appeared, and the results after quantification further confirmed the observation. As the cultivation time increased, PC could induce more mineralization content. Bioaggregates have been proven to induce the differentiation of dental pulp cells.7 We demonstrated that PC enhanced the mineralization and expression of differentiation markers in PDL cells, especially osteogenic

Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022

+

MODEL

PC induces miR-146a and PDL differentiation differentiation marker. In the previous fibroblast study, ALP tends to be the most potent marker for OIM- or PC-induced differentiation.12 Similar condition was identified in this study; the presence of PC additively increased the OIMinduced upregulation of ALP in a long-term PDL cell culture. As CEMP1 attenuates the osteoblastic differentiation of PDL cells,30 we observed decreased CEMP1 associated with the PC treatment in the long-term OIM culture that appeared concordant with osseous differentiation. During long-term cultivation, DMP1 expression was gradually attenuated. PC provoked DMP1 expression that may further support the strength of PC in enhancing differentiation. The expression of osteogenic differentiation marker is stronger than odontogenic and cementogenic differentiation markers in the PC-treated PDL cells. In order to explore the underlying mechanisms of the osteogenic differentiation in the PC-treated PDL cells, several osteogenic differentiation or PDL cells related miRNAs were analyzed. miR-31 modulates the differentiation of bone marrow stem cells and dental follicle cells.23,24 We identified that OIM may slightly upregulate miR-31 expression, and miR-31 elicited the tremendous upregulation of miR-31 expression that increased the expression of all markers. However, as PC is unable to modulate the miR31 expression level, it is unlikely that miR-31 is involved in PC-induced PDL cell differentiation. Although PC upregulated miR-21 and miR-29b in regular cultivation, they were also upregulated by OIM; OIM and PC significantly repressed their expression. The mechanism underlying such ambiguity is unclear. We noted the upregulation of miR-21 by OIM in this study; however, this finding conflicts with the findings of a previous study,22 and further studies may be required to clarify these differences. miR-146a has been proven to regulate the differentiation of PDL cells.20 This study further demonstrated the profound upregulation of ALP, BMP2, and DMP1 and the downregulation of CEMP1 after vigorous miR-146a expression in a regular culture. Apart from this regulation, we noted that treatment with OIM, PC, and OIM plus PC were able to consistently upregulate miR-146a to different extents. As exogenous miR-146a expression seemed to direct PDL cells more toward osteogenic than cementogenic differentiation, miR-146a could be a key regulator in PCinduced differentiation of PDL cells. A study showed that MTA-induced osteogenic differentiation was mediated by NFkB activation in apical papilla stem cells.31 As miR-146a is a microRNA upregulated by NFkB activity,20 it is likely that PC elicits NFkB activation, leading to PDL differentiation as a result of miR-146a upregulation, which further potentiates PDL cell the differentiation. Besides, miR-146a has been demonstrated to suppress IRAK1 and TRAF6 to regulate NFkB pathway in PDL cells. Since NFkB pathway is a central inflammatory pathway,20 further studies are needed to elucidate the potential anti-inflammatory benefit of PC. Regeneration of dental pulp and PDL cells can be achieved with bioaggregate.3,9,10,32 Bioaggregate can stimulate osteogenic potential in different kinds of dental tissues. The osteogenic potential of MTA has been reported in human dental pulp stem cells.29 In this PC-treated PDL cell study, the expression of osteogenic differentiation marker is also stronger, and mineral nodules is observable.

7 However, growth of bone tissue in the root canal may lead to ankylosis in regenerative endodontics,3,33 and the tissue formed in the root canal after revascularization could be periodontal ligament or cementum-like tissue rather than dentin-like tissue.33 Therefore, in order to have better understanding of regenerative endodontics and perhaps prevent further ankylosis, it is crucial to analyze how bioaggregate control osteogenic-differentiation of dental pulp and periodontal tissues. As for possible mechanisms, in this study we demonstrated that PC enhances differentiation by upregulating miR-146a which may be also advantageous for PDL cell differentiation with other factors.20 There is no previous study to explore bioaggregate in the miRNA level. This study provides new clues that PC-miR-146a cascade in facilitating PDL repair may lead to potential clinical applications. Further studies are required to link these aspects. Portland cement can induce the differentiation of PDL cells which may be similar to the reactions with MTA. The PC-induced differentiation in PDL cells may be controlled by miR-146a. However, the osteogenic differentiation is stronger than cementogenic differentiation in these PCtreated PDL cells. These results may explain the mechanisms of ankylosis in some clinical scenarios, which could provide clues for further clinical strategies.

Conflict of interest All authors have no conflicts of interest relevant to this article.

Acknowledgements This study was supported by a grant 99TPECH06 from Taipei Veterans General Hospital and an Oral Health Promotion grant from the Association for Dental Sciences of The Republic of China.

References 1. Darvell BW, Wu RCT. “MTA”dan hydraulic silicate cement: review update and setting reaction. Dent Mater 2011;27: 407e22. 2. Prati C, Gandolfi MG. Calcium silicate bioactive cements: biological perspectives and clinical applications. Dent Mater 2015; 31:351e70. 3. Saoud TM, Zaazou A, Nabil A, Moussa S, Aly HM, Okazaki K, et al. Histological observations of pulpal replacement tissue in immature dog teeth after revascularization of infected pulps. Dent Traumatol 2015;31:243e9. 4. Katsamakis S, Slot DE, Van der Sluis LW, Van der Weijden F. Histological responses of the periodontium to MTA: a systematic review. J Clin Periodontol 2013;40:334e44. 5. Takita T, Hayashi M, Takeichi O, Ogiso B, Suzuki N, Otsuka K, et al. Effect of mineral trioxide aggregate on proliferation of cultured human dental pulp cells. Int Endod J 2006;39:415e22. 6. Asgary S, Nazarian H, Khojasteh A, Shokouhinejad N. Gene expression and cytokine release during odontogenic differentiation of human dental pulp stem cells induced by 2 endodontic biomaterials. J Endod 2014;40:387e92. 7. Zhao X, He W, Song Z, Tong Z, Li S, Ni L. Mineral trioxide aggregate promotes odontoblastic differentiation via mitogen-

Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022

+

MODEL

8

8.

9.

10.

11.

12. 13.

14.

15.

16.

17.

18.

19.

20.

21.

M.-C. Wang et al. activated protein kinase pathway in human dental pulp stem cells. Mol Biol Rep 2012;39:215e20. Samara A, Sarri Y, Stravopodis D, Tzanetakis GN, Kontakiotis EG, Anastasiadou E. A comparative study of the effects of three root-end filling materials on proliferation and adherence of human periodontal ligament fibroblasts. J Endod 2011;37:865e70. Hakki SS, Bozkurt SB, Ozcopur B, Purali N, Belli S. Periodontal ligament fibroblast response to root perforations restored with different materials: a laboratory study. Int Endod J 2012;45:240e8. Hakki SS, Bozkurt SB, Hakki EE, Belli S. Effects of mineral trioxide aggregate on cell survival, gene expression associated with mineralized tissues, and biomineralization of cementoblasts. J Endod 2009;35:513e9. Perinpanayagam H, Al-Rabeah E. Osteoblasts interact with MTA surfaces and express Runx2. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;107:590e6. Bonson S, Jeansonne BG, Lallier TE. Root-end filling materials alter fibroblast differentiation. J Dent Res 2004;83:408e13. Saidon J, He J, Zhu Q, Safavi K, Spangberg LS. Cell and tissue reactions to mineral trioxide aggregate and Portland cement. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2003;95:483e9. Lenherr P, Allgayer N, Weiger R, Filippi A, Attin T, Krastl G. Tooth discoloration induced by endodontic materials: a laboratory study. Int Endod J 2012;45:942e9. Jacobovitz M, de Lima RK. Treatment of inflammatory internal root resorption with mineral trioxide aggregate: a case report. Int Endod J 2008;41:905e12. Marciano MA, Oda DF, Maenosono RM, Cavenago BC, Midena RZ, Minotti PG, et al. Radiopacity, tooth discoloration and calcium release of Portland-based cements. Dent Mater 2014;30:e163e4. Wang MC, Hung PS, Tu HF, Shih WY, Li WC, Chang KW. Lipopolysaccharide induces the migration of human dental pulp cells by up-regulating miR-146a. J Endod 2012;38:1598e603. Gong Q, Wang R, Jiang H, Lin Z, Ling J. Alteration of microRNA expression of human dental pulp cells during odontogenic differentiation. J Endod 2012;38:1348e54. Kebschull M, Papapanou PN. Mini but mighty: microRNAs in the pathobiology of periodontal disease. Periodontol 2000 2015; 69:201e20. Hung PS, Chen FC, Kuang SH, Kao SY, Lin SC, Chang KW. miR146a induces differentiation of periodontal ligament cells. J Dent Res 2010;89:252e7. Chen Y, Mohammed A, Oubaidin M, Evans CA, Zhou X, Luan X, et al. Cyclic stretch and compression forces alter microRNA-29

22.

23.

24.

25. 26.

27.

28.

29.

30.

31.

32.

33.

expression of human periodontal ligament cells. Gene 2015; 566:13e7. Li C, Li C, Yue J, Huang X, Chen M, Gao J, et al. miR-21 and miR-101 regulate PLAP-1 expression in periodontal ligament cells. Mol Med Rep 2012;5:1340e6. Deng Y, Wu S, Zhou H, Bi X, Wang Y, Hu Y, et al. Effects of a miR-31, Runx2, and Satb2 regulatory loop on the osteogenic differentiation of bone mesenchymal stem cells. Stem Cells Dev 2013;22:2278e86. Ge J, Guo S, Fu Y, Zhou P, Zhang P, Du Y, et al. Dental follicle cells participate in tooth eruption via the RUNX2-MiR-31-SATB2 loop. J Dent Res 2015;94:936e44. Yue J, Wu B, Gao J, Huang X, Li C, Ma D, et al. DMP1 is a target of let-7 in dental pulp cells. Int J Mol Med 2012;30:295e301. Torabinejad M, Hong CU, Pitt Ford TR, Kettering JD. Cytotoxicity of four root end filling materials. J Endod 1995;21: 489e92. Hebling J, Bianchi L, Basso FG, Scheffel DL, Soares DG, Carrilho MR, et al. Cytotoxicity of dimethyl sulfoxide (DMSO) in direct contact with odontoblast-like cells. Dent Mater 2015; 31:399e405. Singh J, Mukhopadhyay CS, Kaur S, Malhotra P, Sethi RS, Choudhary RK. Identification of the microRNA repertoire in TLR-ligand challenged bubaline PBMCs as a model of bacterial and viral infection. PLoS One 2016;11:e0156598. Bortoluzzi EA, Niu LN, Palani CD, El-Awady AR, Hammond BD, Pei DD, et al. Cytotoxicity and osteogenic potential of silicate calcium cements as potential protective materials for pulpal revascularization. Dent Mater 2015;31:1510e22. Komaki M, Iwasaki K, Arzate H, Narayanan AS, Izumi Y, Morita I. Cementum protein 1 (CEMP1) induces a cementoblastic phenotype and reduces osteoblastic differentiation in periodontal ligament cells. J Cell Physiol 2012;227:649e57. Yan M, Wu J, Yu Y, Wang Y, Xie L, Zhang G, et al. Mineral trioxide aggregate promotes the odonto/osteogenic differentiation and dentinogenesis of stem cells from apical papilla via nuclear factor kappa B signaling pathway. J Endod 2014;40: 640e7. D’Anto V, Di Caprio MP, Ametrano G, Simeone M, Rengo S, Spagnuolo G. Effect of mineral trioxide aggregate on mesenchymal stem cells. J Endod 2010;36:1839e43. Becerra P, Ricucci D, Loghin S, Gibbs JL, Lin LM. Histologic study of a human immature permanent premolar with chronic apical abscess after revascularization/revitalization. J Endod 2014;40:133e9.

Please cite this article in press as: Wang M-C, et al., Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a, Journal of the Formosan Medical Association (2017), http://dx.doi.org/10.1016/j.jfma.2017.04.022