- Email: [email protected]
Psoriasin (S100A7) is a positive regulator of survival and invasion of prostate cancer cells
Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Original article
Psoriasin (S100A7) is a positive regulator of survival and invasion of prostate cancer cells1 Lin Ye, Ph.D.*, Ping-Hui Sun, B.Sc., Tracey A. Martin, Ph.D., Andrew J. Sanders, Ph.D., Malcolm D. Mason, M.D., Wen G. Jiang, M.D. Metastasis and Angiogenesis Research Group, Institute of Cancer and Genetics, Cardiff University School of Medicine, Heath Park, Cardiff, UK Received 24 February 2012; received in revised form 11 May 2012; accepted 14 May 2012
Abstract Objectives: Psoriasin, also known as S100A7 and first identified as a protein highly expressed in psoriatic lesions, is a calcium binding protein that has been indicated in various malignancies. The current study aimed to examine the implication of psoriasin in prostate cancer (CaP), particularly its impact on functions of CaP cells. Materials and methods: Expression of psoriasin was examined in a variety of prostatic cell lines and human CaP tissues using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemistry, respectively. Knockdown and overexpression of psoriasin in CaP cells was performed using specifically constructed plasmids, which either had an anti-psoriasin ribozyme transgene or the full-length human S100A7 coding sequence. The effects of manipulating psoriasin expression on cellular functions of CaP cells were assessed using in vitro assays. Results: Psoriasin was expressed in prostate epithelia and cancer cells. Elevated expression of psoriasin was evident in CaP from its IHC staining in CaP frozen specimens. Psoriasin promoted cell survival under serum starvation. Its expression was inversely correlated with cell-matrix adhesion. Psoriasin increased invasiveness of PC-3 cells via a regulation of matrix metalproteinases (MMPs). Conclusions: Aberrant expression of psoriasin is implicated in CaP. Its expression in CaP cells is associated with cell survival, adhesion, and in vitro invasion, which is via the regulation of MMPs. © 2013 Elsevier Inc. All rights reserved. Keywords: Psoriasin; Prostate cancer; Apoptosis; Invasion; Matrix metalloproteinase
1. Introduction Psoriasin, also known as S100A7, is a member of S100 calcium binding proteins. It was first identified as a protein highly up-regulated in psoriatic epidermis [1]. To date, there are 21 S100 proteins identified in human, of which 17 are tightly clustered in a region of the human 1q21 chromosome [2,3]. They are widely expressed in various cell types and are localized in the cytoplasm and/or nucleus of the cell and, in some cases, are found to be secreted. These calcium binding and signaling proteins are involved in the regulation of cell proliferation, apoptosis,
1
The authors dedicate this works to a colleague, the late Dr. Gaynor Davies (1967–2006). The authors declare no conflict of interest. * Corresponding author. Tel.: ⫹0044 29 20742893; fax: ⫹0044 29 20742896. E-mail address: [email protected] (L. Ye). 1078-1439/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.urolonc.2012.05.006
differentiation, and migration. Aberrations of their expression and functions have been indicated in psoriasis, neurodegenerative disorders, and inflammatory diseases [4]. Certain S100 proteins have also been indicated in development and progression of malignancies [5]. Psoriasin differs from the other S100 proteins by its lack of calcium binding ability in 1 EF-hand at the N-terminus. In addition to its overexpression in the skin lesions of psoriatic patients, it is also up-regulated and excreted from cells in the epidermis during inflammation. Interestingly, psoriasin is a chemotactic factor for keratinocytes [6,7] and leukocytes [8]. S100A7 has also been implicated as a prominent antimicrobial peptide (AMP) that selectively kills Escherichia coli on the surface of skin [9]. In addition to its role in the inflammatory process and infection, the relevance to cancer has been investigated together with other S100 proteins. Aberrant expression of psoriasin has been indicated in certain squamous cell and other solid tumors, including bladder, breast, oral, skin, head,
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
1577
Table 1 Primer sequences for PCR Primer
Forward
Reverse
Psoriasin Psoriasin expression GAPDH Psoriasin ribozyme
5=-GAGGTCCATAATAGGCATGA 5=-ATGAGCAACACTCAAGCTG 5=-ATGATATCGCCGCGCTCGTC 5=-CTGCAGTCACAGGCACTAAGG AAGTTGGGCTGATGAGTCCGTGAGGA
5=-AGCAAGGACAGAAACTCAGA 5=-ACTGGCTGCCCCCGGAACA 5=-GCTCGGTCAGGATCTTCA 5=-ACTAGTGGCTGGTGTTTGAC ATTTCGTCCTCACGGACT
and neck cancers [10 –13]. For example, the expression of psoriasin has been intensively examined in breast cancer and has been found to be up-regulated in both ductal carcinomas in situ and some tumors at advanced stages, particularly in estrogen receptor ␣ (ER␣) negative and ER positive tumors. The elevated expression level is associated with poor prognosis and survival in patients with breast cancer. However, the expression of psoriasin in prostate cancer (CaP) and its impact on the functions of CaP cells remained unknown. The current study aimed to examine its implication in CaP.
2. Materials and methods 2.1. Materials and cell lines The following human prostate cell lines were used: PC-3 (European Collection of Animal Cell Culture, Salisbury, UK); DU-145, LNCapFGC, CA-HPV-10, and PZ-HPV-7 (American Type Culture Collection, Manassas, VA); PNT-1A and PNT-2C2 were provided by Professor Norman Maitland (University of York, England, UK). The cells were maintained in Dulbecco’s modified Eagle medium (DMEM)-F12 medium supplemented with 10% fetal calf serum and antibiotics. Other kits and reagents were purchased from Sigma-Aldrich, Inc. (Poole, UK). Prostate tissue samples were snap-frozen in liquid nitrogen immediately after radical prostatectomy, transurethral prostatectomy, or prostate biopsy. Both normal prostate tissues and CaP tissues were examined and confirmed by pathologists. All protocols were reviewed and approved by the local ethical committee and all patients gave written informed consent. 2.2. Construction of ribozyme transgenes targeting human psoriasin and psoriasin overexpression vectors Anti-human psoriasin hammerhead ribozymes were designed based on the secondary structure of the mRNA generated using Zuker’s RNA Mfold program [14]. The ribozymes were synthesized and cloned into pEF6/V5-HisTOPO plasmid vector (Invitrogen, Ltd., Paisley, UK). The primers used for synthesis of the ribozyme are shown in Table 1. Similarly, full-length human psoriasin coding se-
quence, amplified from normal human prostate tissues, was cloned into the same vector. The constructed plasmids were extracted using the Genelute Plasmid Mini-Prep Kit (SigmaAldrich, Inc., Poole, UK). Ribozyme transgenes, overexpression constructs, and control plasmids were transfected into PC-3 and CAHPV-10 cells, respectively, using an electroporator (Easject Plus; EquiBio, Ltd., Kent, UK). Stable transfectants were obtained and verified after 3 weeks of selection using blasticidin. 2.3. RNA isolation and reverse transcription PCR Total RNA was obtained using TRI Reagent (SigmaAldrich, Inc., Poole, UK). First strand cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., Hercules, CA). PCR was performed using REDTaq ReadyMix PCR reaction mix. Cycling conditions were 94°C for 5 minutes, followed by 36 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds. This was followed by a final extension of 10 minutes at 72°C. The products were visualized in 2% agarose gels stained with ethidium bromide. 2.4. Immunohistochemical staining for psoriasin Frozen specimens of prostate tumors (n ⫽ 33) and normal prostate tissues (n ⫽ 6) were cut at a thickness of 6 m using a cryostat (Leica, Bristol, UK). The histologic nature of the samples was verified by 2 pathologists. The sections were air dried and fixed in a mixture of 50% acetone and 50% methanol. The sections were then placed in TBS for 20 minutes to rehydrate. Sections were incubated for 20 minutes in a 0.6% BSA blocking solution and probed with the primary antibody (1:100 dilution; Imgenex, San Diego, CA,) for 1 hour at room temperature. Following extensive washings, sections were incubated for 30 minutes in the secondary biotinylated antibody (Multilink swine antigoat/ mouse/rabbit immunoglobulin, DAKO, Inc., Cambridgeshire, UK). Following washing, Avidin biotin complex (Vector Laboratories, Peterborough, UK) was then applied to the sections followed by extensive washings. Diamino benzidine chromogen (Vector laboratories) was then added to the sections, which were incubated in the dark for 5 minutes. Sections were then counterstained in Gill’s hematoxylin and dehydrated in ascending grades of methanol before clearing in xylene and mounting under a cover slip.
1578
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Staining of psoriasin was assessed with method modified from Allred IHC scoring system [15]. Scores 0, 1, 2, or 3 were given to the staining being negative, faint, moderate, and strong, respectively. 2.5. In vitro cell growth assay A standard procedure was used as previously described [16,17]. Cells were plated into a 96-well plate (2,500 cells/ well). Cell growth was assessed after 1, 3, and 5 days. Crystal violet was used to stain cells, and absorbance was determined at a wavelength of 540 nm using a spectrophotometer (Elx800; Bio-Tek, Bedfordshire, UK). 2.6. In vitro invasion assay Transwell inserts with 8 m pore size were coated with 50 g matrigel and air-dried (BD Matrigel Basement Membrane Matrix, Cat Number 354234; BD BioScience, Oxford, UK). The matrigel was rehydrated before use. A total of 25,000 cells were added to each well and after 96 hours, cells that had migrated through the matrix and pores were fixed (4% formalin), stained in crystal violet, and counted. 2.7. Cell-matrix adhesion assay A total of 40,000 cells were added to each well of a 96-well plate previously prepared by coating with matrigel (5 g/well). The cells were incubated at 37°C in 5% CO2 for 40 minutes and the medium was then discarded. Nonadherent cells were washed off using BSS buffer. The remaining cells were then fixed in 4% formaldehyde for 5 minutes. After further washing, cells were stained with crystal violet, and the number of adherent cells was then counted. 2.8. Flow cytometric analysis of apoptosis Cells (2 ⫻ 105) were seeded in a flask for each of the cell lines, and the cells were cultured using DMEM with/without 10% FCS over 48 hours. All cells, including those floating in the culture medium, were then harvested. The apoptotic population of the cells was determined using Vybrant Apoptosis Assay Kit (Invitrogen, Ltd., Paisley, UK), in which FITC-labeled annexin V was used to identify apoptotic cells following a previously described protocol [18,19]. The stained cells were immediately analyzed using a flow cytometer (CyFlow SL) and FlowMax software package (Partec, GmbH, Münster, Germany). 2.9. Gelatin zymography assay Cells (1 ⫻ 106) were seeded into a 25 cm2 culture flask for each tested cell line. Following overnight culture, cells were washed with serum-free DMEM twice and cultured in 1 ml of serum-free DMEM for 6 hours. The
Fig. 1. Expression of Psoriasin in prostate cancer specimens and cancer cell lines was assessed using immunohistochemical staining and RTPCR respectively. IHC staining of Psoriasin was seen in the cytoplasm of prostate epithelia and cancer cells. (A and B) Staining was moderately strong or absent from prostatic epithelia in normal prostate specimens. (C and D) Strong and moderately strong staining of Psoriasin was seen in most of prostate cancer specimens. (E and F) Psoriasin staining was weak and even absent from foci of completely disrupted gland structure. (G) Psoriasin mRNA expression in prostate cancer cell lines was examined using RT-PCR. (A–F) IHC staining of psoriasin and reduced from 100⫻. (Color version of figure is available online.)
conditioned medium was then collected followed by a centrifugation to remove floating cells. Samples were prepared in a nonreduced sample buffer containing 0.625 mm Tris-HCl, 10% glycerol, 2% SDS, and 2% bromphenol blue. Thirty microliters of each sample was loaded into each lane and separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), which contained 1 mg/ml gelatine. Gel was then renatured in a solution containing 50 mM Tris-HCl (pH 7.6), 5 mMCaCl2, and 2.5 Triton X-100 at room temperature for 1 hour. The gel was then incubated in a buffer containing 50 mm Tris-HCl (pH 7.6) and 5 mm CaCl2 for 36 hours before staining with Coomassie blue. The clear
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583 Table 2 IHC staining of psoriasin in prostate cancer specimens
Tumor Normal
1579
3. Results
Score 0 (%)
Score 1 (%)
Score 2 (%)
Score 3 (%)
Total
1 (3.0%) 3 (50%)
9 (27.3%) 0
15 (45.5%) 3 (50%)
8 (24.2%) 0
33 6
Score 0 ⫽ negative, Score 2 ⫽ faint staining, Score 3 ⫽ moderate staining, Score 4 ⫽ strong staining. The staining of psoriasin was increased in prostate cancer; P ⫽ 0.003 in comparison with its staining in normal prostate tissues using Chi-square test.
bands of gelatin digested by matrix metalloproteinases (MMPs) were then documented using a scanner. 2.10. Statistical analysis The Minitab statistical software package (ver. 14) and SigmaPlot (ver. 11.0) were used for analysis. Non-normally distributed data were assessed using the Mann-Whitney test, and the 2-sample t-test was used for normally distributed data. The 2 test was used to analyze the IHC staining of psoriasin in CaP specimens. Differences were considered statistically significant at P ⬍ 0.05.
3.1. Expression of psoriasin in prostate cancer The expression of psoriasin in CaP specimens was examined using immunohistochemical staining (Fig. 1). Intensive staining of psoriasin was seen in the cytoplasm of CaP cells in CaP specimens. The staining appeared to be relatively weak or absent from prostate epithelial cells from normal prostate tissues. Positive staining for psoriasin was seen in most of the CaP specimens (32/33), P ⫽ 0.003 in comparison with its expression in normal prostate tissues, in which only half of the normal prostate tissues exhibited moderate staining (Table 2). It was noteworthy that the staining of psoriasin was seen to be absent from some foci of Gleason ⬎7 tumors in which the gland structure was completely disrupted (Fig. 1F). We also examined the expression in CaP cells using reverse transcriptase-polymerase chain reaction (RT-PCR). Three CaP cell lines expressed the gene transcript albeit with some subtle differences (i.e., PC-3, DU-145, and CA-HPV-10. Psoriasin was barely detectable in the LNCaP CaP cell line. No obvious difference in expression was seen in CaP cells compared with its expression in 3 immortalized prostatic epithelial cell lines (Fig. 1E).
Fig. 2. Knockdown and overexpression of psoriasin in prostate cancer, and consequent effect on in vitro cell growth. (A) Knockdown and overexpression of psoriasin in PC-3 cells were verified using RT-PCR. Knockdown of psoriasin was also confirmed using the same procedure. PC-3WT and PC-3pEF are PC-3 wild-type and cells transfected with empty plasmids respectively. PC-3⌬PSO and PC-3PSOexp are cells of psoriasin knockdown and overexpression, respectively. (B) Reduced expression of psoriasin was seen in CA-HPV-10⌬Pso cells in comparison with both controls (i.e., CA-HPV-10WT and CA-HPV-10pEF, which are wild-type and empty plasmid control respectively. (C) There was no obvious effect on in vitro growth of PC-3 cells after knockdown and overexpression of psoriasin. (D) No significant impact of psoriasin knockdown was evident in CA-HPV-10 cells. Error bars are standard deviation.
1580
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Fig. 3. Psoriasin promoted survival of prostate cancer under serum starvation. When cells were cultured in DMEM supplemented with 10%FCS, a minimal reduction in the number of apoptotic cells was seen in the PC-3PSOexp, which was 9.56%, compared with 16.14% of PC-3pEF cells. A similar effect was noticed in psoriasin knockdown cells, of which the apoptotic population was 11.65%. The apoptotic population includes both Q4 of early apoptotic cells and Q2 of both late apoptotic and necrotic cells. (Color version of figure is available online.)
3.2. Creation of psoriasin knockdown and overexpression prostate cancer sublines To assess the influence of psoriasin on functions of CaP cells, knockdown of psoriasin was performed in PC-3 (PC3⌬PSO) and CAHPV-10 (CAHPV3⌬PSO) cells using constructed ribozyme transgenes. To verify the regulation of cellular functions by psoriasin, an overexpression plasmid vector was also constructed and transfected into PC-3 cells (PC3PSOexp). Knockdown and overexpression of psoriasin were verified in respective transfectants using RT-PCR (Fig. 2A, B). 3.3. Influence on proliferation and survival of prostate cancer cells by psoriasin There was no significant influence on the in vitro growth of both PC-3 and CAHPV-10 cells after the respective knockdown or overexpression, compared with their controls (Fig 2C, D). The effect on apoptosis and survival was examined in PC-3 cells using a flow cytometric assay. Apoptotic populations of PC-3 cells after knockdown or overexpression of psoriasin were similar in comparison with control cells when the cells were cultured in DMEM supplemented with 10% FCS (Fig. 3). However, serum starvation induced an elevated number of
cells to undergo apoptosis in PC-3⌬PSO cells compared with control cells. In contrast, an inverse effect on apoptosis under serum starvation was seen in the psoriasin overexpression cells, which remained at a similar level of the cells under normal culture condition. 3.4. Psoriasin inversely affected cell-matrix of prostate cancer cells An increased number of cells adhered to matrix was seen in both PC-3 and CAHPV-10 cells after psoriasin knockdown, compared with the respective control. In PC-3 psoriasin overexpression cells, an opposite effect on cell-matrix adhesion was seen. These observations together indicated that the cell-matrix adhesiveness of CaP cells was inversely associated with psoriasin expression (Fig. 4). 3.5. Psoriasin regulates invasiveness of prostate cancer cells via MMPs We finally determined the influence of psoriasin on the in vitro invasion of CaP cells. Contrasting effects on invasion by psoriasin knockdown and overexpression were seen in PC-3 cells. A decrease was seen in the number of invaded
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Fig. 4. Psoriasin inhibits cell-matrix adhesion. (A) Knockdown of psoriasin resulted in an increased adhesion of CAPHV10 cells. (B) An increase was also seen in PC-3 cells after knockdown of psoriasin, whereas a decrease was seen in PC-3PSOexp cells. One asterisk indicates P ⬍ 0.05, and two asterisks indicate P ⬍ 0.01, in comparison with the respective control.
cells after knockdown of psoriasin compared with the control cells, whereas a marked increase of invaded cells was exhibited in the cells of psoriasin overexpression (Fig. 5A). However, no obvious effect was seen in CAHPV-10 cells after knockdown of psoriasin (Fig. 5B). We further analyzed the activities of MMPs from PC-3 cells using zymography. Increased activities of MMP-9, -1, and -3 were seen in PC-3 psoriasin overexpression cells with the gelatin zymography.
4. Discussion The present study examined the expression of psoriasin in both CaP tissues and CaP cell lines. Elevated expression of psoriasin was seen in CaP in comparison with normal prostate tissues. It has also been noticed that weak or negative staining of psoriasin was evident in both normal prostate and some foci of CaP with completely disrupted gland
1581
structure. These data collectively indicate that deregulation of psoriasin occurs in CaP, and that this molecule may play different roles at different stages of the disease (i.e., from onset to disease progression). Elevated expression of psoriasin has previously been indicated in other malignancies [10 –13]. Up-regulation of this molecule in cancer was initially identified in pre-invasive carcinomas; whether the up-regulation also occurs at high-grade prostatic intra-epithelial neoplasm that proceeds to prostate adenocarcinoma is yet to be investigated in future study with appropriate tissue samples. Increased expression of psoriasin has also been shown in malignancies at advanced stage. For example, its increased expression in breast cancer is associated with metastasis and death from the disease [11,20]. Loss of attachment to extracellular matrix, growth factor deprivation, and confluent conditions dramatically up-regulate psoriasin expression in a mammary epithelial cell (MCF10A) [21]. Additionally, psoriasin is also positively regulated by estrogen via ER- [22], by proinflammatory cytokines (oncostatin-M and interleukin-6) via the STAT3, phosphatidylinositol 3-kinase (PI3K), and ERK1/2 pathways [23]. Phospholipase C (PLC) has been indicated in the induction of psoriasin in breast cancer cells by loss of intercellular adhesion molecule 1 (ICAM-1) [24]. By contrast, suppression on its expression in breast cancer cells has been demonstrated by interferon-gamma (IFN-␥), -catenin signaling, and a complex of BRCA1 and c-Myc [25–27]. These reflect the complexity of its regulation and also diverse expression at different stages of the malignancies. Together with its expression revealed in other cancer, it is suggested that aberrant expressions of psoriasin occur during the development and progression of CaP. Therefore, we further investigated its impact on CaP at cellular level. Knockdown and overexpression of psoriasin in CaP cells did not affect the in vitro growth. Interestingly, a promotion of survival was seen in psoriasin overexpression cells only under the condition of serum deprivation. In breast cancer, psoriasin can promote cell growth by repressing the expression of p27 [28]. In addition to this direct effect on the growth of breast cancer cells, the present study indicates a protective role played by psoriasin in CaP cells in response to serum starvation. Loss of attachment can up-regulate psoriasin in mammary epithelial cells [21]. In the current study, an increase was seen in the cell-matrix adhesion of CaP cells after knockdown of psoriasin, and vice versa. The expression of psoriasin in CaP cells is inversely linked to the cell-matrix adhesion. It suggests that the expression of psoriasin is not only a response in cancer cells to changes of cell-matrix adhesion, but it can also reciprocally affect the adhesion to matrix. It may also suggest that the lower or absent expression of psoriasin in the tumor cells at some foci with completely disturbed gland structure of higher Gleason score is to some extent due to the loss of cellmatrix adhesion. A dynamic expression of psoriasin participates in orchestrated progression of CaP together with many other pathways and molecules.
1582
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Fig. 5. Psoriasin regulates invasiveness of PC-3 cells via a regulation of MMPs. (A) Knockdown of psoriasin resulted in a reduction in the invasiveness of PC-3 cells, whereas a contrasting effect was seen in PC-3PSOexp cells. (B) No obvious effect on invasion of CA-HPV-10 cells by psoriasin knockdown was evident. (C) Further examination of conditioned medium from PC-3 cells revealed promoted activities of MMP-9, MMP-1, and MMP-3. (Color version of figure is available online.)
Further to its influences on cell survival and adhesion, we also examined the effect on the invasion of CaP cells. Knockdown of psoriasin in CA-HPV-10, a relatively indolent CaP cell line derived from a primary prostate tumor, did not cause obvious change of its invasiveness although it expresses relatively higher levels of psoriasin compared with the other cancer cells. However, in another more aggressive CaP cell line PC-3, psoriasin overexpression resulted in increased invasion, while a decrease in invasion was seen in the psoriasin knockdown cells. The study went on to show a change of MMP activities following psoriasin expression manipulation. Together, these data suggest that psoriasin regulates invasion of CaP cells via the regulation of MMPs. In a recently published study, an interaction with the cytoplasmic domain of integrin 6 subunit by psoriasin has been implicated in the promotion of invasion of breast cancer cells [29]. Similarly, up-regulation of MMPs was also seen in the psoriasin overexpressing breast cancer cells. This most recent finding in breast cancer cells is in line with our finding in CaP cells. Additionally, another psoriasin interacting protein, C-jun activation-domain binding protein 1 (Jab1), has been implicated in the induced production of MMPs by tumor necrosis factor-␣ (TNF-␣) through activation of nuclear factor-B and JNK [30]. However, whether these partner proteins are involved in the regulation on invasion of CaP cells by psoriasin requires further investigations.
5. Conclusions Psoriasin is expressed in prostate epithelia and cancer cells. Elevated expression of psoriasin is a common feature in CaP. Its expression in CaP cells is associated with cell survival, adhesion, and invasion. Psoriasin regulates invasion of CaP cells via MMPs. Its implications in tumorigenesis and disease progression of CaP warrant further investigations.
6. Acknowledgment The authors gratefully acknowledge support for this work by Cancer Research Wales.
References [1] Madsen P, Rasmussen HH, Leffers H, et al. Molecular cloning, occurrence, and expression of a novel partially secreted protein “psoriasin” that is highly up-regulated in psoriatic skin. J Invest Dermatol 1991;97:701–12. [2] Engelkamp D, Schäfer BW, Mattei MG, et al. Six S100 genes are clustered on human chromosome 1q21: Identification of 2 genes coding for the 2 previously unreported calcium-binding proteins S100D and S100E. Proc Natl Acad Sci U S A 1993;90:6547–51.
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583 [3] Schäfer BW, Wicki R, Engelkamp D, et al. Isolation of a YAC clone covering a cluster of nine S100 genes on human chromosome 1q21: Rationale for a new nomenclature of the S100 calcium-binding protein family. Genomics 1995;25:638 – 43. [4] Fritz G, Botelho HM, Morozova-Roche LA, et al. Natural and amyloid self-assembly of S100 proteins: Structural basis of functional diversity. FEBS J 2010;277:4578 –90. [5] Salama I, Malone PS, Mihaimeed F, et al. A review of the S100 proteins in cancer. Eur J Surg Oncol 2008;34:357– 64. [6] Boniface K, Diveu C, Morel F, et al. Oncostatin M secreted by skin infiltrating T lymphocytes is a potent keratinocyte activator involved in skin inflammation. J Immunol 2007;178:4615–22. [7] Boniface K, Bernard FX, Garcia M, et al. IL-22 inhibits epidermal differentiation and induces proinflammatory gene expression and migration of human keratinocytes. J Immunol 2005;174:3695–702. [8] Wolf R, Howard OM, Dong HF, et al. Chemotactic activity of S100A7 (psoriasin) is mediated by the receptor for advanced glycation end products and potentiates inflammation with highly homologous but functionally distinct S100A15. J Immunol 2008;181:1499 –506. [9] Gläser R, Harder J, Lange H, et al. Antimicrobial psoriasin (S100A7) protects human skin from Escherichia coli infection. Nat Immunol 2005;6:57– 64. [10] Emberley ED, Gietz RD, Campbell JD, et al. RanBPM interacts with psoriasin in vitro and their expression correlates with specific clinical features in vivo in breast cancer. BMC Cancer 2002;2:28. [11] Jiang WG, Watkins G, Douglas-Jones A, et al. Psoriasin is aberrantly expressed in human breast cancer and is related to clinical outcomes. Int J Oncol 2004;25:81–5. [12] Alowami S, Qing G, Emberley E, et al. Psoriasin (S100A7) expression is altered during skin tumorigenesis. BMC Dermatol 2003;3:1. [13] Yao R, Lopez-Beltran A, Maclennan GT, et al. Expression of S100 protein family members in the pathogenesis of bladder tumors. Anticancer Res 2007;27:3051– 8. [14] Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 2003;31:3406 –15. [15] Allred DC, Harvey JM, Berardo M, et al. Prognostic and predictive factors in breast cancer by immunohistochemical analysis. Mod Pathol 1998;11:155– 68. [16] Bonnekoh B, Wevers A, Jugert F, et al. Colorimetric growth assay for epidermal cell cultures by their crystal violet binding capacity. Arch Dermatol Res 1989;281:487–90.
1583
[17] Jiang WG, Davies G, Martin TA, et al. Targeting matrilysin and its impact on tumor growth in vivo: The potential implications in breast cancer therapy. Clin Cancer Res 2005;11:6012–9. [18] Ye L, Kynaston H, Jiang WG. Bone morphogenetic protein-10 suppresses the growth and aggressiveness of prostate cancer cells through a Smad independent pathway. J Urol 2009;181:2749 –59. [19] Koopman G, Reutelingsperger CP, Kuijten GA, et al. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 1994;84:1415–20. [20] Al-Haddad S, Zhang Z, Leygue E, et al. Psoriasin (S100A7) expression and invasive breast cancer. Am J Pathol 1999;155:2057– 66. [21] Enerbäck C, Porter DA, Seth P, et al. Psoriasin expression in mammary epithelial cells in vitro and in vivo. Cancer Res 2002;62:43–7. [22] Skliris GP, Lewis A, Emberley E, et al. Estrogen receptor-beta regulates psoriasin (S100A7) in human breast cancer. Breast Cancer Res Treat 2007;104:75– 85. [23] West NR, Watson PH. S100A7 (psoriasin) is induced by the proinflammatory cytokines oncostatin-M and interleukin-6 in human breast cancer. Oncogene 2010;29:2083–92. [24] Petersson S, Shubbar E, Yhr M, et al. Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells. Breast Cancer Res Treat 2011;125:13–25. [25] Petersson S, Bylander A, Yhr M, et al. S100A7 (psoriasin), highly expressed in ductal carcinoma in situ (DCIS), is regulated by IFNgamma in mammary epithelial cells. BMC Cancer 2007;7:205. [26] Kennedy RD, Gorski JJ, Quinn JE, et al. BRCA1 and c-Myc associate to transcriptionally repress psoriasin, a DNA damage-inducible gene. Cancer Res 2005;65:10265–72. [27] Zhou G, Xie TX, Zhao M, et al. Reciprocal negative regulation between S100A7/psoriasin and beta-catenin signaling plays an important role in tumor progression of squamous cell carcinoma of oral cavity. Oncogene 2008;27:3527–38. [28] Emberley ED, Niu Y, Leygue E, et al. Psoriasin interacts with Jab1 and influences breast cancer progression. Cancer Res 2003;63:1954 – 61. [29] Morgan MR, Jazayeri M, Ramsay AG, et al. Psoriasin (S100A7) associates with integrin 6 subunit and is required for ␣v6-dependent carcinoma cell invasion. Oncogene 2011;30:1422–35. [30] Wang J, Li C, Liu Y, et al. JAB1 determines the response of rheumatoid arthritis synovial fibroblasts to tumor necrosis factor-alpha. Am J Pathol 2006;169:889 –902.
Original article
Psoriasin (S100A7) is a positive regulator of survival and invasion of prostate cancer cells1 Lin Ye, Ph.D.*, Ping-Hui Sun, B.Sc., Tracey A. Martin, Ph.D., Andrew J. Sanders, Ph.D., Malcolm D. Mason, M.D., Wen G. Jiang, M.D. Metastasis and Angiogenesis Research Group, Institute of Cancer and Genetics, Cardiff University School of Medicine, Heath Park, Cardiff, UK Received 24 February 2012; received in revised form 11 May 2012; accepted 14 May 2012
Abstract Objectives: Psoriasin, also known as S100A7 and first identified as a protein highly expressed in psoriatic lesions, is a calcium binding protein that has been indicated in various malignancies. The current study aimed to examine the implication of psoriasin in prostate cancer (CaP), particularly its impact on functions of CaP cells. Materials and methods: Expression of psoriasin was examined in a variety of prostatic cell lines and human CaP tissues using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemistry, respectively. Knockdown and overexpression of psoriasin in CaP cells was performed using specifically constructed plasmids, which either had an anti-psoriasin ribozyme transgene or the full-length human S100A7 coding sequence. The effects of manipulating psoriasin expression on cellular functions of CaP cells were assessed using in vitro assays. Results: Psoriasin was expressed in prostate epithelia and cancer cells. Elevated expression of psoriasin was evident in CaP from its IHC staining in CaP frozen specimens. Psoriasin promoted cell survival under serum starvation. Its expression was inversely correlated with cell-matrix adhesion. Psoriasin increased invasiveness of PC-3 cells via a regulation of matrix metalproteinases (MMPs). Conclusions: Aberrant expression of psoriasin is implicated in CaP. Its expression in CaP cells is associated with cell survival, adhesion, and in vitro invasion, which is via the regulation of MMPs. © 2013 Elsevier Inc. All rights reserved. Keywords: Psoriasin; Prostate cancer; Apoptosis; Invasion; Matrix metalloproteinase
1. Introduction Psoriasin, also known as S100A7, is a member of S100 calcium binding proteins. It was first identified as a protein highly up-regulated in psoriatic epidermis [1]. To date, there are 21 S100 proteins identified in human, of which 17 are tightly clustered in a region of the human 1q21 chromosome [2,3]. They are widely expressed in various cell types and are localized in the cytoplasm and/or nucleus of the cell and, in some cases, are found to be secreted. These calcium binding and signaling proteins are involved in the regulation of cell proliferation, apoptosis,
1
The authors dedicate this works to a colleague, the late Dr. Gaynor Davies (1967–2006). The authors declare no conflict of interest. * Corresponding author. Tel.: ⫹0044 29 20742893; fax: ⫹0044 29 20742896. E-mail address: [email protected] (L. Ye). 1078-1439/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.urolonc.2012.05.006
differentiation, and migration. Aberrations of their expression and functions have been indicated in psoriasis, neurodegenerative disorders, and inflammatory diseases [4]. Certain S100 proteins have also been indicated in development and progression of malignancies [5]. Psoriasin differs from the other S100 proteins by its lack of calcium binding ability in 1 EF-hand at the N-terminus. In addition to its overexpression in the skin lesions of psoriatic patients, it is also up-regulated and excreted from cells in the epidermis during inflammation. Interestingly, psoriasin is a chemotactic factor for keratinocytes [6,7] and leukocytes [8]. S100A7 has also been implicated as a prominent antimicrobial peptide (AMP) that selectively kills Escherichia coli on the surface of skin [9]. In addition to its role in the inflammatory process and infection, the relevance to cancer has been investigated together with other S100 proteins. Aberrant expression of psoriasin has been indicated in certain squamous cell and other solid tumors, including bladder, breast, oral, skin, head,
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
1577
Table 1 Primer sequences for PCR Primer
Forward
Reverse
Psoriasin Psoriasin expression GAPDH Psoriasin ribozyme
5=-GAGGTCCATAATAGGCATGA 5=-ATGAGCAACACTCAAGCTG 5=-ATGATATCGCCGCGCTCGTC 5=-CTGCAGTCACAGGCACTAAGG AAGTTGGGCTGATGAGTCCGTGAGGA
5=-AGCAAGGACAGAAACTCAGA 5=-ACTGGCTGCCCCCGGAACA 5=-GCTCGGTCAGGATCTTCA 5=-ACTAGTGGCTGGTGTTTGAC ATTTCGTCCTCACGGACT
and neck cancers [10 –13]. For example, the expression of psoriasin has been intensively examined in breast cancer and has been found to be up-regulated in both ductal carcinomas in situ and some tumors at advanced stages, particularly in estrogen receptor ␣ (ER␣) negative and ER positive tumors. The elevated expression level is associated with poor prognosis and survival in patients with breast cancer. However, the expression of psoriasin in prostate cancer (CaP) and its impact on the functions of CaP cells remained unknown. The current study aimed to examine its implication in CaP.
2. Materials and methods 2.1. Materials and cell lines The following human prostate cell lines were used: PC-3 (European Collection of Animal Cell Culture, Salisbury, UK); DU-145, LNCapFGC, CA-HPV-10, and PZ-HPV-7 (American Type Culture Collection, Manassas, VA); PNT-1A and PNT-2C2 were provided by Professor Norman Maitland (University of York, England, UK). The cells were maintained in Dulbecco’s modified Eagle medium (DMEM)-F12 medium supplemented with 10% fetal calf serum and antibiotics. Other kits and reagents were purchased from Sigma-Aldrich, Inc. (Poole, UK). Prostate tissue samples were snap-frozen in liquid nitrogen immediately after radical prostatectomy, transurethral prostatectomy, or prostate biopsy. Both normal prostate tissues and CaP tissues were examined and confirmed by pathologists. All protocols were reviewed and approved by the local ethical committee and all patients gave written informed consent. 2.2. Construction of ribozyme transgenes targeting human psoriasin and psoriasin overexpression vectors Anti-human psoriasin hammerhead ribozymes were designed based on the secondary structure of the mRNA generated using Zuker’s RNA Mfold program [14]. The ribozymes were synthesized and cloned into pEF6/V5-HisTOPO plasmid vector (Invitrogen, Ltd., Paisley, UK). The primers used for synthesis of the ribozyme are shown in Table 1. Similarly, full-length human psoriasin coding se-
quence, amplified from normal human prostate tissues, was cloned into the same vector. The constructed plasmids were extracted using the Genelute Plasmid Mini-Prep Kit (SigmaAldrich, Inc., Poole, UK). Ribozyme transgenes, overexpression constructs, and control plasmids were transfected into PC-3 and CAHPV-10 cells, respectively, using an electroporator (Easject Plus; EquiBio, Ltd., Kent, UK). Stable transfectants were obtained and verified after 3 weeks of selection using blasticidin. 2.3. RNA isolation and reverse transcription PCR Total RNA was obtained using TRI Reagent (SigmaAldrich, Inc., Poole, UK). First strand cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., Hercules, CA). PCR was performed using REDTaq ReadyMix PCR reaction mix. Cycling conditions were 94°C for 5 minutes, followed by 36 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds. This was followed by a final extension of 10 minutes at 72°C. The products were visualized in 2% agarose gels stained with ethidium bromide. 2.4. Immunohistochemical staining for psoriasin Frozen specimens of prostate tumors (n ⫽ 33) and normal prostate tissues (n ⫽ 6) were cut at a thickness of 6 m using a cryostat (Leica, Bristol, UK). The histologic nature of the samples was verified by 2 pathologists. The sections were air dried and fixed in a mixture of 50% acetone and 50% methanol. The sections were then placed in TBS for 20 minutes to rehydrate. Sections were incubated for 20 minutes in a 0.6% BSA blocking solution and probed with the primary antibody (1:100 dilution; Imgenex, San Diego, CA,) for 1 hour at room temperature. Following extensive washings, sections were incubated for 30 minutes in the secondary biotinylated antibody (Multilink swine antigoat/ mouse/rabbit immunoglobulin, DAKO, Inc., Cambridgeshire, UK). Following washing, Avidin biotin complex (Vector Laboratories, Peterborough, UK) was then applied to the sections followed by extensive washings. Diamino benzidine chromogen (Vector laboratories) was then added to the sections, which were incubated in the dark for 5 minutes. Sections were then counterstained in Gill’s hematoxylin and dehydrated in ascending grades of methanol before clearing in xylene and mounting under a cover slip.
1578
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Staining of psoriasin was assessed with method modified from Allred IHC scoring system [15]. Scores 0, 1, 2, or 3 were given to the staining being negative, faint, moderate, and strong, respectively. 2.5. In vitro cell growth assay A standard procedure was used as previously described [16,17]. Cells were plated into a 96-well plate (2,500 cells/ well). Cell growth was assessed after 1, 3, and 5 days. Crystal violet was used to stain cells, and absorbance was determined at a wavelength of 540 nm using a spectrophotometer (Elx800; Bio-Tek, Bedfordshire, UK). 2.6. In vitro invasion assay Transwell inserts with 8 m pore size were coated with 50 g matrigel and air-dried (BD Matrigel Basement Membrane Matrix, Cat Number 354234; BD BioScience, Oxford, UK). The matrigel was rehydrated before use. A total of 25,000 cells were added to each well and after 96 hours, cells that had migrated through the matrix and pores were fixed (4% formalin), stained in crystal violet, and counted. 2.7. Cell-matrix adhesion assay A total of 40,000 cells were added to each well of a 96-well plate previously prepared by coating with matrigel (5 g/well). The cells were incubated at 37°C in 5% CO2 for 40 minutes and the medium was then discarded. Nonadherent cells were washed off using BSS buffer. The remaining cells were then fixed in 4% formaldehyde for 5 minutes. After further washing, cells were stained with crystal violet, and the number of adherent cells was then counted. 2.8. Flow cytometric analysis of apoptosis Cells (2 ⫻ 105) were seeded in a flask for each of the cell lines, and the cells were cultured using DMEM with/without 10% FCS over 48 hours. All cells, including those floating in the culture medium, were then harvested. The apoptotic population of the cells was determined using Vybrant Apoptosis Assay Kit (Invitrogen, Ltd., Paisley, UK), in which FITC-labeled annexin V was used to identify apoptotic cells following a previously described protocol [18,19]. The stained cells were immediately analyzed using a flow cytometer (CyFlow SL) and FlowMax software package (Partec, GmbH, Münster, Germany). 2.9. Gelatin zymography assay Cells (1 ⫻ 106) were seeded into a 25 cm2 culture flask for each tested cell line. Following overnight culture, cells were washed with serum-free DMEM twice and cultured in 1 ml of serum-free DMEM for 6 hours. The
Fig. 1. Expression of Psoriasin in prostate cancer specimens and cancer cell lines was assessed using immunohistochemical staining and RTPCR respectively. IHC staining of Psoriasin was seen in the cytoplasm of prostate epithelia and cancer cells. (A and B) Staining was moderately strong or absent from prostatic epithelia in normal prostate specimens. (C and D) Strong and moderately strong staining of Psoriasin was seen in most of prostate cancer specimens. (E and F) Psoriasin staining was weak and even absent from foci of completely disrupted gland structure. (G) Psoriasin mRNA expression in prostate cancer cell lines was examined using RT-PCR. (A–F) IHC staining of psoriasin and reduced from 100⫻. (Color version of figure is available online.)
conditioned medium was then collected followed by a centrifugation to remove floating cells. Samples were prepared in a nonreduced sample buffer containing 0.625 mm Tris-HCl, 10% glycerol, 2% SDS, and 2% bromphenol blue. Thirty microliters of each sample was loaded into each lane and separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), which contained 1 mg/ml gelatine. Gel was then renatured in a solution containing 50 mM Tris-HCl (pH 7.6), 5 mMCaCl2, and 2.5 Triton X-100 at room temperature for 1 hour. The gel was then incubated in a buffer containing 50 mm Tris-HCl (pH 7.6) and 5 mm CaCl2 for 36 hours before staining with Coomassie blue. The clear
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583 Table 2 IHC staining of psoriasin in prostate cancer specimens
Tumor Normal
1579
3. Results
Score 0 (%)
Score 1 (%)
Score 2 (%)
Score 3 (%)
Total
1 (3.0%) 3 (50%)
9 (27.3%) 0
15 (45.5%) 3 (50%)
8 (24.2%) 0
33 6
Score 0 ⫽ negative, Score 2 ⫽ faint staining, Score 3 ⫽ moderate staining, Score 4 ⫽ strong staining. The staining of psoriasin was increased in prostate cancer; P ⫽ 0.003 in comparison with its staining in normal prostate tissues using Chi-square test.
bands of gelatin digested by matrix metalloproteinases (MMPs) were then documented using a scanner. 2.10. Statistical analysis The Minitab statistical software package (ver. 14) and SigmaPlot (ver. 11.0) were used for analysis. Non-normally distributed data were assessed using the Mann-Whitney test, and the 2-sample t-test was used for normally distributed data. The 2 test was used to analyze the IHC staining of psoriasin in CaP specimens. Differences were considered statistically significant at P ⬍ 0.05.
3.1. Expression of psoriasin in prostate cancer The expression of psoriasin in CaP specimens was examined using immunohistochemical staining (Fig. 1). Intensive staining of psoriasin was seen in the cytoplasm of CaP cells in CaP specimens. The staining appeared to be relatively weak or absent from prostate epithelial cells from normal prostate tissues. Positive staining for psoriasin was seen in most of the CaP specimens (32/33), P ⫽ 0.003 in comparison with its expression in normal prostate tissues, in which only half of the normal prostate tissues exhibited moderate staining (Table 2). It was noteworthy that the staining of psoriasin was seen to be absent from some foci of Gleason ⬎7 tumors in which the gland structure was completely disrupted (Fig. 1F). We also examined the expression in CaP cells using reverse transcriptase-polymerase chain reaction (RT-PCR). Three CaP cell lines expressed the gene transcript albeit with some subtle differences (i.e., PC-3, DU-145, and CA-HPV-10. Psoriasin was barely detectable in the LNCaP CaP cell line. No obvious difference in expression was seen in CaP cells compared with its expression in 3 immortalized prostatic epithelial cell lines (Fig. 1E).
Fig. 2. Knockdown and overexpression of psoriasin in prostate cancer, and consequent effect on in vitro cell growth. (A) Knockdown and overexpression of psoriasin in PC-3 cells were verified using RT-PCR. Knockdown of psoriasin was also confirmed using the same procedure. PC-3WT and PC-3pEF are PC-3 wild-type and cells transfected with empty plasmids respectively. PC-3⌬PSO and PC-3PSOexp are cells of psoriasin knockdown and overexpression, respectively. (B) Reduced expression of psoriasin was seen in CA-HPV-10⌬Pso cells in comparison with both controls (i.e., CA-HPV-10WT and CA-HPV-10pEF, which are wild-type and empty plasmid control respectively. (C) There was no obvious effect on in vitro growth of PC-3 cells after knockdown and overexpression of psoriasin. (D) No significant impact of psoriasin knockdown was evident in CA-HPV-10 cells. Error bars are standard deviation.
1580
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Fig. 3. Psoriasin promoted survival of prostate cancer under serum starvation. When cells were cultured in DMEM supplemented with 10%FCS, a minimal reduction in the number of apoptotic cells was seen in the PC-3PSOexp, which was 9.56%, compared with 16.14% of PC-3pEF cells. A similar effect was noticed in psoriasin knockdown cells, of which the apoptotic population was 11.65%. The apoptotic population includes both Q4 of early apoptotic cells and Q2 of both late apoptotic and necrotic cells. (Color version of figure is available online.)
3.2. Creation of psoriasin knockdown and overexpression prostate cancer sublines To assess the influence of psoriasin on functions of CaP cells, knockdown of psoriasin was performed in PC-3 (PC3⌬PSO) and CAHPV-10 (CAHPV3⌬PSO) cells using constructed ribozyme transgenes. To verify the regulation of cellular functions by psoriasin, an overexpression plasmid vector was also constructed and transfected into PC-3 cells (PC3PSOexp). Knockdown and overexpression of psoriasin were verified in respective transfectants using RT-PCR (Fig. 2A, B). 3.3. Influence on proliferation and survival of prostate cancer cells by psoriasin There was no significant influence on the in vitro growth of both PC-3 and CAHPV-10 cells after the respective knockdown or overexpression, compared with their controls (Fig 2C, D). The effect on apoptosis and survival was examined in PC-3 cells using a flow cytometric assay. Apoptotic populations of PC-3 cells after knockdown or overexpression of psoriasin were similar in comparison with control cells when the cells were cultured in DMEM supplemented with 10% FCS (Fig. 3). However, serum starvation induced an elevated number of
cells to undergo apoptosis in PC-3⌬PSO cells compared with control cells. In contrast, an inverse effect on apoptosis under serum starvation was seen in the psoriasin overexpression cells, which remained at a similar level of the cells under normal culture condition. 3.4. Psoriasin inversely affected cell-matrix of prostate cancer cells An increased number of cells adhered to matrix was seen in both PC-3 and CAHPV-10 cells after psoriasin knockdown, compared with the respective control. In PC-3 psoriasin overexpression cells, an opposite effect on cell-matrix adhesion was seen. These observations together indicated that the cell-matrix adhesiveness of CaP cells was inversely associated with psoriasin expression (Fig. 4). 3.5. Psoriasin regulates invasiveness of prostate cancer cells via MMPs We finally determined the influence of psoriasin on the in vitro invasion of CaP cells. Contrasting effects on invasion by psoriasin knockdown and overexpression were seen in PC-3 cells. A decrease was seen in the number of invaded
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Fig. 4. Psoriasin inhibits cell-matrix adhesion. (A) Knockdown of psoriasin resulted in an increased adhesion of CAPHV10 cells. (B) An increase was also seen in PC-3 cells after knockdown of psoriasin, whereas a decrease was seen in PC-3PSOexp cells. One asterisk indicates P ⬍ 0.05, and two asterisks indicate P ⬍ 0.01, in comparison with the respective control.
cells after knockdown of psoriasin compared with the control cells, whereas a marked increase of invaded cells was exhibited in the cells of psoriasin overexpression (Fig. 5A). However, no obvious effect was seen in CAHPV-10 cells after knockdown of psoriasin (Fig. 5B). We further analyzed the activities of MMPs from PC-3 cells using zymography. Increased activities of MMP-9, -1, and -3 were seen in PC-3 psoriasin overexpression cells with the gelatin zymography.
4. Discussion The present study examined the expression of psoriasin in both CaP tissues and CaP cell lines. Elevated expression of psoriasin was seen in CaP in comparison with normal prostate tissues. It has also been noticed that weak or negative staining of psoriasin was evident in both normal prostate and some foci of CaP with completely disrupted gland
1581
structure. These data collectively indicate that deregulation of psoriasin occurs in CaP, and that this molecule may play different roles at different stages of the disease (i.e., from onset to disease progression). Elevated expression of psoriasin has previously been indicated in other malignancies [10 –13]. Up-regulation of this molecule in cancer was initially identified in pre-invasive carcinomas; whether the up-regulation also occurs at high-grade prostatic intra-epithelial neoplasm that proceeds to prostate adenocarcinoma is yet to be investigated in future study with appropriate tissue samples. Increased expression of psoriasin has also been shown in malignancies at advanced stage. For example, its increased expression in breast cancer is associated with metastasis and death from the disease [11,20]. Loss of attachment to extracellular matrix, growth factor deprivation, and confluent conditions dramatically up-regulate psoriasin expression in a mammary epithelial cell (MCF10A) [21]. Additionally, psoriasin is also positively regulated by estrogen via ER- [22], by proinflammatory cytokines (oncostatin-M and interleukin-6) via the STAT3, phosphatidylinositol 3-kinase (PI3K), and ERK1/2 pathways [23]. Phospholipase C (PLC) has been indicated in the induction of psoriasin in breast cancer cells by loss of intercellular adhesion molecule 1 (ICAM-1) [24]. By contrast, suppression on its expression in breast cancer cells has been demonstrated by interferon-gamma (IFN-␥), -catenin signaling, and a complex of BRCA1 and c-Myc [25–27]. These reflect the complexity of its regulation and also diverse expression at different stages of the malignancies. Together with its expression revealed in other cancer, it is suggested that aberrant expressions of psoriasin occur during the development and progression of CaP. Therefore, we further investigated its impact on CaP at cellular level. Knockdown and overexpression of psoriasin in CaP cells did not affect the in vitro growth. Interestingly, a promotion of survival was seen in psoriasin overexpression cells only under the condition of serum deprivation. In breast cancer, psoriasin can promote cell growth by repressing the expression of p27 [28]. In addition to this direct effect on the growth of breast cancer cells, the present study indicates a protective role played by psoriasin in CaP cells in response to serum starvation. Loss of attachment can up-regulate psoriasin in mammary epithelial cells [21]. In the current study, an increase was seen in the cell-matrix adhesion of CaP cells after knockdown of psoriasin, and vice versa. The expression of psoriasin in CaP cells is inversely linked to the cell-matrix adhesion. It suggests that the expression of psoriasin is not only a response in cancer cells to changes of cell-matrix adhesion, but it can also reciprocally affect the adhesion to matrix. It may also suggest that the lower or absent expression of psoriasin in the tumor cells at some foci with completely disturbed gland structure of higher Gleason score is to some extent due to the loss of cellmatrix adhesion. A dynamic expression of psoriasin participates in orchestrated progression of CaP together with many other pathways and molecules.
1582
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583
Fig. 5. Psoriasin regulates invasiveness of PC-3 cells via a regulation of MMPs. (A) Knockdown of psoriasin resulted in a reduction in the invasiveness of PC-3 cells, whereas a contrasting effect was seen in PC-3PSOexp cells. (B) No obvious effect on invasion of CA-HPV-10 cells by psoriasin knockdown was evident. (C) Further examination of conditioned medium from PC-3 cells revealed promoted activities of MMP-9, MMP-1, and MMP-3. (Color version of figure is available online.)
Further to its influences on cell survival and adhesion, we also examined the effect on the invasion of CaP cells. Knockdown of psoriasin in CA-HPV-10, a relatively indolent CaP cell line derived from a primary prostate tumor, did not cause obvious change of its invasiveness although it expresses relatively higher levels of psoriasin compared with the other cancer cells. However, in another more aggressive CaP cell line PC-3, psoriasin overexpression resulted in increased invasion, while a decrease in invasion was seen in the psoriasin knockdown cells. The study went on to show a change of MMP activities following psoriasin expression manipulation. Together, these data suggest that psoriasin regulates invasion of CaP cells via the regulation of MMPs. In a recently published study, an interaction with the cytoplasmic domain of integrin 6 subunit by psoriasin has been implicated in the promotion of invasion of breast cancer cells [29]. Similarly, up-regulation of MMPs was also seen in the psoriasin overexpressing breast cancer cells. This most recent finding in breast cancer cells is in line with our finding in CaP cells. Additionally, another psoriasin interacting protein, C-jun activation-domain binding protein 1 (Jab1), has been implicated in the induced production of MMPs by tumor necrosis factor-␣ (TNF-␣) through activation of nuclear factor-B and JNK [30]. However, whether these partner proteins are involved in the regulation on invasion of CaP cells by psoriasin requires further investigations.
5. Conclusions Psoriasin is expressed in prostate epithelia and cancer cells. Elevated expression of psoriasin is a common feature in CaP. Its expression in CaP cells is associated with cell survival, adhesion, and invasion. Psoriasin regulates invasion of CaP cells via MMPs. Its implications in tumorigenesis and disease progression of CaP warrant further investigations.
6. Acknowledgment The authors gratefully acknowledge support for this work by Cancer Research Wales.
References [1] Madsen P, Rasmussen HH, Leffers H, et al. Molecular cloning, occurrence, and expression of a novel partially secreted protein “psoriasin” that is highly up-regulated in psoriatic skin. J Invest Dermatol 1991;97:701–12. [2] Engelkamp D, Schäfer BW, Mattei MG, et al. Six S100 genes are clustered on human chromosome 1q21: Identification of 2 genes coding for the 2 previously unreported calcium-binding proteins S100D and S100E. Proc Natl Acad Sci U S A 1993;90:6547–51.
L. Ye et al. / Urologic Oncology: Seminars and Original Investigations 31 (2013) 1576 –1583 [3] Schäfer BW, Wicki R, Engelkamp D, et al. Isolation of a YAC clone covering a cluster of nine S100 genes on human chromosome 1q21: Rationale for a new nomenclature of the S100 calcium-binding protein family. Genomics 1995;25:638 – 43. [4] Fritz G, Botelho HM, Morozova-Roche LA, et al. Natural and amyloid self-assembly of S100 proteins: Structural basis of functional diversity. FEBS J 2010;277:4578 –90. [5] Salama I, Malone PS, Mihaimeed F, et al. A review of the S100 proteins in cancer. Eur J Surg Oncol 2008;34:357– 64. [6] Boniface K, Diveu C, Morel F, et al. Oncostatin M secreted by skin infiltrating T lymphocytes is a potent keratinocyte activator involved in skin inflammation. J Immunol 2007;178:4615–22. [7] Boniface K, Bernard FX, Garcia M, et al. IL-22 inhibits epidermal differentiation and induces proinflammatory gene expression and migration of human keratinocytes. J Immunol 2005;174:3695–702. [8] Wolf R, Howard OM, Dong HF, et al. Chemotactic activity of S100A7 (psoriasin) is mediated by the receptor for advanced glycation end products and potentiates inflammation with highly homologous but functionally distinct S100A15. J Immunol 2008;181:1499 –506. [9] Gläser R, Harder J, Lange H, et al. Antimicrobial psoriasin (S100A7) protects human skin from Escherichia coli infection. Nat Immunol 2005;6:57– 64. [10] Emberley ED, Gietz RD, Campbell JD, et al. RanBPM interacts with psoriasin in vitro and their expression correlates with specific clinical features in vivo in breast cancer. BMC Cancer 2002;2:28. [11] Jiang WG, Watkins G, Douglas-Jones A, et al. Psoriasin is aberrantly expressed in human breast cancer and is related to clinical outcomes. Int J Oncol 2004;25:81–5. [12] Alowami S, Qing G, Emberley E, et al. Psoriasin (S100A7) expression is altered during skin tumorigenesis. BMC Dermatol 2003;3:1. [13] Yao R, Lopez-Beltran A, Maclennan GT, et al. Expression of S100 protein family members in the pathogenesis of bladder tumors. Anticancer Res 2007;27:3051– 8. [14] Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 2003;31:3406 –15. [15] Allred DC, Harvey JM, Berardo M, et al. Prognostic and predictive factors in breast cancer by immunohistochemical analysis. Mod Pathol 1998;11:155– 68. [16] Bonnekoh B, Wevers A, Jugert F, et al. Colorimetric growth assay for epidermal cell cultures by their crystal violet binding capacity. Arch Dermatol Res 1989;281:487–90.
1583
[17] Jiang WG, Davies G, Martin TA, et al. Targeting matrilysin and its impact on tumor growth in vivo: The potential implications in breast cancer therapy. Clin Cancer Res 2005;11:6012–9. [18] Ye L, Kynaston H, Jiang WG. Bone morphogenetic protein-10 suppresses the growth and aggressiveness of prostate cancer cells through a Smad independent pathway. J Urol 2009;181:2749 –59. [19] Koopman G, Reutelingsperger CP, Kuijten GA, et al. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 1994;84:1415–20. [20] Al-Haddad S, Zhang Z, Leygue E, et al. Psoriasin (S100A7) expression and invasive breast cancer. Am J Pathol 1999;155:2057– 66. [21] Enerbäck C, Porter DA, Seth P, et al. Psoriasin expression in mammary epithelial cells in vitro and in vivo. Cancer Res 2002;62:43–7. [22] Skliris GP, Lewis A, Emberley E, et al. Estrogen receptor-beta regulates psoriasin (S100A7) in human breast cancer. Breast Cancer Res Treat 2007;104:75– 85. [23] West NR, Watson PH. S100A7 (psoriasin) is induced by the proinflammatory cytokines oncostatin-M and interleukin-6 in human breast cancer. Oncogene 2010;29:2083–92. [24] Petersson S, Shubbar E, Yhr M, et al. Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells. Breast Cancer Res Treat 2011;125:13–25. [25] Petersson S, Bylander A, Yhr M, et al. S100A7 (psoriasin), highly expressed in ductal carcinoma in situ (DCIS), is regulated by IFNgamma in mammary epithelial cells. BMC Cancer 2007;7:205. [26] Kennedy RD, Gorski JJ, Quinn JE, et al. BRCA1 and c-Myc associate to transcriptionally repress psoriasin, a DNA damage-inducible gene. Cancer Res 2005;65:10265–72. [27] Zhou G, Xie TX, Zhao M, et al. Reciprocal negative regulation between S100A7/psoriasin and beta-catenin signaling plays an important role in tumor progression of squamous cell carcinoma of oral cavity. Oncogene 2008;27:3527–38. [28] Emberley ED, Niu Y, Leygue E, et al. Psoriasin interacts with Jab1 and influences breast cancer progression. Cancer Res 2003;63:1954 – 61. [29] Morgan MR, Jazayeri M, Ramsay AG, et al. Psoriasin (S100A7) associates with integrin 6 subunit and is required for ␣v6-dependent carcinoma cell invasion. Oncogene 2011;30:1422–35. [30] Wang J, Li C, Liu Y, et al. JAB1 determines the response of rheumatoid arthritis synovial fibroblasts to tumor necrosis factor-alpha. Am J Pathol 2006;169:889 –902.