- Email: [email protected]
EPLIN is a Negative Regulator of Prostate Cancer Growth and Invasion
EPLIN is a Negative Regulator of Prostate Cancer Growth and Invasion Andrew J. Sanders,* Tracey A. Martin, Lin Ye, Malcolm D. Mason and Wen G. Jiang From the Metastasis and Angiogenesis Research Group (AJS, TAM, LY, WGJ) and Department of Clinical Oncology, Cardiff University School of Medicine (MDM), Cardiff; United Kingdom
Purpose: We investigated the importance of EPLIN, a cytoskeletal associated protein implicated in cancer, in clinical prostate cancer and its role in the PC-3 prostate cancer cell line (ATCC™). Materials and Methods: Full-length human EPLIN cDNA was cloned into a pEF6 expression vector and used to transfect the PC-3 human prostate cancer cell line. Cells over expressing EPLIN were termed PC-3EPLIN EXP while wild-type and empty pEF6 vector control cells were designated PC-3WT and PC-3pEF6, respectively. The in vitro and in vivo impact of EPLIN on PC-3 cells was examined using a number of model assays. Results: EPLIN over expression in PC-3 cells resulted in a decrease in the growth rate of this cell line (mean ⫾ SD 0.6 ⫾ 0.17 for PC-3pEF6 cells vs 0.33 ⫾ 0.01 for PC-3EPLIN EXP cells, p ⬍0.01). PC-3EPLIN EXP cells were significantly less able to adhere to extracellular matrix than control cells (mean 61.0 ⫾ 12.4 vs 102.8 ⫾ 20.7, p ⫽ 0.028). Immunofluorescence staining showed an increased staining profile for paxillin in PC-3EPLIN EXP cells compared to wild-type cells. Conclusions: EPLIN over expression in the PC-3 cell line resulted in decreased in vivo and in vitro growth potential together with decreased cell invasiveness and ability to adhere to extracellular matrix, and enhanced paxillin staining. This further highlights the importance of EPLIN in regulating prostate cancer cell growth and aggressiveness, and suggests a possible connection between EPLIN and paxillin.
Abbreviations and Acronyms EPLIN ⫽ epithelial protein lost in neoplasm GAPDH ⫽ glyceraldehyde-3phosphate dehydrogenase HGF ⫽ hepatocyte growth factor IHC ⫽ immunohistochemistry PCR ⫽ polymerase chain reaction Submitted for publication September 10, 2010. Study received local ethics committee approval. Supported by Cancer Research Wales. * Correspondence: Metastasis and Angiogenesis Research Group, Cardiff University School of Medicine, Cardiff, CF14 4XN, United Kingdom (telephone: 44 29 2074 2893; FAX: 44 29 2076 1623; e-mail: [email protected]).
Key Words: prostate; prostatic neoplasms; EPLIN protein, human; paxillin; neoplasm invasiveness THE EPLIN gene was initially identified as being down-regulated in transformed vs normal oral keratinocytes.1 Subsequent studies revealed that EPLIN exists as 2 isoforms, EPLIN␣ and EPLIN, which differ from each other by approximately 160 amino acids and arise due to transcription initiation from 2 distinct promoter sites.2,3 EPLIN is expressed in various tissues and immunofluorescence studies have indicated its distribution in cytoplasm
in a fibrillar pattern, similar to that of actin fibers.2 A number of studies have suggested a role for EPLIN in regulating cytoskeletal dynamics, for which it influences actin stabilization, regulates actin turnover and links the cadherin-catenin complex to F-actin.4,5 A recent study also implied a role for EPLIN in cytokinesis and showed that EPLIN depletion results in mislocalization of key proteins during the final stages of cytokinesis.6 Studies
0022-5347/11/1861-0295/0 THE JOURNAL OF UROLOGY® © 2011 by AMERICAN UROLOGICAL ASSOCIATION EDUCATION
Vol. 186, 295-301, July 2011 Printed in U.S.A. DOI:10.1016/j.juro.2011.03.038
AND
RESEARCH, INC.
www.jurology.com
295
296
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
have also suggested possible links between EPLIN and paxillin with overlaps between EPLIN and paxillin staining patterns noted2 and enhanced levels of paxillin staining observed in HECV endothelial cells over expressing EPLIN.7 EPLIN␣ expression is often down-regulated in cancerous cells and tissues. Maul and Chang observed that EPLIN␣ expression was substantially down-regulated or lost in most oral cancer cell lines (8 of 8), breast cancer cell lines (5 of 6), prostate cancer cell lines (4 of 4) and xenograph tumors (3 of 3).2 A recent study done at our laboratory revealed that EPLIN␣ over expression decreased the invasiveness, in vitro and in vivo growth and development, and motility of the aggressive MDA-MB-231 breast cancer cell line.8 Also, examination of EPLIN levels using quantitative PCR and IHC staining in a cohort of breast cancer samples showed that lower EPLIN levels were associated with more aggressive cancer and poor patient outcome.8 Given the involvement of EPLIN with cytoskeletal dynamics and cytokinesis, it was suggested that the loss of EPLIN expression in cancerous cells may contribute to the genomic instability, and enhanced motility and invasiveness of these cancer cells.4 – 6 We examined the importance of EPLIN␣ in prostate cancer. The study demonstrated that EPLIN expression is dysregulated in clinical prostate cancer samples. We noted that EPLIN␣ over expression in PC-3 prostate cancer cells can influence aggressive traits, such as in vitro cell invasion, adhesion, growth and in vivo tumor development, in this aggressive prostate cancer cell line. We also found additional evidence suggesting a link between EPLIN and paxillin in PC-3 prostate cancer cells.
METHODS AND MATERIALS Clinical Sample Collection, Processing and IHC Staining Prostate tissue samples were snap frozen in liquid nitrogen immediately after transurethral prostatectomy, radical prostatectomy or prostate biopsy. Written consent was acquired for all patients and all protocols were reviewed by the local ethics committee. After collection 20 prostate tumor and 11 normal prostate tissue samples were sectioned using a cryostat and verified by 2 pathologists. IHC was performed using antiEPLIN antibody (Bethyl Laboratories, Montgomery, Texas) and the Vectastain® Elite Universal ABC Kit. Sections were visualized under microscopy and digital images were acquired. Staining intensity was quantified using ImageJ.
Cell Lines and Culture Conditions PC-3 cells were maintained in Dulbecco’s modified Eagle medium supplemented with penicillin, streptomycin and 10% fetal calf serum (PAA Laboratories, Yeovil, United
Kingdom). Cells were incubated at 37C with 95% humidity in 5% CO2.
Generation of PC-3 Cells Over Expressing EPLIN The full-length human EPLIN␣ cDNA sequence was isolated and amplified from normal tissue, and subsequently inserted into a pEF6 plasmid, as described previously.8 This expression plasmid was used to transfect the PC-3 prostate cancer cell line, which expresses this molecule at a minimal level. PC-3 cells containing the expression plasmid and showing amplified EPLIN␣ expression were termed PC-3EPLIN EXP. They were compared throughout to unmodified wild-type PC-3WT cells and PC-3pEF6 cells transfected with an empty pEF6 plasmid vector.
RNA Isolation and cDNA Synthesis RNA isolation was performed using Total RNA Isolation Reagent (ABgene™) and used to generate cDNA using an Enhanced Avian RT-PCR-100 Kit with anchored oligo(deoxythymidine) primers (Sigma®). cDNA quality was assessed using GAPDH primers. For EPLIN the primers were sense AAGCAAAAATGAAAACGAAG and antisense ACTGAACCTGACCGTACAGACACCCACCTTAGCAA. For GAPDH the primers were sense ATGATATCGCCGCGCTCA and antisense CGCTCGGTGAGGATCTTCA. PCR was done using standard methods.
Assays In vitro cell growth. Cells were seeded into duplicate 96-well plates at a seeding density of 3,000 cells per well. Plates were incubated for 3 or 5 days before assessing cell growth. Cells were stained with crystal violet and absorbance was determined at 540 nm using an ELx800 multiplate reader (BioTek®). In vitro Matrigel™ adhesion. Cell-matrix adhesion was examined using an in vitro Matrigel adhesion assay adapted from a previously described method.9 Cells were seeded into 96-well plates precoated with 5 g Matrigel basement membrane matrix. After 45 minutes of incubation the cells were subjected to vigorous washing to remove unbound cells. The remaining adherent cells were fixed, stained, visualized under microscopy and counted. In vitro Matrigel invasion. Cellular invasiveness was examined using an in vitro Matrigel invasion assay, as previously described and modified.10 Well plate inserts (Greiner Bio-One, Stonehouse, United Kingdom) with an 8.0 m pore were coated with 50 g Matrigel basement membrane, air dried and rehydrated before seeding 20,000 cells per insert. After 72 hours of incubation cells that had invaded through the Matrigel layer to the underside of the insert were fixed, stained and counted under microscopy. The ability of the cytokine HGF to contribute to cell invasiveness was also studied. PC-3WT, PC-3pEF6 and EPLIN EXP samples treated with 40 ng/ml HGF were PC-3 tested beside those containing only normal culture medium. In vivo tumor development. An in vivo tumor growth and development assay was used to examine the role of EPLIN␣ over expression in the in vivo tumor growth and development of the PC-3 prostate cancer cell line. This
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
model was adapted from previously described protocols.11,12 A suspension of 500,000 control PC-3pEF6 or PC-3EPLIN EXP cells in 0.5 mg/ml Matrigel was subcutaneously injected into the left and right flanks of 4 to 6-weekold CD-1 athymic nude mice (Charles Rivers Laboratories, Manston, United Kingdom). Mice were kept and maintained in accordance with the guidelines of the United Kingdom Home Office and United Kingdom Coordinating Committee on Cancer Research. They were weighed and tumors were measured weekly. Tumor volume at each time point was calculated using the formula, tumor volume ⫽ 0.523 ⫻ width2 ⫻ length.
Immunofluorescence Staining Cells were seeded into a 16-well Lab-Tek™ chamber slide at a density of 20,000 cells per well and incubated overnight before receiving 40 ng/ml HGF or normal medium for 2 hours. After treatment the cells were fixed in ice-cold ethanol at ⫺20C for 20 minutes. Immunofluorescence staining for paxillin was performed using anti-paxillin primary antibody (BD Transduction Laboratories™) and fluorescein isothiocyanate conjugated anti-mouse secondary antibody (Insight Biotechnology, Wembley, United Kingdom). The slides were mounted with FluorSave™ and visualized under an Olympus® BX51 microscope at 100⫻ objective magnification.
Statistical Analysis Experimental procedures were repeated a minimum of 3 times. Minitab® 14 was used to analyze differences between EPLIN␣ over expression in cell and control groups using the 2-sample 2-tailed t test. In vivo tumor development during the experimental procedure was analyzed using SigmaPlot® and 2-way ANOVA to highlight any statistical differences between PC-3EPLIN EXP and PC-3pEF6 tumor development. Statistical significance was considered at p ⬍0.05.
RESULTS EPLIN Expression IHC staining of a sample of normal and cancerous prostate sections was used to assess EPLIN expression pattern in the clinical setting (fig. 1). EPLIN stained strongly positive in normal samples and was highly expressed in the epithelial content of sections, where staining seemed to be predominantly localized to the cell cytoplasm. In contrast, tumor sections showed much decreased EPLIN staining throughout the sections, suggesting that EPLIN expression is much weaker in clinical prostate sections than in normal prostate sections. Statistical comparisons after sample quantification revealed significantly decreased EPLIN staining in cancerous than in normal tissue (p ⫽ 0.004). However, no significant differences were seen between Gleason 6 and 7 samples (p ⫽ 0.169), or between stage T1 and T2 samples (p ⫽ 0.248).
297
EPLIN Over Expression Negatively impacted PC-3 prostate cancer cell growth in vitro and in vivo. The growth capacity of PC-3 cells containing the EPLIN␣ expression plasmid was examined compared to that in PC-3 control cell lines. In vitro EPLIN over expression negatively influenced the growth rate of the PC-3 prostate cancer cell line (fig. 2, B). PC-3EPLIN EXP cells had a significantly decreased growth rate compared to that of PC-3pEF6 and PC-3WT control cells during the 3 and 5-day incubation periods (each p ⬍0.01). This difference did not seem to be due to alterations in the apoptosis rate with similar rates observed in control and test cells (data not shown). A similar trend was observed in vivo. PC-3EPLIN EXP cells subcutaneously injected into CD-1 nude mice generally developed at a slower pace than PC-3pEF6 control cells, which developed rapidly in vivo (fig. 2, C). A significant difference was observed between the tumor development of inoculated PC-3EPLIN EXP and PC-3pEF6 cells during the course of the experimental procedure (2-way ANOVA p ⫽ 0.002). Rendered prostate cancer cells less invasive. Enhanced EPLIN␣ expression in the PC-3 cell line resulted in a significant decrease in the in vitro invasiveness of this aggressive cell line (PC-3EPLIN EXP vs PC-3pEF6 and PC-3WT each p ⬍0.001, fig. 3). In addition to this finding, we noted that PC-3 cells over expressing EPLIN lost responsiveness to HGF. In control PC-3WT and PC-3pEF6 cells HGF treatment resulted in a significant increase in cellular invasiveness (medium control vs HGF p ⫽ ⬍0.001 and 0.047, respectively). However, when PC-3EPLIN EXP cells were treated with HGF, no significant increase in invasiveness was observed (vs medium control p ⫽ 0.79). This suggests that PC-3EPLIN EXP cells were no longer responsive to the enhanced invasiveness induced by HGF. EPLIN Impact Forced expression of EPLIN␣ in PC-3 cells negatively impacted the ability of this cell line to adhere to extracellular matrix (fig. 4, A). Significantly fewer PC-3EPLIN EXP cells adhered to extracellular matrix than plasmid control PC-3pEF6 cells (p ⫽ 0.028). To further investigate the role of EPLIN in extracellular matrix binding we examined the expression pattern of the paxillin adhesion molecule using immunofluorescence cell staining. PC-3 cells over expressing EPLIN␣ had greater paxillin staining intensity than wild-type cells (fig. 4, B). Paxillin localization was also observed around the periphery of cells at the site of focal adhesion complexes. Treatment of cells with HGF cytokine did not seem to have any substantial effects on paxillin staining intensity in wildtype cells or those that over expressed EPLIN␣.
298
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
Figure 1. IHC staining demonstrates EPLIN expression in clinical prostate sections. A, representative normal and tumor samples show EPLIN differential expression in prostate cancer tissues. B to D, statistical comparison after quantifying staining intensity revealed significant decrease in EPLIN expression between normal and cancer samples (p ⫽ 0.004). No differences were noted between Gleason 6 and 7 (p ⫽ 0.169) or stage T1 and T2 (p ⫽ 0.248).
DISCUSSION EPLIN was initially identified as a gene demonstrating differential expression between normal and HPV immortalized oral keratinocytes.1 EPLIN has been functionally linked with the cytoskeleton and the cytokinesis process,4 – 6 and EPLIN expression is often lost in cancerous cells and tissues compared to their normal counterparts.2,8 In the current study we examined EPLIN levels in a cohort of prostate tissues and examined the effect of EPLIN␣ over expression in the aggressive PC-3 human prostate cancer cell line. IHC analysis and staining quantification of a panel of prostate sections revealed a modest decrease in EPLIN expression in cancerous vs normal tissues (p ⫽ 0.004). These data are in line with the current literature, again suggesting decreased EPLIN expression in cancerous prostate tissue. The data
are also consistent with another study at our laboratory of EPLIN expression in a breast tissue cohort, in which IHC was similarly used to determine decreased EPLIN levels in clinical breast cancer sections compared with their normal counterparts.8 This breast cancer study also indicated that lower transcript levels of EPLIN␣ were associated with higher grade and TNM score, and linked to poor Nottingham Prognostic Index prognosis and a lower patient survival rate. However, in the current study we noted no significant differences between Gleason 6 and 7 or stage T1 and T2 samples after tissue staining quantification. This may have been partially due to our relatively small sample size. Future study is required to examine these trends in larger cohorts. In the current study EPLIN␣ over expression resulted in a decrease in the in vitro growth rate of
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
299
pendent growth of EPLIN expressing NIH3T3 cells transformed with Cdc42 or the chimeric nuclear oncogene EWS/Fli-1, in which EPLIN remains localized to actin filaments, but not in Ras transformed NIH3T3 cells, in which EPLIN is distributed heterogeneously throughout the cytoplasm.13 EPLIN␣ over expression in MDA-MB-231 breast cancer cells decreased in vitro and in vivo growth, invasiveness and motility.8 This is consistent with the current study, which demonstrated similar growth rate inhibition as well as decreased invasiveness of PC-3 cells after EPLIN␣ over expression. However, the in vivo model that we used showed only growth of the primary tumor. Due to the role of EPLIN in motility and invasiveness it is important in the future to study metastatic progression using additional in vivo models. EPLIN␣ over expression also seems to inhibit the pro-invasive effect of the cytokine HGF on PC-3 cells.
Figure 2. EPLIN␣ role in PC-3 prostate cancer cells in vitro and in vivo growth. A, cell transfection with EPLIN expression plasmid successfully enhanced cell EPLIN expression. B, EPLIN␣ over expression significantly decreased 3 and 5-day growth rate of cells in vitro, as indicated by decreased cell density measured by extracted stain absorbance. C, PC-3EPLIN EXP cells injected subcutaneously in CD-1 athymic nude mice developed more slowly than PC-3pEF6 control, forming smaller tumors during experimental course (p ⫽ 0.002).
PC-3 cells during the 3 and 5-day incubation periods, and also resulted in decreased tumor development of PC-3 cells subcutaneously injected into CD-1 athymic nude mice. The difference in the growth rate was not due to differences in the apoptotic rate (data not shown). Future study is required to focus on potential mechanisms to account for these differences in growth, which may include factors such as slowed progression through the cell cycle. The ability of EPLIN to suppress growth effectively may be linked to its location in cells. A previous study revealed the inhibition of anchorage inde-
Figure 3. EPLIN␣ over expression significantly decreased number of invasive PC-3EPLIN EXP prostate cancer cells compared to control PC-3WT and PC-3pEF6 cells (vs control p ⬍0.001). Treatment with 40 ng/ml of cytokine HGF significantly enhanced invasive potential of PC-3WT and PC-3pEF6 controls (vs untreated equivalent p ⬍0.001 and 0.047, respectively). PC-3EPLIN EXP cells were unresponsive to HGF pro-invasive effect and no significant difference was noted between treated and untreated groups.
300
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
Figure 4. EPLIN␣ over expression. A, over expression decreased ability of PC-3 cells to attach to Matrigel basement membrane (vs PC-3pEF6 controls p ⫽ 0.028). B, over expression also enhanced staining of paxillin adhesion molecule around cell periphery vs that in nontransfected PC-3 cells. HGF treatment of control or transfected cells showed no further impact on paxillin staining intensity or localization.
The importance of HGF in cancer and its capacity to enhance various aggressive protumorigenic traits are well established.14 In keeping with this role for HGF, treatment of wild-type and plasmid control PC-3 cells with HGF substantially enhanced their invasive capacity. However, PC-3 cells over expressing EPLIN␣ showed no such enhanced invasiveness after HGF treatment. To our knowledge the precise mechanism by which EPLIN␣ interferes with this and whether EPLIN␣ contributes directly to HGF signaling are currently unknown. Previous studies suggested that the interaction of EPLIN with cytoskeletal components such as actin filaments may act to inhibit cell movement and invasion.4,5,15 Thus, the inhibitory role of EPLIN in these processes may indirectly oppose the pro-invasive effect of HGF, although further study is necessary to highlight potential mechanisms. EPLIN␣ over expression also impacted cell-matrix adhesion, significantly decreasing it compared to that of plasmid control PC-3 cells. In light of this result immunofluorescence staining was performed to examine the paxillin adhesion molecule. Paxillin staining in EPLIN␣ over expressing PC-3 cells seemed enhanced compared to that in control cells and paxillin staining was observed around the cellular periphery. EPLIN␣ over expression in human HECV endothelial cells also suggests a similar relationship between EPLIN␣, cell-matrix adhesion and paxillin expression.7 In addition, early studies
showed a frequent overlap between EPLIN and paxillin staining, and suggested that EPLIN may also be present in focal adhesion plaques.2 EPLIN has been linked to cell-cell adhesion through its interaction with cadherin-catenin complex binding to F-actin.5 This molecule may have some relationship with the paxillin adhesion molecule and may also have a role in regulating cellular adhesion to the extracellular matrix, although further research is required to fully examine this potential. The ability of EPLIN to negatively impact the aggressive nature of prostate cancer cells together with its decrease during cancer progression demonstrates the potential of this molecule. Future studies are warranted that focus on the generation and efficacy of a recombinant form of EPLIN to treat prostate cancer in vitro and in vivo as well as large-scale studies of its reliability as a biomarker that is lost in cancer progression.
CONCLUSIONS The current study provides data supporting a tumor suppressive role for EPLIN␣ and suggests that EPLIN␣ can act to inhibit aggressive traits in prostate cancer cells in vitro and in vivo. Further research is required in this field to fully elucidate the mechanism(s) of action through which EPLIN␣ causes the inhibition of these cellular traits.
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
301
REFERENCES 1. Chang DD, Park NH, Denny CT et al: Characterization of transformation related genes in oral cancer cells. Oncogene 1998; 16: 1921. 2. Maul RS and Chang DD: EPLIN, Epithelial protein lost in neoplasm. Oncogene 1999; 18: 7838. 3. Chen S, Maul RS, Kim HR et al: Characterization of the human EPLIN (Epithelial Protein Lost in Neoplasm) gene reveals distinct promoters for the two EPLIN isoforms. Gene 2000; 248: 69.
7. Sanders AJ, Ye L, Mason MD et al: The impact of EPLINalpha (Epithelial protein lost in neoplasm) on endothelial cells, angiogenesis and tumorigenesis. Angiogenesis 2010; 13: 317. 8. Jiang WG, Martin TA, Lewis-Russell JM et al: Eplin-alpha expression in human breast cancer, the impact on cellular migration and clinical outcome. Molecular Cancer 2008; 7: 71.
4. Maul RS, Song Y, Amann KJ et al: EPLIN regulates actin dynamics by cross-linking and stabilizing filaments. J Cell Biol 2003; 160: 399.
9. Jiang WG, Hiscox S, Hallett MB et al: Inhibition of invasion and motility of human colon cancer cells by gamma linolenic acid. Br J Cancer 1995; 71: 744.
5. Abe K and Takeichi M: EPLIN mediates linkage of the cadherin catenin complex to F-actin and stabilizes the circumferential actin belt. Proc Natl Acad Sci USA 2008; 105: 13.
10. Jiang WG, Hiscox S, Hallett MB et al: Regulation of the expression of E-cadherin on human cancer cells by gamma linolenic acid. Cancer Res 1995; 55: 5043.
6. Chircop M, Oakes V, Graham ME et al: The actin-binding and bundling protein, EPLIN, is required for cytokinesisa. Cell Cycle 2009; 8: 757.
11. Martin TA, Parr C, Davies G et al: Growth and angiogenesis of human breast cancer in a nude mouse tumour model is reduced by NK4, a
HGF/SF antagonist. Carcinogenesis 2003; 24: 1317. 12. Jiang WG, Davies G, Martin TA et al: Targeting matrilysin and its impact on tumour growth in vivo: the potential implications in breast cancer therapy. Clin Cancer Res 2005; 11: 6012. 13. Song Y, Maul RS, Gerbin CS et al: Inhibition of anchorage-independent growth of transformed NIH3T3 cells by epithelial protein lost in neoplasm (EPLIN) requires localization of EPLIN to actin cytoskeleton. Mol Biol Cell 2002; 13: 1408. 14. Jiang WG, Martin TA, Parr C et al: Hepatocyte growth factor, its receptor, and their potential value in cancer therapies. Crit Rev Oncol Hematol 2005; 53: 35. 15. Han MY, Kosako H, Watanabe T et al: Extracellular signal-regulated kinase/mitogen-activated protein kinase regulates actin organization and cell motility by phosphorylating the actin crosslinking protein EPLIN. Mol Cell Biol 2007; 27: 8190.
Purpose: We investigated the importance of EPLIN, a cytoskeletal associated protein implicated in cancer, in clinical prostate cancer and its role in the PC-3 prostate cancer cell line (ATCC™). Materials and Methods: Full-length human EPLIN cDNA was cloned into a pEF6 expression vector and used to transfect the PC-3 human prostate cancer cell line. Cells over expressing EPLIN were termed PC-3EPLIN EXP while wild-type and empty pEF6 vector control cells were designated PC-3WT and PC-3pEF6, respectively. The in vitro and in vivo impact of EPLIN on PC-3 cells was examined using a number of model assays. Results: EPLIN over expression in PC-3 cells resulted in a decrease in the growth rate of this cell line (mean ⫾ SD 0.6 ⫾ 0.17 for PC-3pEF6 cells vs 0.33 ⫾ 0.01 for PC-3EPLIN EXP cells, p ⬍0.01). PC-3EPLIN EXP cells were significantly less able to adhere to extracellular matrix than control cells (mean 61.0 ⫾ 12.4 vs 102.8 ⫾ 20.7, p ⫽ 0.028). Immunofluorescence staining showed an increased staining profile for paxillin in PC-3EPLIN EXP cells compared to wild-type cells. Conclusions: EPLIN over expression in the PC-3 cell line resulted in decreased in vivo and in vitro growth potential together with decreased cell invasiveness and ability to adhere to extracellular matrix, and enhanced paxillin staining. This further highlights the importance of EPLIN in regulating prostate cancer cell growth and aggressiveness, and suggests a possible connection between EPLIN and paxillin.
Abbreviations and Acronyms EPLIN ⫽ epithelial protein lost in neoplasm GAPDH ⫽ glyceraldehyde-3phosphate dehydrogenase HGF ⫽ hepatocyte growth factor IHC ⫽ immunohistochemistry PCR ⫽ polymerase chain reaction Submitted for publication September 10, 2010. Study received local ethics committee approval. Supported by Cancer Research Wales. * Correspondence: Metastasis and Angiogenesis Research Group, Cardiff University School of Medicine, Cardiff, CF14 4XN, United Kingdom (telephone: 44 29 2074 2893; FAX: 44 29 2076 1623; e-mail: [email protected]).
Key Words: prostate; prostatic neoplasms; EPLIN protein, human; paxillin; neoplasm invasiveness THE EPLIN gene was initially identified as being down-regulated in transformed vs normal oral keratinocytes.1 Subsequent studies revealed that EPLIN exists as 2 isoforms, EPLIN␣ and EPLIN, which differ from each other by approximately 160 amino acids and arise due to transcription initiation from 2 distinct promoter sites.2,3 EPLIN is expressed in various tissues and immunofluorescence studies have indicated its distribution in cytoplasm
in a fibrillar pattern, similar to that of actin fibers.2 A number of studies have suggested a role for EPLIN in regulating cytoskeletal dynamics, for which it influences actin stabilization, regulates actin turnover and links the cadherin-catenin complex to F-actin.4,5 A recent study also implied a role for EPLIN in cytokinesis and showed that EPLIN depletion results in mislocalization of key proteins during the final stages of cytokinesis.6 Studies
0022-5347/11/1861-0295/0 THE JOURNAL OF UROLOGY® © 2011 by AMERICAN UROLOGICAL ASSOCIATION EDUCATION
Vol. 186, 295-301, July 2011 Printed in U.S.A. DOI:10.1016/j.juro.2011.03.038
AND
RESEARCH, INC.
www.jurology.com
295
296
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
have also suggested possible links between EPLIN and paxillin with overlaps between EPLIN and paxillin staining patterns noted2 and enhanced levels of paxillin staining observed in HECV endothelial cells over expressing EPLIN.7 EPLIN␣ expression is often down-regulated in cancerous cells and tissues. Maul and Chang observed that EPLIN␣ expression was substantially down-regulated or lost in most oral cancer cell lines (8 of 8), breast cancer cell lines (5 of 6), prostate cancer cell lines (4 of 4) and xenograph tumors (3 of 3).2 A recent study done at our laboratory revealed that EPLIN␣ over expression decreased the invasiveness, in vitro and in vivo growth and development, and motility of the aggressive MDA-MB-231 breast cancer cell line.8 Also, examination of EPLIN levels using quantitative PCR and IHC staining in a cohort of breast cancer samples showed that lower EPLIN levels were associated with more aggressive cancer and poor patient outcome.8 Given the involvement of EPLIN with cytoskeletal dynamics and cytokinesis, it was suggested that the loss of EPLIN expression in cancerous cells may contribute to the genomic instability, and enhanced motility and invasiveness of these cancer cells.4 – 6 We examined the importance of EPLIN␣ in prostate cancer. The study demonstrated that EPLIN expression is dysregulated in clinical prostate cancer samples. We noted that EPLIN␣ over expression in PC-3 prostate cancer cells can influence aggressive traits, such as in vitro cell invasion, adhesion, growth and in vivo tumor development, in this aggressive prostate cancer cell line. We also found additional evidence suggesting a link between EPLIN and paxillin in PC-3 prostate cancer cells.
METHODS AND MATERIALS Clinical Sample Collection, Processing and IHC Staining Prostate tissue samples were snap frozen in liquid nitrogen immediately after transurethral prostatectomy, radical prostatectomy or prostate biopsy. Written consent was acquired for all patients and all protocols were reviewed by the local ethics committee. After collection 20 prostate tumor and 11 normal prostate tissue samples were sectioned using a cryostat and verified by 2 pathologists. IHC was performed using antiEPLIN antibody (Bethyl Laboratories, Montgomery, Texas) and the Vectastain® Elite Universal ABC Kit. Sections were visualized under microscopy and digital images were acquired. Staining intensity was quantified using ImageJ.
Cell Lines and Culture Conditions PC-3 cells were maintained in Dulbecco’s modified Eagle medium supplemented with penicillin, streptomycin and 10% fetal calf serum (PAA Laboratories, Yeovil, United
Kingdom). Cells were incubated at 37C with 95% humidity in 5% CO2.
Generation of PC-3 Cells Over Expressing EPLIN The full-length human EPLIN␣ cDNA sequence was isolated and amplified from normal tissue, and subsequently inserted into a pEF6 plasmid, as described previously.8 This expression plasmid was used to transfect the PC-3 prostate cancer cell line, which expresses this molecule at a minimal level. PC-3 cells containing the expression plasmid and showing amplified EPLIN␣ expression were termed PC-3EPLIN EXP. They were compared throughout to unmodified wild-type PC-3WT cells and PC-3pEF6 cells transfected with an empty pEF6 plasmid vector.
RNA Isolation and cDNA Synthesis RNA isolation was performed using Total RNA Isolation Reagent (ABgene™) and used to generate cDNA using an Enhanced Avian RT-PCR-100 Kit with anchored oligo(deoxythymidine) primers (Sigma®). cDNA quality was assessed using GAPDH primers. For EPLIN the primers were sense AAGCAAAAATGAAAACGAAG and antisense ACTGAACCTGACCGTACAGACACCCACCTTAGCAA. For GAPDH the primers were sense ATGATATCGCCGCGCTCA and antisense CGCTCGGTGAGGATCTTCA. PCR was done using standard methods.
Assays In vitro cell growth. Cells were seeded into duplicate 96-well plates at a seeding density of 3,000 cells per well. Plates were incubated for 3 or 5 days before assessing cell growth. Cells were stained with crystal violet and absorbance was determined at 540 nm using an ELx800 multiplate reader (BioTek®). In vitro Matrigel™ adhesion. Cell-matrix adhesion was examined using an in vitro Matrigel adhesion assay adapted from a previously described method.9 Cells were seeded into 96-well plates precoated with 5 g Matrigel basement membrane matrix. After 45 minutes of incubation the cells were subjected to vigorous washing to remove unbound cells. The remaining adherent cells were fixed, stained, visualized under microscopy and counted. In vitro Matrigel invasion. Cellular invasiveness was examined using an in vitro Matrigel invasion assay, as previously described and modified.10 Well plate inserts (Greiner Bio-One, Stonehouse, United Kingdom) with an 8.0 m pore were coated with 50 g Matrigel basement membrane, air dried and rehydrated before seeding 20,000 cells per insert. After 72 hours of incubation cells that had invaded through the Matrigel layer to the underside of the insert were fixed, stained and counted under microscopy. The ability of the cytokine HGF to contribute to cell invasiveness was also studied. PC-3WT, PC-3pEF6 and EPLIN EXP samples treated with 40 ng/ml HGF were PC-3 tested beside those containing only normal culture medium. In vivo tumor development. An in vivo tumor growth and development assay was used to examine the role of EPLIN␣ over expression in the in vivo tumor growth and development of the PC-3 prostate cancer cell line. This
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
model was adapted from previously described protocols.11,12 A suspension of 500,000 control PC-3pEF6 or PC-3EPLIN EXP cells in 0.5 mg/ml Matrigel was subcutaneously injected into the left and right flanks of 4 to 6-weekold CD-1 athymic nude mice (Charles Rivers Laboratories, Manston, United Kingdom). Mice were kept and maintained in accordance with the guidelines of the United Kingdom Home Office and United Kingdom Coordinating Committee on Cancer Research. They were weighed and tumors were measured weekly. Tumor volume at each time point was calculated using the formula, tumor volume ⫽ 0.523 ⫻ width2 ⫻ length.
Immunofluorescence Staining Cells were seeded into a 16-well Lab-Tek™ chamber slide at a density of 20,000 cells per well and incubated overnight before receiving 40 ng/ml HGF or normal medium for 2 hours. After treatment the cells were fixed in ice-cold ethanol at ⫺20C for 20 minutes. Immunofluorescence staining for paxillin was performed using anti-paxillin primary antibody (BD Transduction Laboratories™) and fluorescein isothiocyanate conjugated anti-mouse secondary antibody (Insight Biotechnology, Wembley, United Kingdom). The slides were mounted with FluorSave™ and visualized under an Olympus® BX51 microscope at 100⫻ objective magnification.
Statistical Analysis Experimental procedures were repeated a minimum of 3 times. Minitab® 14 was used to analyze differences between EPLIN␣ over expression in cell and control groups using the 2-sample 2-tailed t test. In vivo tumor development during the experimental procedure was analyzed using SigmaPlot® and 2-way ANOVA to highlight any statistical differences between PC-3EPLIN EXP and PC-3pEF6 tumor development. Statistical significance was considered at p ⬍0.05.
RESULTS EPLIN Expression IHC staining of a sample of normal and cancerous prostate sections was used to assess EPLIN expression pattern in the clinical setting (fig. 1). EPLIN stained strongly positive in normal samples and was highly expressed in the epithelial content of sections, where staining seemed to be predominantly localized to the cell cytoplasm. In contrast, tumor sections showed much decreased EPLIN staining throughout the sections, suggesting that EPLIN expression is much weaker in clinical prostate sections than in normal prostate sections. Statistical comparisons after sample quantification revealed significantly decreased EPLIN staining in cancerous than in normal tissue (p ⫽ 0.004). However, no significant differences were seen between Gleason 6 and 7 samples (p ⫽ 0.169), or between stage T1 and T2 samples (p ⫽ 0.248).
297
EPLIN Over Expression Negatively impacted PC-3 prostate cancer cell growth in vitro and in vivo. The growth capacity of PC-3 cells containing the EPLIN␣ expression plasmid was examined compared to that in PC-3 control cell lines. In vitro EPLIN over expression negatively influenced the growth rate of the PC-3 prostate cancer cell line (fig. 2, B). PC-3EPLIN EXP cells had a significantly decreased growth rate compared to that of PC-3pEF6 and PC-3WT control cells during the 3 and 5-day incubation periods (each p ⬍0.01). This difference did not seem to be due to alterations in the apoptosis rate with similar rates observed in control and test cells (data not shown). A similar trend was observed in vivo. PC-3EPLIN EXP cells subcutaneously injected into CD-1 nude mice generally developed at a slower pace than PC-3pEF6 control cells, which developed rapidly in vivo (fig. 2, C). A significant difference was observed between the tumor development of inoculated PC-3EPLIN EXP and PC-3pEF6 cells during the course of the experimental procedure (2-way ANOVA p ⫽ 0.002). Rendered prostate cancer cells less invasive. Enhanced EPLIN␣ expression in the PC-3 cell line resulted in a significant decrease in the in vitro invasiveness of this aggressive cell line (PC-3EPLIN EXP vs PC-3pEF6 and PC-3WT each p ⬍0.001, fig. 3). In addition to this finding, we noted that PC-3 cells over expressing EPLIN lost responsiveness to HGF. In control PC-3WT and PC-3pEF6 cells HGF treatment resulted in a significant increase in cellular invasiveness (medium control vs HGF p ⫽ ⬍0.001 and 0.047, respectively). However, when PC-3EPLIN EXP cells were treated with HGF, no significant increase in invasiveness was observed (vs medium control p ⫽ 0.79). This suggests that PC-3EPLIN EXP cells were no longer responsive to the enhanced invasiveness induced by HGF. EPLIN Impact Forced expression of EPLIN␣ in PC-3 cells negatively impacted the ability of this cell line to adhere to extracellular matrix (fig. 4, A). Significantly fewer PC-3EPLIN EXP cells adhered to extracellular matrix than plasmid control PC-3pEF6 cells (p ⫽ 0.028). To further investigate the role of EPLIN in extracellular matrix binding we examined the expression pattern of the paxillin adhesion molecule using immunofluorescence cell staining. PC-3 cells over expressing EPLIN␣ had greater paxillin staining intensity than wild-type cells (fig. 4, B). Paxillin localization was also observed around the periphery of cells at the site of focal adhesion complexes. Treatment of cells with HGF cytokine did not seem to have any substantial effects on paxillin staining intensity in wildtype cells or those that over expressed EPLIN␣.
298
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
Figure 1. IHC staining demonstrates EPLIN expression in clinical prostate sections. A, representative normal and tumor samples show EPLIN differential expression in prostate cancer tissues. B to D, statistical comparison after quantifying staining intensity revealed significant decrease in EPLIN expression between normal and cancer samples (p ⫽ 0.004). No differences were noted between Gleason 6 and 7 (p ⫽ 0.169) or stage T1 and T2 (p ⫽ 0.248).
DISCUSSION EPLIN was initially identified as a gene demonstrating differential expression between normal and HPV immortalized oral keratinocytes.1 EPLIN has been functionally linked with the cytoskeleton and the cytokinesis process,4 – 6 and EPLIN expression is often lost in cancerous cells and tissues compared to their normal counterparts.2,8 In the current study we examined EPLIN levels in a cohort of prostate tissues and examined the effect of EPLIN␣ over expression in the aggressive PC-3 human prostate cancer cell line. IHC analysis and staining quantification of a panel of prostate sections revealed a modest decrease in EPLIN expression in cancerous vs normal tissues (p ⫽ 0.004). These data are in line with the current literature, again suggesting decreased EPLIN expression in cancerous prostate tissue. The data
are also consistent with another study at our laboratory of EPLIN expression in a breast tissue cohort, in which IHC was similarly used to determine decreased EPLIN levels in clinical breast cancer sections compared with their normal counterparts.8 This breast cancer study also indicated that lower transcript levels of EPLIN␣ were associated with higher grade and TNM score, and linked to poor Nottingham Prognostic Index prognosis and a lower patient survival rate. However, in the current study we noted no significant differences between Gleason 6 and 7 or stage T1 and T2 samples after tissue staining quantification. This may have been partially due to our relatively small sample size. Future study is required to examine these trends in larger cohorts. In the current study EPLIN␣ over expression resulted in a decrease in the in vitro growth rate of
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
299
pendent growth of EPLIN expressing NIH3T3 cells transformed with Cdc42 or the chimeric nuclear oncogene EWS/Fli-1, in which EPLIN remains localized to actin filaments, but not in Ras transformed NIH3T3 cells, in which EPLIN is distributed heterogeneously throughout the cytoplasm.13 EPLIN␣ over expression in MDA-MB-231 breast cancer cells decreased in vitro and in vivo growth, invasiveness and motility.8 This is consistent with the current study, which demonstrated similar growth rate inhibition as well as decreased invasiveness of PC-3 cells after EPLIN␣ over expression. However, the in vivo model that we used showed only growth of the primary tumor. Due to the role of EPLIN in motility and invasiveness it is important in the future to study metastatic progression using additional in vivo models. EPLIN␣ over expression also seems to inhibit the pro-invasive effect of the cytokine HGF on PC-3 cells.
Figure 2. EPLIN␣ role in PC-3 prostate cancer cells in vitro and in vivo growth. A, cell transfection with EPLIN expression plasmid successfully enhanced cell EPLIN expression. B, EPLIN␣ over expression significantly decreased 3 and 5-day growth rate of cells in vitro, as indicated by decreased cell density measured by extracted stain absorbance. C, PC-3EPLIN EXP cells injected subcutaneously in CD-1 athymic nude mice developed more slowly than PC-3pEF6 control, forming smaller tumors during experimental course (p ⫽ 0.002).
PC-3 cells during the 3 and 5-day incubation periods, and also resulted in decreased tumor development of PC-3 cells subcutaneously injected into CD-1 athymic nude mice. The difference in the growth rate was not due to differences in the apoptotic rate (data not shown). Future study is required to focus on potential mechanisms to account for these differences in growth, which may include factors such as slowed progression through the cell cycle. The ability of EPLIN to suppress growth effectively may be linked to its location in cells. A previous study revealed the inhibition of anchorage inde-
Figure 3. EPLIN␣ over expression significantly decreased number of invasive PC-3EPLIN EXP prostate cancer cells compared to control PC-3WT and PC-3pEF6 cells (vs control p ⬍0.001). Treatment with 40 ng/ml of cytokine HGF significantly enhanced invasive potential of PC-3WT and PC-3pEF6 controls (vs untreated equivalent p ⬍0.001 and 0.047, respectively). PC-3EPLIN EXP cells were unresponsive to HGF pro-invasive effect and no significant difference was noted between treated and untreated groups.
300
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
Figure 4. EPLIN␣ over expression. A, over expression decreased ability of PC-3 cells to attach to Matrigel basement membrane (vs PC-3pEF6 controls p ⫽ 0.028). B, over expression also enhanced staining of paxillin adhesion molecule around cell periphery vs that in nontransfected PC-3 cells. HGF treatment of control or transfected cells showed no further impact on paxillin staining intensity or localization.
The importance of HGF in cancer and its capacity to enhance various aggressive protumorigenic traits are well established.14 In keeping with this role for HGF, treatment of wild-type and plasmid control PC-3 cells with HGF substantially enhanced their invasive capacity. However, PC-3 cells over expressing EPLIN␣ showed no such enhanced invasiveness after HGF treatment. To our knowledge the precise mechanism by which EPLIN␣ interferes with this and whether EPLIN␣ contributes directly to HGF signaling are currently unknown. Previous studies suggested that the interaction of EPLIN with cytoskeletal components such as actin filaments may act to inhibit cell movement and invasion.4,5,15 Thus, the inhibitory role of EPLIN in these processes may indirectly oppose the pro-invasive effect of HGF, although further study is necessary to highlight potential mechanisms. EPLIN␣ over expression also impacted cell-matrix adhesion, significantly decreasing it compared to that of plasmid control PC-3 cells. In light of this result immunofluorescence staining was performed to examine the paxillin adhesion molecule. Paxillin staining in EPLIN␣ over expressing PC-3 cells seemed enhanced compared to that in control cells and paxillin staining was observed around the cellular periphery. EPLIN␣ over expression in human HECV endothelial cells also suggests a similar relationship between EPLIN␣, cell-matrix adhesion and paxillin expression.7 In addition, early studies
showed a frequent overlap between EPLIN and paxillin staining, and suggested that EPLIN may also be present in focal adhesion plaques.2 EPLIN has been linked to cell-cell adhesion through its interaction with cadherin-catenin complex binding to F-actin.5 This molecule may have some relationship with the paxillin adhesion molecule and may also have a role in regulating cellular adhesion to the extracellular matrix, although further research is required to fully examine this potential. The ability of EPLIN to negatively impact the aggressive nature of prostate cancer cells together with its decrease during cancer progression demonstrates the potential of this molecule. Future studies are warranted that focus on the generation and efficacy of a recombinant form of EPLIN to treat prostate cancer in vitro and in vivo as well as large-scale studies of its reliability as a biomarker that is lost in cancer progression.
CONCLUSIONS The current study provides data supporting a tumor suppressive role for EPLIN␣ and suggests that EPLIN␣ can act to inhibit aggressive traits in prostate cancer cells in vitro and in vivo. Further research is required in this field to fully elucidate the mechanism(s) of action through which EPLIN␣ causes the inhibition of these cellular traits.
EPLIN IS NEGATIVE REGULATOR OF PROSTATE CANCER GROWTH AND INVASION
301
REFERENCES 1. Chang DD, Park NH, Denny CT et al: Characterization of transformation related genes in oral cancer cells. Oncogene 1998; 16: 1921. 2. Maul RS and Chang DD: EPLIN, Epithelial protein lost in neoplasm. Oncogene 1999; 18: 7838. 3. Chen S, Maul RS, Kim HR et al: Characterization of the human EPLIN (Epithelial Protein Lost in Neoplasm) gene reveals distinct promoters for the two EPLIN isoforms. Gene 2000; 248: 69.
7. Sanders AJ, Ye L, Mason MD et al: The impact of EPLINalpha (Epithelial protein lost in neoplasm) on endothelial cells, angiogenesis and tumorigenesis. Angiogenesis 2010; 13: 317. 8. Jiang WG, Martin TA, Lewis-Russell JM et al: Eplin-alpha expression in human breast cancer, the impact on cellular migration and clinical outcome. Molecular Cancer 2008; 7: 71.
4. Maul RS, Song Y, Amann KJ et al: EPLIN regulates actin dynamics by cross-linking and stabilizing filaments. J Cell Biol 2003; 160: 399.
9. Jiang WG, Hiscox S, Hallett MB et al: Inhibition of invasion and motility of human colon cancer cells by gamma linolenic acid. Br J Cancer 1995; 71: 744.
5. Abe K and Takeichi M: EPLIN mediates linkage of the cadherin catenin complex to F-actin and stabilizes the circumferential actin belt. Proc Natl Acad Sci USA 2008; 105: 13.
10. Jiang WG, Hiscox S, Hallett MB et al: Regulation of the expression of E-cadherin on human cancer cells by gamma linolenic acid. Cancer Res 1995; 55: 5043.
6. Chircop M, Oakes V, Graham ME et al: The actin-binding and bundling protein, EPLIN, is required for cytokinesisa. Cell Cycle 2009; 8: 757.
11. Martin TA, Parr C, Davies G et al: Growth and angiogenesis of human breast cancer in a nude mouse tumour model is reduced by NK4, a
HGF/SF antagonist. Carcinogenesis 2003; 24: 1317. 12. Jiang WG, Davies G, Martin TA et al: Targeting matrilysin and its impact on tumour growth in vivo: the potential implications in breast cancer therapy. Clin Cancer Res 2005; 11: 6012. 13. Song Y, Maul RS, Gerbin CS et al: Inhibition of anchorage-independent growth of transformed NIH3T3 cells by epithelial protein lost in neoplasm (EPLIN) requires localization of EPLIN to actin cytoskeleton. Mol Biol Cell 2002; 13: 1408. 14. Jiang WG, Martin TA, Parr C et al: Hepatocyte growth factor, its receptor, and their potential value in cancer therapies. Crit Rev Oncol Hematol 2005; 53: 35. 15. Han MY, Kosako H, Watanabe T et al: Extracellular signal-regulated kinase/mitogen-activated protein kinase regulates actin organization and cell motility by phosphorylating the actin crosslinking protein EPLIN. Mol Cell Biol 2007; 27: 8190.