EPLIN

Cancer Letters 390 (2017) 58e66

Contents lists available at ScienceDirect

Cancer Letters journal homepage: www.elsevier.com/locate/canlet

Original Article

p53 mediates the suppression of cancer cell invasion by inducing LIMA1/EPLIN Tomoko Ohashi a, b, 1, Masashi Idogawa a, *, 1, Yasushi Sasaki a, Takashi Tokino a, * a b

Department of Medical Genome Sciences, Research Institute for Frontier Medicine, Sapporo Medical University School of Medicine, Japan Research Fellow of Japan Society for the Promotion of Science, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 October 2016 Received in revised form 7 December 2016 Accepted 29 December 2016

The tumor suppressor gene p53 is frequently mutated in human cancer. p53 executes various functions, such as apoptosis induction and cell cycle arrest, by modulating transcriptional regulation. In this study, LIM domain and Actin-binding protein 1 (LIMA1) was identified as a target of the p53 family using a cDNA microarray. We also evaluated genome-wide occupancy of the p53 protein by performing chromatin immunoprecipitation-sequencing (ChIP-seq) and identified two p53 response elements in the LIMA1 gene. LIMA1 protein levels were increased by treatment with nutlin-3a, a small molecule that activates endogenous p53. In addition, LIMA1 expression was significantly downregulated in cancers compared with normal tissues. Knockdown of LIMA1 significantly enhanced cancer cell invasion and partially inhibited p53-induced suppression of cell invasion. Furthermore, low expression of LIMA1 in cancer patients correlated with decreased survival and poor prognosis. Thus, p53-induced LIMA1 inhibits cell invasion, and the downregulation of LIMA1 caused by p53 mutation results in decreased survival in cancer patients. Collectively, this study reveals the molecular mechanism of LIMA1 downregulation in various cancers and suggests that LIMA1 may be a novel prognostic predictor and a therapeutic target for cancer. © 2017 Elsevier B.V. All rights reserved.

Keywords: LIMA1 EPLIN p53 Invasion Prognosis

Introduction p53 is one of the most important tumor suppressor genes and is frequently mutated in human cancer. Furthermore, mutation or deletion of p53 is related to poor prognosis and resistance to chemotherapy and radiation. The p53 protein is activated by a variety of cell stresses, including DNA damage, oncogene activation, spindle damage and hypoxia, and activated p53 transactivates a number of target genes, many of which are involved in DNA repair, cell cycle arrest and apoptosis. MicroRNAs and long non-coding RNAs (lncRNAs) play important roles in various biological and pathological processes. Our previous study revealed that p53 transactivates not only coding genes but also lncRNAs, and knockdown of specific lncRNAs modulates p53-induced apoptosis [1].

* Corresponding authors. S1W17, Chuo-Ku, Sapporo, 060-8556, Japan. Fax: þ81 11 618 3313. E-mail addresses: [email protected] (M. Idogawa), [email protected] (T. Tokino). 1 Contributed equally to this work. http://dx.doi.org/10.1016/j.canlet.2016.12.034 0304-3835/© 2017 Elsevier B.V. All rights reserved.

Therefore, many studies have sought to identify target genes of p53 and its family members because these proteins execute diverse functions, primarily through transcriptional regulation. Although a number of p53 target genes have been identified, the p53 downstream pathway involved in cancer invasion and metastasis remains unclear. To fully characterize the p53 pathways, we compared mRNA expression between H1299 cells overexpressing p53 family members and control cells by performing a cDNA microarray. The results identified LIM domain and Actin-binding protein 1 (LIMA1) as a direct target of the p53 family. LIMA1, also known as EPLIN (Epithelial Protein Lost In Neoplasm), was initially identified as an actin-binding protein that is preferentially expressed in human epithelia but frequently lost in cancers [2,3]. LIMA1 is involved in actin cytoskeleton regulation and dynamics and has multiple associations at epithelial cell junctions [4,5]. However, LIMA1 expression is frequently lost in various cancers, such as breast [6], prostate [7], esophageal [8] and lung cancers [9], suggesting important implications for cancer cell migration and invasion and increasing metastatic potential [10]. In this current study, we elucidated the molecular mechanism underlying LIMA1 downregulation in various cancers. LIMA1

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66

knockdown inhibited the suppression of cancer cell invasion induced by p53 and also inhibited tumor suppression in vivo when nutlin-3a, a small molecule that activates endogenous p53, was administered. Thus, the induction of LIMA1 expression is required for the tumor suppressor functions of p53. Materials and methods Cell culture Human osteosarcoma Saos-2 cells, colon cancer Lovo and SW480 cells, breast cancer MCF7, MDA-MB-231, and MDA-MB-361 cells, and lung cancer A549, Lu99 and H1299 cells were purchased from the American Type Culture Collection and the Japan Collection of Research Bioresources. The construction, purification, and infection of replication-deficient recombinant adenoviruses containing FLAG-tagged p53 (Ad-p53), TAp63g (Ad-p63g) and TAp73b (Ad-p73b) or the bacterial lacZ gene (Ad-LacZ) were described previously [11,12]. Chromatin immunoprecipitation (ChIP)

59

samples were fractionated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto Immobilon-P membranes (Millipore). Immunoreactive proteins were detected using enhanced chemiluminescence (ECL: GE Healthcare). Reverse transcription (RT)-PCR Total RNA was prepared from the cell lines using an RNeasy Mini kit (Qiagen). For RT-PCR analysis, cDNA was synthesized from 5 mg of total RNA with SuperScript III (Life Technologies). Quantitative PCR (qPCR) was performed using TaqMan Gene Expression assay kits and a 7900HT real-time PCR system (Applied Biosystems, Carlsbad, CA, USA) according to the manufacturer's protocol. Relative gene expression levels were quantified using the DDCt method by normalizing transcript levels to the expression of the housekeeping gene glyceraldehyde-3phosphate dehydrogenase. The data are presented as the mean ± standard error (SE) of three independent experiments. The following primer/probe sets were used: LIMA1, Hs01035646_m1; CDKN1A, Hs00355782_m1; and GAPDH, Hs99999905_m1. Luciferase reporter assay

H1299 cells were infected with Ad-p53, p63g, p73b, and LacZ at a multiplicity of infection (MOI) of 25. Twenty-four hours after infection, these cells were subjected to ChIP with an anti-FLAG antibody or normal mouse IgG as a control using a ChIP Assay Kit (Upstate) according to the manufacturer's protocol. ChIP-sequencing (ChIP-seq) data were deposited in the DDBJ sequence read archive (DRA, accession number: DRA000614) in our previous study [1]. Primer sequences for PCR were GAAACAGCAGTGGACCAGGA and TGCTGGGAGAGATTTTCGGT for LIMA1-RE1 and AAGTTGCCCAGGGATCATTA and TGTCCTAGATTGCTCCTGCAT for LIMA1-RE2. GoTaq (Promega) was used for PCR.

LIMA1-RE1 (AGGCAAGTTa tAACTgGCaT), the RE1 mutant (AGGaAAtTTa tAAaTgtCaT), RE2 (GGACAgaaCT AGACAAGCCC), and the RE2 mutant (GGAaAgaaCT AGAaAAtCCC) were subcloned into the pGL3-promoter plasmid (Promega). Cells were transiently transfected in triplicate with the luciferase reporter phRG-TK (Promega), and expression vectors for p53, p63g, p73b or MOCK were inserted into pCMV-Tag2-FLAG (Stratagene) using Lipofectamine 2000 (Life Technologies). Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega). Renilla luciferase activity was used as an internal control.

Antibodies and reagents

Establishment of stable cell lines

Nutlin-3a and adriamycin was purchased from Sigma. An anti-FLAG (M2) mouse antibody was purchased from Sigma. An anti-LIMA1 rabbit antibody was purchased from Novus Biologicals. Anti-p53 (DO-1), anti-p63 (4A4), anti-MDM2 (SMP14) and anti-p21 (F-5) mouse antibodies were purchased from Santa Cruz Biotechnology. Anti-p73 (Ab-2) and anti-actin mouse antibodies were purchased from Millipore.

H1299 cells were transfected with a plasmid vector (pFN21A, Promega) expressing LIMA1 or empty vector as control. Twenty-four hours after transfection, these cells were cultured in media containing G418 (1 mg/ml), and resistant cells were selected. A549, Lu99 and MDA-MB-361 cells were infected with lentivirus (MISSION Lentiviral Transduction Particles: TRCN0000149941, Sigma) expressing shRNA-LIMA1 or negative control shRNA (MISSION pLKO.1-puro Non-Target shRNA Control Transduction: SHC016V, Sigma). Twenty-four hours after infection, these cells were cultured in media containing puromycin (1 mg/ml for A549 cells, 2 mg/ml for Lu99 cells and 10 mg/ml for MDA-MB-361 cells), and resistant cells were selected.

Western blot analysis Total cell lysates were extracted at 4  C with RIPA buffer (150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS and 50 mM Tris HCl, pH 8.0). The

A Relative expression (log2, LacZ=0)

B

p53

p63γ

p73β

LIMA1

3.55

3.87

2.56

CDKN1A

5.48

3.33

2.01

Relative expression (log2, LacZ=0)

Saos-2

H1299

7

7

6

6

5

5

4

4

3

3

2

2

1

1

p53 p63γ p73β

0

0 LIMA1

CDKN1A

LIMA1

CDKN1A

Fig. 1. The induction of LIMA1 mRNA expression by the p53 family. Twenty-four hours after infection with adenoviral vectors expressing LacZ (control), p53, p63g or p73b at an MOI of 25, mRNA expression was analyzed using a cDNA microarray. The relative expression of LIMA1 and CDKN1A (p21) is indicated as log2 values with LacZ ¼ 0 (A). LIMA1 and CDKN1A (p21) expression was quantified by RT-qPCR in Saos-2 and H1299 cells (B). The averages of three experiments are indicated as log2 values with LacZ. Error bars indicate the standard deviation (SD).

60

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66

Cell invasion Cell invasion was analyzed using Matrigel invasion chambers (CORNING) following the manufacturer's protocol. Briefly, cells were washed with PBS and then were resuspended in culture medium at the appropriate density according to the specific experiment. Equal volumes (0.5 ml/chamber) of the cell suspensions were seeded in the Matrigel invasion chambers, which were placed in 24-well culture plates containing 0.75 ml/well of culture medium supplemented with 10% fetal bovine serum. Cells that had invaded to the underside of the inserts after a 24 h incubation were stained and quantified by counting the cells from three microscopic fields. Cell invasiveness is expressed as the average number of invaded cells per microscopic field. Animal models All animals were maintained under specific-pathogen-free conditions and treated in accordance with guidelines set by the Animal Care and Use Committee of Sapporo Medical University. To evaluate the effects of nutlin-3a on established tumors, 8 female BALB/c nude mice were injected subcutaneously (s.c.) with 2  106 A549 cells infected with lentiviral shRNA-LIMA1 or control vector into both flanks. Treatment began when tumor sizes reached 100 mm3. Nutlin-3a (25 mg/kg) was administered as an intraperitoneal injection daily for 5 days followed by a 2-day rest period for a total of 2 weeks (a total of 10 injections). Tumor volumes were measured using calipers and calculated using the equation V (mm3) ¼ a  b2/2, where “a” represents the largest dimension and “b” is the perpendicular diameter.

deposited into the NCBI Gene Expression Omnibus (GEO, accession number: GSE86347). Genes with greater than 2-fold changes in expression in A549 cells stably infected with lentiviral shRNA-control vector (shRNA-cont A549 cells) treated with nutlin-3a (10 mM) compared with the same cells without nutlin-3a were selected for further analysis. The expression levels were converted to Z-scores and subjected to hierarchical clustering based on the average Euclidean distance using gplots (R package). Genes included in specific gene clusters were analyzed by DAVID (The Database for Annotation, Visualization and Integrated Discovery, https://david. ncifcrf.gov/) [15]. The analysis of gene expression datasets Four human cancer gene expression datasets (GEO: GSE20916, GSE5206, GSE10072 and GSE3744) and two gene expression datasets for human breast and colorectal cancers (The Cancer Genome Atlas: TCGA-COAD, TCGA-BRCA) were analyzed. In the three human cancer gene expression datasets that included survival information (GEO: GSE17537, GSE11121 and GSE14814), patients were divided into two groups, those exhibiting high and low LIMA1 expression, using the PrognoScan algorithm [16]. A survival curve was constructed via the KaplaneMeier method using survfit (R package). P-values were calculated from the log-rank test using survdiff (R package).

Results Transactivation of LIMA1 by the p53 family

RNA sequencing analysis RNA sequencing (RNA-seq) was performed using a HiSeq2500 (Illumina) according to the manufacturer's protocol. Acquired sequence reads were aligned to the human genome sequence (hg19) by TopHat2 [13]. The expression of each gene was quantified by Cuffquant and normalized by Cuffnorm [14]. The expression data were

Scale chr12

50 kb 50,600,000

B

hg19 50,650,000

Input

FLAG-IP

LacZ p53 p63γ p73β IgG-IP LacZ p53 p63γ p73β

A

In our previous study, we identified 223 genes exhibiting greater than 8-fold increased expression following infection with an adenovirus expressing p53 (Ad-p53) compared with control H1299

p53 motif p53

LIMA1-RE1

ChIP seq p63γ

LIMA1-RE2

p73β

TSS 11 10

9 8

7

65

2

1

LIMA1 exon

RE1 +61046 (bp)

RE1 reporter

0

0

*

*

40 35

12

*

*

* WT mut

30

10

25

8

20

6

15

4

10

2

5

0

0

p73β

1 p73β

0.5

p53

2

p63γ

1

MOCK

3

p63γ

1.5

p73β

4

p53

2

MOCK

*

5

14

p63γ

*

2.5

*

Saos-2

*

p53

6

MOCK

n.s.

H1299 Relative luciferase activity (MOCK=1)

Saos-2

H1299 3

RE2 reporter

p53

C

AtGCcAGTTa tAACTTGCCT

p63γ

GGGCTTGTCT AGttcTGTCC

Relative luciferase activity (MOCK=1)

3

MOCK

RE2 +113042

4

p73β

LIMA1

Fig. 2. p53 family response elements in the human LIMA1 gene. (A) The genomic positions of in silico p53 motifs and ChIP-seq peaks are indicated as gray bars and black peaks, respectively. The LIMA1 gene is also displayed as boxes connected by horizontal lines. Boxes indicate exons (wide box: open reading frame), horizontal lines indicate introns, and > marks on the line indicate the transcriptional direction. In silico p53 motif sequences corresponding to ChIP-seq peaks (RE1, RE2) and the distance of each transcription start site (TSS) from the LIMA1 gene are also displayed (base-matching and mismatching of the consensus p53 motif [RRRCWWGYYY RRRCWWGYYY] are shown in upper and lower case letters, respectively). (B) H1299 cells were infected with adenoviral vectors expressing LacZ, FLAG-p53, FLAG-p63g or FLAG-p73b at an MOI of 25. Twenty-four hours after infection, ChIP was performed with an anti-FLAG antibody or IgG as a control (top). ChIP products or input samples were amplified by PCR using primers for RE1 and RE2. (C) The relative luciferase activities of reporter vectors expressing RE1 (WT), RE2 (WT) or each mutant (mut) transfected into H1299 cells (p53 null) and Saos-2 cells (p53 null) in combination with plasmids expressing MOCK, p53, p63g, or p73b are shown. The nucleotide sequences of RE1 (mut) and RE2 (mut) are (AGGaAAtTTa tAAaTgtCaT) and (GGAaAgaaCT AGAaAAtCCC), respectively. The averages of 3 experiments are indicated. Error bars indicate the SD. Asterisk indicates a P-value <0.05 as determined by t-test. n.s.; not statistically significant.

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66

p63γ

p73β

p53

B

H1299 (p53 null)

LacZ

A

61

MCF7 Nutlin (μM) 0 5 10 0 5

LoVo 10

0 5 10 0

A549 5

10

0 5 10 0

5

10

LIMA1

LIMA1 p53

p53

p63

MDM2

p73

p21

MDM2

Actin 24

p21

24

48

48

24

48

(h)

Actin

Fig. 3. The induction of LIMA1 by the p53 family. (A) H1299 cells were infected with adenoviral vectors expressing LacZ (control), p53, p63g, or p73b at an MOI of 25. Forty-eight hours after infection, total cell lysates of these cell lines were analyzed by Western blotting using the indicated antibodies. (B) MCF7, LoVo, and A549 (all containing wild-type p53) cells were treated with nutlin-3a (0, 5, and 10 mM). Total cell lysates of these cells were analyzed 24 or 48 h after treatment by Western blotting using the indicated antibodies.

cells [17]. These genes included several known p53 targets, such as CDKN1A, MDM2, LGALS7, PHLDA3, and AKR1B10. Among these genes, we focused on LIMA1, which encodes the EPLIN protein, as a candidate novel p53 target gene. LIMA1 expression was significantly increased following the overexpression of p53, p63g, and p73b (Fig. 1A). To validate this induction of LIMA1, we compared LIMA1 mRNA expression in H1299 and Saos-2 osteosarcoma cells (both p53-null) overexpressing p53 family members by quantitative RT-PCR (Fig. 1B) (Expression of p53 family proteins was confirmed by Western blotting in Fig. 3A and Supplementary

A

Fig. S1). LIMA1 was significantly upregulated by p53, p63g, and p73b in both cell lines. p53 binding sites in the LIMA1 gene and their transcriptional activity To investigate whether the LIMA1 gene is a direct target of transcriptional activation by the p53 family, we analyzed nextgeneration ChIP-seq data obtained in our previous study [1]. We identified two ChIP-seq peaks: LIMA1-RE1 and LIMA1-RE2 in the

Colorectal cancer Kaiser, et al. (Genome Biol 2007)

Colorectal cancer Skrzypczak, et al. (PLoS One 2010)

B Colorectal cancer (TCGA-COAD)

12.0

LIMA1 expression (log2, arbitrary unit)

LIMA1 expression (log2, arbitrary unit)

12.0 11.0

11.5 11.0

10.0

10.5 9.0

10.0

10.0 9.0 8.0 7.0

9.5

Normal (24)

Cancer (81)

Normal (5)

P=9.037x10-7 Lung Adenocarcinoma

p53WT (41) p53mut (295) P=0.001919

Breast cancer Richardson, et al. (Nat Genet 2010)

Landi, et al. (PLoS One 2008)

Breast cancer (TCGA-BRCA)

11.0

11.0

10.0 10.5

LIMA1 expression (log2, arbitrary unit)

LIMA1 expression (log2, arbitrary unit)

Cancer (100)

P=6.041x10-9

9.0 8.0

10.0

7.0 9.5

6.0

10.0 8.0 6.0 4.0 2.0

5.0

Normal (49)

Cancer (58)

P=1.702x10-7

Normal (7)

Cancer (40)

P=0.0003868

p53WT (657) p53mut (309) P=1.247x10-19

Fig. 4. LIMA1 expression in human cancers. Four cancer gene expression datasets were divided into two groups (normal and tumor) (A). Two gene expression datasets from The Cancer Genome Atlas (TCGA) were divided into two groups based on p53 gene status (WT: wild type, mut: mutant) (B). These datasets were analyzed and depicted in a boxplot (log2 median-centered). The sample numbers are shown in parentheses. P-values were calculated using Student's t-test.

62

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66

4th intron and downstream region of the LIMA1 gene, respectively (Fig. 2A). The nucleotide sequence of each peak corresponded to the consensus p53 motif (RRRCWWGYYY RRRCWWGYYY) (Fig. 2A). Furthermore, we confirmed interactions between p53 family proteins and LIMA1-RE1 and LIMA1-RE2 by ChIP-PCR (Fig. 2B). To determine whether the LIMA1-RE1 and -RE2 sequences confer transcriptional activity in a p53-dependent manner, we performed a reporter assay using luciferase vectors containing the LIMA1-RE1 or -RE2 sequences. H1299 and Saos-2 cells were transiently cotransfected with each luciferase vector together with a p53-, p63g-, or p73b-expressing plasmid. Luciferase activity of the RE1 reporter was increased in the presence of p63g and p73b, whereas p53 significantly increased luciferase activity of the RE2 reporter (Fig. 2C). Thus, the p53 family directly transactivates the LIMA1 gene by binding to two distinct p53 response elements. Curiously, p53 decreased luciferase activity of the RE1 reporter. This seems to be apparent due to the apoptotic response, because p53 decreased luciferase activities also in mutant RE. LIMA1 induction by the p53 family To assess whether LIMA1 is induced by the p53 family at the protein level, H1299 cell lines were infected with adenoviruses expressing p53 family members, and the expression of the LIMA1 protein was then examined by Western blotting (Fig. 3A). LIMA1

protein levels were increased in the presence of p53, p63g, or p73b. Subsequently, MCF7 breast cancer cells, LoVo colon cancer cells, and A549 lung cancer cells (all containing wild-type p53) were treated with nutlin-3a (Fig. 3B). In all of the tested cell lines, nutlin3a treatment increased LIMA1 protein expression along with wildtype p53 in a dose-dependent manner. In addition, LIMA1 protein levels were not increased by treatment with nutlin-3a in p53mutated cancer cell lines (Supplementary Fig. S2). Furthermore, nutlin-3a treatment did not increase endogenous p63 or p73 protein levels in these cell lines (data not shown). Therefore, endogenous wild-type p53 increased the induction of LIMA1 protein expression. The downregulation of LIMA1 in human cancer To examine changes in LIMA1 expression during cancer, we surveyed 4 human cancer gene expression datasets. The expression of LIMA1 mRNA was reduced in cancers compared with normal tissues, and this difference was statistically significant in all 4 datasets (Fig. 4A). Subsequently, we compared LIMA1 mRNA expression in cancers containing wild-type p53 with that in cancers containing mutant p53 in two TCGA datasets. LIMA1 mRNA expression was significantly reduced in p53-mutated cancers (Fig. 4B). Thus, the functional loss of p53 downregulates LIMA1 expression, whose downregulation may contribute to cancer progression.

LIMA1

MOCK

H1299 MOCK

LIMA1

LIMA1 Actin

Relative invaded cells

A *

1.2 1 0.8 0.6 0.4 0.2

0 MOCK LIMA1

Lu99 sh-LIMA1

-

+

+

LIMA1 Actin

MDA-MB-361 sh-LIMA1 sh-LIMA1 LIMA1 Actin

-

+

-

+

*

2.5 2 1.5 1 0.5

0 sh-LIMA1 Relative invaded cells

sh-LIMA1

-

Relative invaded cells

B

-

+ *

2 1.5 1 0.5

0 sh-LIMA1

-

+

Fig. 5. The effects of LIMA1 expression on cancer cell invasion. (A) H1299 cells were stably transfected with LIMA1-expressing or empty control plasmid vectors. The constitutive expression of LIMA1 was confirmed by Western blotting (left). Cell invasion was measured using a Matrigel invasion assay, and the results are presented as invaded cells (middle) and counts (right). The experiments were repeated three times with similar results. Relative cell invasion was normalized to control cells. (B) Lu99 and MDA-MB-361 cells were stably infected with lentiviruses expressing shRNA-LIMA1 (sh-LIMA1 þ) or negative control shRNA (sh-LIMA1 ). LIMA1 knockdown was confirmed by Western blotting (left). Cell invasion was measured and presented in the same manner as in (A) (middle and right). In (A) and (B), error bars indicate the SD. Asterisk indicates a P-value <0.05 as determined by t-test.

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66

63

Fig. 6. The suppression of cell invasion by p53-induced LIMA1. (A) Lu99 and A549 cells were stably infected with lentiviruses expressing shRNA-LIMA1 targeting LIMA1 (shLIMA1 þ) or negative control shRNA (sh-LIMA1 ). Lu99 cells were infected with adenoviral vectors expressing p53 (p53þ) or LacZ (p53) as controls at an MOI of 200, and A549 cells were treated with nutlin-3a (10 mM) or left untreated. Twenty-four hours after infection or treatment, total cell lysates were analyzed by Western blotting with the indicated antibodies. (B) Under the same conditions used in (A), cell invasion was analyzed in a Matrigel invasion assay, and the results are presented as invaded cells (middle) and counts (right). The experiments were repeated three times with similar results. Relative cell invasion was normalized to control cells. Error bars indicate the SD. (C) A549 cells stably infected with lentiviruses expressing shRNA-LIMA1 (sh-LIMA1) or negative control (sh-cont) were injected s.c. into nude mice. When tumor volumes reached 100 mm3, nutlin-3a (25 mg/kg) or control (dimethyl sulfoxide) was intraperitoneally injected daily for 5 days followed by a 2-day rest period for a total of 2 weeks (a total of 10 injections (indicated by brackets)). sh-LIMA1, red circle; sh-LIMA1þnutlin-3a, red square; sh-cont, blue circle and sh-contþnutlin-3a, blue square. The data represent the average volume of three independent tumors. The volume of each tumor is expressed relative to the volume at day 0, which was set as 1. Error bars indicate the SE. In (B) and (C), the asterisk indicates a P-value <0.05 as determined by t-test. n.s.; not statistically significant. (D) Under the same conditions used in (A), mRNA expression in A549 cells was analyzed by RNA-seq. The mRNA expression levels of 1057 coding genes and 314 non-coding RNAs were more than 2-fold increased in cells treated with nutlin-3a (sh-cont, nutlinþ) than in untreated cells (sh-cont, nutlin). Subsequently, hierarchical clustering analysis of the 1371 transcripts was performed for the four types of A549 cells. The red and green colors in the heatmap indicate positive and negative Z-scores, respectively. The asterisk indicates the cluster of 213 genes whose expression was increased by treatment with nutlin-3a in control cells but not in LIMA1-knockdown cells.

64

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66

LIMA1 inhibits cancer cell invasion The LIMA1 protein (also known as EPLIN) plays an important role in cancer cell invasion [10]. To investigate the impact of LIMA1 on invasive ability, we established stable cell lines constitutively expressing LIMA1 by transfecting a LIMA1-expressing plasmid into H1299 cells. The constitutive expression of LIMA1 was confirmed by Western blotting (Fig. 5A, left). Based on the results of invasion assays, forced LIMA1 expression significantly reduced invasion capabilities (Fig. 5A, right). We then investigated the effects of LIMA1 on invasion by knocking down LIMA1 in Lu99 lung cancer cells and MDA-MB-361 breast cancer cells. We established stable cell lines in which LIMA1 was constitutively knocked down via lentivirus-mediated expression of shRNA-LIMA1 in Lu99 and MDAMB-361 cells. The constitutive knockdown of LIMA1 in each cell line was confirmed by Western blotting (Fig. 5B, left). Cell invasion was measured in the same manner noted in Fig. 5A. Cancer cell invasion was significantly enhanced by LIMA1 knockdown (Fig. 5B, right). Conversely, changes in cell growth were not induced by differences in LIMA1 expression (Supplementary Fig. S3). On the other hand, LIMA1 expression and knockdown had only modest effects on cell migration (Supplementary Fig. S4A). These results suggest that LIMA1 regulates cancer cell invasion.

Table 1 Gene ontology analysis of a gene cluster whose expression was increased in control cells but not in LIMA1-knockdown cells. Term

P-value

Cell adhesion GO:0016339 calcium-dependent cellecell adhesion GO:0007155 cell adhesion GO:0022610 biological adhesion Signal GO:0007156:homophilic cell adhesion GO:0005509 calcium ion binding Calcium Glycoprotein GO:0016337 cellecell adhesion

7.21 1.42 1.99 2.03 5.07 6.11 1.17 1.57 2.43 2.74

         

108 107 107 107 107 107 105 105 105 105

genes (148 coding genes, 64 non-coding RNAs and LIMA1 itself; Supplementary Table S1). Gene Ontology analysis revealed a significant association between the genes included in the cluster and cell adhesion (Table 1). These results indicate that p53-induced LIMA1 inhibits cancer cell invasion not only by modulating LIMA1/EPLIN function itself but also by regulating the expression of genes associated with the process of cell adhesion. LIMA1 downregulation correlates with poor prognosis in cancers

LIMA1 knockdown partially inhibits p53-induced suppression of cell invasion To evaluate the biological influence of LIMA1 downregulation in p53-induced tumor suppression, we infected LIMA1 knockdown Lu99 cells with a p53-expressing adenovirus. In addition, we treated LIMA1 knockdown A549 cells (sh-LIMA1-A549 cells) with nutlin-3a. In both cell lines, LIMA1 induction by p53 and knockdown by shRNA were confirmed by Western blotting (Fig. 6A). Under these conditions, we evaluated cancer cell invasion. Interestingly, p53 significantly suppressed cancer cell invasion, whereas LIMA1 knockdown partially inhibited the suppression of invasion in both cell lines (Fig. 6B). Similar results were observed in Lu99 cells in which LIMA1 was transiently knocked down by siRNA (Supplementary Fig. S5). On the other hand, nutlin-3a treatment significantly decreased cell migration, but there was no difference in cell migration between sh-cont and sh-LIMA1 cells (Supplementary Fig. S4B). To clarify the influence of LIMA1 on p53-induced tumor suppression in vivo, we examined a xenograft model of tumorigenesis. sh-LIMA1-A549 cells or control A549 cells (sh-cont-A549 cells) were injected s.c. into nude mice. When tumor volumes reached a consistent size, nutlin-3a was intraperitoneally administered a total of 10 times. In sh-cont-A549 cells, the administration of nutlin-3a significantly decreased tumor volume, whereas the decrease in tumor volume was modest in sh-LIMA1-A549 cells (Fig. 6C: compare sh-contþnutlin with sh-LIMA1þnutlin). Therefore, LIMA1 is required for the tumor suppressor function of p53 not only in vitro but also in vivo. To explore the effects of LIMA1 on the transcriptional regulation of p53, we then evaluated changes in gene expression by performing RNA-seq in sh-cont-A549 cells and sh-LIMA1-A549 cells. We selected 1371 transcripts (1057 coding genes and 314 noncoding RNAs) exhibiting greater than 2-fold increased expression in nutlin-3a-treated sh-cont-A549 cells compared with untreated sh-cont-A549 cells. Subsequently, we performed hierarchical clustering of the 1371 transcripts among the four types of A549 cells (Fig. 6D: sh-cont, nutlin e and þ; sh-LIMA1, nutlin e and þ). Interestingly, we detected a gene cluster exhibiting increased expression upon treatment with nutlin-3a in sh-cont-A549 cells but not in sh-LIMA1-A549 cells. The gene cluster included 213

To examine whether LIMA1 expression affects cancer prognosis, we surveyed 3 human cancer gene expression datasets that included survival information and constructed survival curves using the KaplaneMeier method (Fig. 7). In all datasets analyzed, the rate of disease-free or overall survival was significantly reduced among patients whose tumors expressed low levels of LIMA1 compared with patients bearing tumors characterized by high LIMA1 levels. Thus, low LIMA1 expression may be a marker of poor prognosis for patients with cancer. Discussion In our study, LIMA1 expression is increased not only by the overexpression of exogenous p53 family members but also by the activation of endogenous p53 via nutlin-3a in colon, lung and breast cancer cells (Fig. 3). Recently, Steder et al. reported the highly aggressive behavior of melanoma cells expressing dominantnegative DNp73, which inhibits p73 function upon LIMA1 expression [18]. In melanoma cells, reductions in LIMA1/EPLIN eventually lead to activation of the IGF1R-AKT/STAT3 signaling pathways, followed by an increase in Slug and consecutive attenuation of Ecadherin expression. Thus, LIMA1 appears to be directly transactivated by the p53 family. LIMA1 mRNA expression was decreased in colon, lung and breast cancers compared with corresponding normal tissues based on our analysis of gene expression datasets (Fig. 4A). However, the promoter region of the LIMA1 gene does not contain a typical CpG island, and a public database of genome-wide DNA methylation based on reduced representation bisulfate sequencing (RRBS) revealed no significant differences in DNA methylation status in the promoter regions of the LIMA1 gene. Furthermore, LIMA1 mRNA expression was significantly reduced in p53 mutant cancers compared with p53 wild-type cancers (Fig. 4B). These observations support that the regulation of LIMA1 expression primarily depends on p53 status. Conversely, dominant-negative DNp73 was overexpressed in several types of cancer but not in normal tissues [18]. In these cancers, LIMA1 downregulation may largely be caused by the overexpression of DNp73. We also observed suppressed cancer cell invasion following the induction of LIMA1 by p53 (Fig. 6). In normal cells, LIMA1 associates

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66

65

20

40

60

0.0 0.2 0.4 0.6 0.8 1.0

Distant Metastasis Free Survival

Breast cancer Schmidt, et al. (Cancer Res. 2008)

80

High (113)

Low (87)

50

100

150

200

Low (12) p=0.00905 0

p=3.98x10-4 0

High (43)

20

Months

250

40

60

80

100

Lung cancer Zhu, et al. (J Clin Oncol. 2010)

Overall survival

0

Overall survival

Low (13)

p=0.00852

0.0 0.2 0.4 0.6 0.8 1.0

High (42)

0.0 0.2 0.4 0.6 0.8 1.0

Disease free survival

0.0 0.2 0.4 0.6 0.8 1.0

Colorectal cancer Smith, et al. (Gastroenterology 2010)

120

Months

High (84)

Low (49) p=0.007679 0

2

4

6

8

10

Years

Months

Fig. 7. The correlation between LIMA1 expression and prognosis among cancer patients. For the four indicated datasets, the correlation between LIMA1 expression and survival was analyzed and plotted using the KaplaneMeier method. The survival rates for patients with high and low LIMA1 expression are plotted as solid and dashed lines, respectively. The number of patients in each group is shown in parentheses. P-values were calculated by performing a log-rank test.

with the actin cytoskeleton linking the cadherinecatenin complex to actin via a-catenin, which causes the stabilization of actin dynamics. Conversely, the loss of LIMA1 in cancer cells induces disorganization of the actin cytoskeleton and membrane ruffling, which initiates enhanced cancer cell migration and invasion, resulting in increased metastatic potential [10]. These changes may liberate cell surface receptors for ligand-dependent stimulation, leading to the activation of survival signaling pathways in cancer cells [18]. Interestingly, we identified a gene cluster whose expression was increased in A549 cells treated with nutlin-3a but not in LIMA1 knockdown cells (Fig. 6D). Gene Ontology analysis revealed a significant association between genes included in the cluster and cell adhesion (Table 1). Thus, LIMA1 may regulate cancer cell migration and invasion not only by directly controlling actin dynamics but also by modulating gene expression. In prostate cancer, Zhang et al. proposed a model wherein LIMA1 downregulation results in the disintegration of adherens junctions, actin cytoskeleton remodeling and the activation of Wnt/b-catenin signaling, which may lead to the activation of multiple pro-EMT and pro-metastasis genes [7]. Furthermore, based on our analysis, survival rates are significantly decreased in patients with tumors expressing low levels of LIMA1 (Fig. 7), suggesting decreased LIMA1 expression leads to the augmentation of cancer cell invasion, resulting in poor prognosis in cancer patients. In our mouse model, the administration of nutlin-3a significantly decreased tumor volume, whereas the decrease in tumor volume was modest in sh-LIMA1-A549 cells (Fig. 6C). However, cell growth was not affected by LIMA1 knockdown in these cell lines in vitro (Supplementary Fig. S3). In addition, the tumor volumes in mice without nutlin-3a treatment did not have significant differences between in sh-LIMA1- and sh-cont-A549 cells (Fig. 6C). These

results indicate that both LIMA1 and p53 activation is required for the decrease of tumor volume. We speculate that several factors which have tumor suppressive effect predominantly in vivo are included in the gene cluster mentioned above, resulting in the decrease of tumor volume in mice with nutlin-3a treatment. In summary, we identified a novel p53 pathway wherein the loss of p53 function initiates the invasion-metastasis cascade through LIMA1 downregulation. Our finding that LIMA1, which is associated with actin cytoskeleton reorganization, is a novel p53 target highlights the importance of LIMA1 as a potential therapeutic target in cancers. Acknowledgements This work was supported by JSPS KAKENHI grant numbers 16K07122, 16K09285 and 16J05870. Conflict of interest The authors declared that they have no conflict of interest. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.canlet.2016.12.034. References [1] M. Idogawa, T. Ohashi, Y. Sasaki, R. Maruyama, L. Kashima, H. Suzuki, et al., Identification and analysis of large intergenic non-coding RNAs regulated by

66

[2] [3]

[4]

[5]

[6]

[7]

[8]

[9]

T. Ohashi et al. / Cancer Letters 390 (2017) 58e66 p53 family members through a genome-wide analysis of p53-binding sites, Hum. Mol. Genet. 23 (2014) 2847e2857. R.S. Maul, D.D. Chang, EPLIN, epithelial protein lost in neoplasm, Oncogene 18 (1999) 7838e7841. Y. Song, R.S. Maul, C.S. Gerbin, D.D. Chang, Inhibition of anchorageindependent growth of transformed NIH3T3 cells by epithelial protein lost in neoplasm (EPLIN) requires localization of EPLIN to actin cytoskeleton, Mol. Biol. Cell 13 (2002) 1408e1416. R.S. Maul, Y. Song, K.J. Amann, S.C. Gerbin, T.D. Pollard, D.D. Chang, EPLIN regulates actin dynamics by cross-linking and stabilizing filaments, J. Cell Biol. 160 (2003) 399e407. K. Abe, M. Takeichi, EPLIN mediates linkage of the cadherin catenin complex to F-actin and stabilizes the circumferential actin belt, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 13e19. W.G. Jiang, T.A. Martin, J.M. Lewis-Russell, A. Douglas-Jones, L. Ye, R.E. Mansel, Eplin-alpha expression in human breast cancer, the impact on cellular migration and clinical outcome, Mol. Cancer 7 (2008) 71. S. Zhang, X. Wang, A.O. Osunkoya, S. Iqbal, Y. Wang, Z. Chen, et al., EPLIN downregulation promotes epithelial-mesenchymal transition in prostate cancer cells and correlates with clinical lymph node metastasis, Oncogene 30 (2011) 4941e4952. Y. Liu, A.J. Sanders, L. Zhang, W.G. Jiang, EPLIN-alpha expression in human oesophageal cancer and its impact on cellular aggressiveness and clinical outcome, Anticancer Res. 32 (2012) 1283e1289. Y. Liu, A.J. Sanders, L. Zhang, W.G. Jiang, Expression profile of epithelial protein lost in neoplasm-alpha (EPLIN-a) in human pulmonary cancer and its impact on SKMES-1 cells in vitro, J. Cancer Ther. 3 (2012) 452e459.

[10] R.J. Collins, W.G. Jiang, R. Hargest, M.D. Mason, A.J. Sanders, EPLIN: a fundamental actin regulator in cancer metastasis? Cancer Metastasis Rev. 34 (2015) 753e764. [11] M. Idogawa, Y. Sasaki, H. Suzuki, H. Mita, K. Imai, Y. Shinomura, et al., A single recombinant adenovirus expressing p53 and p21-targeting artificial microRNAs efficiently induces apoptosis in human cancer cells, Clin. Cancer Res. 15 (2009) 3725e3732. [12] M. Idogawa, T. Ohashi, J. Sugisaka, Y. Sasaki, H. Suzuki, T. Tokino, Array-based genome-wide RNAi screening to identify shRNAs that enhance p53-related apoptosis in human cancer cells, Oncotarget 5 (2014) 7540e7548. [13] D. Kim, G. Pertea, C. Trapnell, H. Pimentel, R. Kelley, S.L. Salzberg, TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions, Genome Biol. 14 (2013) R36. [14] C. Trapnell, B.A. Williams, G. Pertea, A. Mortazavi, G. Kwan, M.J. van Baren, et al., Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nat. Biotechnol. 28 (2010) 511e515. [15] W. Huang da, B.T. Sherman, R.A. Lempicki, Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources, Nat. Protoc. 4 (2009) 44e57. [16] H. Mizuno, K. Kitada, K. Nakai, A. Sarai, PrognoScan: a new database for metaanalysis of the prognostic value of genes, BMC Med. Genomics 2 (2009) 18. [17] T. Ohashi, M. Idogawa, Y. Sasaki, H. Suzuki, T. Tokino, AKR1B10, a transcriptional target of p53, is downregulated in colorectal cancers associated with poor prognosis, Mol. Cancer Res. 11 (2013) 1554e1563. [18] M. Steder, V. Alla, C. Meier, A. Spitschak, J. Pahnke, K. Furst, et al., DNp73 exerts function in metastasis initiation by disconnecting the inhibitory role of EPLIN on IGF1R-AKT/STAT3 signaling, Cancer Cell 24 (2013) 512e527.