- Email: [email protected]
Quantitative determination of deleted mitochondrial DNA relative to normal DNA in parkinsonian striatum by a kinetic PCR analysis
Vol.
172,
No.
October
30,
BIOCHEMICAL
2, 1990
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Pages 483-489
1990
Quantitative determination of deleted mitochondrial DNA relative to normal DNA in parkinsonian striatum by a kinetic PCR analysis Takayuki Ozawa, Masashi Tanaka, Shin-ichiro Ikebe*, Kinji Ohno, Tomoyoshi Kondo”, and Yoshikuni Mizuno* Department of Biomedical Chemistry, Faculty of Medicine, University of Nagoya, Nagoya 466, Japan *Department of Neurology, Juntendo University School of Medicine, Tokyo 113, Japan Received
August
20,
1990
Summary: Deleted mitochondrial DNA (mtDNA) was accumulated in the parkinsonian striatum, but the same deleted mtDNA was also detectable in the control striatum when cycles of polymerase chain reaction were increased. To discriminate between these pathological and physiological conditions, we quantitatively analyzed the proportion of deleted mtDNA to normal mtDNA by measuring the incorporation of a-[32P]deoxycytosine triphosphate into mtDNA To estimate the molar ratio of the fragments by using a laser image analyzer. deleted mtDNA to normal mtDNA, the radioactivity was normalized by each against PCR fragment size. By plotting logarithms of normalized radioactivities amplification cycles, straight lines were obtained with different slopes. By extrapolation of the line to the zero amplification, the proportion of mutant mtDNA to normal mtDNA in the original sample from the parkinsonian striatum was estimated to be cu. 5%, which was at least ten times higher than the proportion of ca. 0.3% in the control striatum. These results indicate that phenotype of the mutant mtDNA as Parkinson’s disease is expressed when the proportion of deleted mtDNA to normal mtDNA exceeds a threshold of ten times higher value than in the normal subject. ‘01990ncademlcPress,1°C. Idiopathic Parkinson’s disease (PD) is a common degenerative brain disease. About one person in 40 will become symptomatic with PD during normal lifetime (1). Abnormality of the mitochondrial electron-transfer chain in idiopathic PD has been reported from several laboratories suggesting its etiological role in the phathogenesis of PD (2,3). Administration of 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine (MPTP) produces experimental parkinsonism by the inhibition of mitochondrial Complex I (NADH-ubiquinone phenylpyridinium
oxidoreductase) with its metabolite l-methyl+
(MPP+) (4). MPP+ was demonstrated to bind to the same site as rotenone,
another Complex I inhibitor, which has similar effects to MPP+ on the nigroshiatal pathway (5). We have demonstrated defects among the seven Complex I subunits encoded by mtDNA in the striatal mitochondria of parkinsonian patients (2). In fact, a 4,977-bp deletion between the ATPase8 gene and the ND5 gene in mitochondrial DNA (mtDNA) resulting in defects in four genes for Complex I subunits was detected in the striatum of five patients with PD using polymerase chain reaction (PCR) (6). The deleted mtDNA and the normal mtDNA heteroplasmically existed in the tissue. However, the same deletion and heteroplasmy was also detected in the stiatum of senescent controls (6) and even in young normal subjects with increased PCR amplification cycles. This 0006-291X/90
483
$1.50
Vol.
172, No. 2, 1990
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
suggests that the mtDNA deletion is accumulated in postmitotic neurons as an age-related process of normal subjects. Previously, we proposed that the accumulation of mtDNA mutations is an important contributor to the ageing process and several degenerative diseases (7). An important point to be elucidated in this proposal was how to discriminate the mutations related to the ageing from those connected to diseases, especially, in the above case where not a different but the same mutation was detected both in the patients and the controls. It could be postulated that there exists a threshold of the phenotype expression of mutant gene as PD; viz. clinical manifestation beyond the normal progression of ageing occurs when the proportion of mutant mtDNA to normal mtDNA exceeds a certain point, because several thousands copies of mtDNA exist within a cell. To examine this point, we devised a kinetic PCR method to quantify the proportion of mutant mtDNA to normal mtDNA in the tissue; viz. the proportion before PCR amplification. The present paper presents the result that the accumulation of mtDNA mutations was at least ten times higher in the idiopathic PD than in the normal control.
Materials and Methods Materials a-[32P]Deoxycytosine triphosphate (30 TBq/mmol) was obtained from Amersham, and Taq DNA polymerase from Parkin-Elmer/Cetus. Patients Brains were obtained at autopsy from a 73-year-old female patient with Parkinson’s disease and from a male control in whom no neuromuscular disorders were found. Histological diagnosis of PD was confirmed at the Department of Pathology of Jichi Medical School and Juntendo University. Nigral degeneration and the existence of Lewy bodies were observed in the brains of the patient. A 38-year-old male who died in an accident served as the control. No degenerative changes were observed either in the substantia nigra or in the striatum of the control. Post-mortem delay between the time of death and the freezing of the brain was 12 hours for the patient with PD and 3 hours for the control. Preparation of DNA The tissue of striatum was homogenized and then digested for 4 hours in 1 ml of 10 mM Tris-HCI, 0.1 M EDTA (pH 7.4) containing 0.1 mg/ml of proteinase K and 0.5% SDS. DNA was extracted twice with equal volumes of phenol/chloroform/isoamyl alcohol (25:25:1), and then once with chloroform/isoamyl alcohol (25:l). DNA was precipitated with a one-fifth volume of 5 M NaCl and two volumes of ethanol at -80°C for 1 hour, and then rinsed with 70% ethanol. The precipitated DNA was recovered in 30 ul of 10 mM Tris-HCl, 0.1 mM EDTA (pH 8.0). Oligonucleotide primers Primers used for PCR were synthesized using a Shimadzu model NS-1 DNA synthesizer and an Applied Biosystems model 308B DNA synthesizer and were purified with Oligonucleotide Purification Cartridges from Applied Biosystems. The sequences of the oligonucleotides are shown in Table 1 . PCR analysis Fragments of mtDNA were amplified from 10 ng of the total DNA in 100 ul of a reaction mixture containing 200 uM of each dNTP, 1 uM of each primer, 2.5 units of Taq Table 1. Synthesized primers used for PCR Primers*
L790 H1363
Sequence 5’+3’
TGAACCTACGAGTACACCGA CAGGTCAACCTCGCTICCCC
Complementary
7,901 13,650
to to
site**
7,920 13,631
*Primer L790 was used for amplification of the light strand of mtDNA, and Primer H1338 was used for amplification of the heavy strand of mtDNA. **Numbering of mtDNA is according to Anderson et al. (8) . 484
Vol.
172,
No.
2,
1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
DNA polymerase , 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgC12 (9). The reactions were carried out for a total of 20 cycles with the use of a Thermal Cycler supplied by PerkinElmer/Cetus. The cycle times were as follows: denaturation, 15 set at 94’C; annealing, 15 set at 45°C; primer extension, 120 set at 72°C. The amplified fragments were separated by electrophoresis on 1% agarose gels and were detected fluorographically after staining with ethidium bromide. Quantitative analysis of PCR products Fragments of mtDNA were amplified from each 10 ng of total DNA extracted from the striatum of the PD patient and that from the normal control by the same PCR condition mentioned above except in the presence of 7.4 KBq a[3*P]deoxycytosine triphosphate in the reaction mixture. The cycle times were as follows: denaturation, 15 set at 94oC; annealing, 15 set at 5oOC; primer extension, 95 set at 72°C. PCR reactions were stopped after 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28 amplification cycles, and the reaction products were electrophoresed on a 1% agarose gel at 1OOVfor 30 minutes,, transferred onto a nylon membrane (Hybond-N+, Amersham), and autoradiographed. The radioactlvlties of the labeled DNA-fragments were measured by using a laser image analyzer (Fujix BAS2000 system, Fuji Film, Tokyo).
Results As shown in Fig. 1, after 20 cycles of PCR amplification using primers L820 and H1363, a fragment of 0.77 kb was amplified from the mutant mtDNA in the striatum of the PD patient in addition to a 5.75-kb fragment derived from normal mtDNA (lane P), indicating the heteroplasmic existence of mutant mtDNA and normal mtDNA. In the previous paper (6), it was confirmed that the abnormal fragment was derived from the mutant mtDNA with a 4,977-bp deletion bp directly repeated sequences of 5’-ACCTCCCTCACCA-3’
between
13-
in both the ATPase8 gene and the
ND5 gene. The same abnormal fragment was detected in two normal aged controls (6). Further investigation revealed that the same mutation was detectable even in young normal subjects when increased cycles of PCR amplification
were performed, as shown in Fig. 2. Therefore, we
intended to discriminate the pathological phenotypic expression of the mutant gene from the normal ageing by quantitative analysis of the proportion of mutant mtDNA to normal mtDNA. For the first step, the efficiencies in PCR amplification were compared between deleted mtDNA and normal mtDNA as shown in Fig. 1. The amplifications were carried out using
u Calibration of the ratio of deleted mtDNA to normal mtDNA in the striatum of a patient with PD. The mtDNA fragments derived from the normal mt DNA and from the deleted mtDNA were amplified by PCR for 20 cyclesusing primers L790 and H1363, separatedon a 1% agarose gel, and stainedwith ethidium bromide. Sizesof amplified fragments are indicated in kb. Lane C is the samplefrom the control and lane P that from the patient. The 5.75.kb fragment derived from the normal mtDNA is indicated by the arrowhead. The 0.77-kb fragment derived from the deleted mtDNA is indicated by the asterisk. For calibration, the 0.77-kb fragment was amplified from total DNA from the striatum of the patient with PD, separatedon a 1% agarosegel, extracted from the gel, and adjustedto a concentrationof 10 ng/pl. To each 10 ng of the total DNA extractedfrom the cerebral cortex of the normal control, serially increased amounts as indicated of the 0.75.kb fragment were added asthe template and the mixture were subjectedthe PCR amplification for 20 cycle,separatedon the gel and stained. 485
Vol.
172,
No.
mixtures
2,
1990
in various ratios of the abnormal
total DNA
When
0.77-kb
the amount
10 pg to 100 pg, the relative
mtDNA
AND
was drastically
discernible
fragment
RESEARCH
amplified
of the 0.77-kb
amount
COMMUNICATIONS
from the deleted mtDNA
decreased.
of 3 pg of the 0.77-kb
The 0.77-kb
fragment
fragment
of the 5.75kb
(lane C), and this ratio was comparable
mixture
BIOPHYSICAL
and
extracted from the cerebral cortex of the control, the amount of each DNA being indicated
on the top of each lane. from
BIOCHEMICAL
fragment
fragment
in the control
and 10 ng of total DNA.
in the striatum
fragment,
and this ratio was larger than the ratio of the amplified fragment
amplified
of the parkinsonian
patient
and 10 ng of total DNA.
was slightly
was increased
from
the normal
striatum
to the ratio of the amplified
fragment
of the 0.77-kb
in the template
was barely
fragments
The amount
from the
of the 0.77-kb
larger than that of the 5.75-kb fragments
Thus, the proportion
from mixtures
of 30 pg
of deleted mtDNA
to normal
105,
104.
A
103lo*-
10’
. . . . ..61i
A 12
16
14
18
20
22
24
26
28 -
*
^
0
Normal mtDNA
A
Deleted mtDNA
”
03
*
0
2
PCR 10
20
cycles Fip. Autoradiograms of PCR products of mtDNA in the striatum of the normal control and in that of the patient with PD. The mtDNA fragments derived from the normal mtDNA (arrowhead) and from the deleted mtDNA (asterisk) were amplified by PCR as described in Fig. 1, except in the presence of a-[s2P]deoxycytosine ttiphosphate. PCR reactions were terminated after different cycles of amplification as indicated on the top of each lane. The fragments were electrophoresed on the gel, transferred on a nylon membrane, and autoradiographed. A, PCR products of mtDNA form the normal control; B, those from the patient with PD. Fie. 3. Kinetic analyses of PCR products from deleted mtDNA and normal mtDNA in the parkinsonian and control striatum. The radioactivities of the labeled DNA fragments shown in Fig. 2 were measured by a laser image analyzer. The radioactivity of fragments was normalized by each size. Logarithms of the normalized radioactivities were plotted against the number of PCR amplification cycles. Straight lines with different slopes thus obtained were extrapolated to zero cycle of the amplification. The intercepts of the vertical axis gives the amount of the deleted mtDNA relative to the normal mtDNA before PCR amplification. A, control striatum; B, parkinsonian sb-iatum.
486
30
Vol.
172,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
mtDNA in the parkinsonian striatum was estimated to be at least ten times higher than in the control stiatum.
However, as shown in the figure, the amplification efficiency of the deleted mtDNA
seems to be far higher than that of the normal mtDNA under the present PCR condition, because the length of the fragment derived from the deleted mtDNA is one seventh of the fragment amplified from the normal mtDNA. Thus, we intended to determine the proportion of deleted mtDNA to normal mtDNA before PCR amplification
to eliminate the ambiguity due to the difference in amplification efficiency
between fragments. For this purpose, we amplified mtDNA fragments from total DNA extracted from the parkinsonian striatum and from that extracted from the control striatum under the same PCR condition in the presence of a-[32P]deoxycytosine triphosphate. PCR reactions were terminated after different amplification
cycles, and the reaction products were loaded onto an
agarose gel, separated by electrophoresis, and then autoradiographed as shown in Fig. 2. For the kinetic analysis, the radioactivities of the labeled DNA fragments were measured by a laser image analyzer. To estimate the molar ratio of the deleted mt DNA to normal mtDNA, we normalized the radioactivity by each fragment size. By plotting logarithms of the normalized radioactivity against the cycle number of PCR amplification, straight lines with different slopes were obtained as shown in Fig. 3. Extrapolation of the lines to zero amplification mtDNA to normal mtDNA before the PCR amplification.
cycle gave the proportion of deleted The proportion was estimated to be ca.
0.3% in the case of the normal control (Fig. 3-A) and ca. 5% in the case of the patient with PD (Fig. 3-B).
Discussion The nonmenderian pattern of occurrence of PD and defect of subunits of the mitochondrial electron-transfer chain in the brain have raised suspicion of a defect in the mitochondrial genome (2,3). Final confirmation of the suspicion was provided by our previous report (6) and by the results presented in this paper. In the parkinsonian striatum, we found a distinct existence of mutant mtDNA with the 4,977-bp deletion (Fig. 1) which was common among five autopsied patients with PD (6). The 4,977-bp deletion between the 13-bp directly repeated sequences in the ATPase8 gene and the ND5 gene is a hot spot of mutation among many patients with mitochondrial myopathy (9-14). The mtDNA deletion, spanning the genes coding for four Complex 1 subunits will cause a defect of Complex I, both in its subunit composition and enzymic activity, leading to decreased energy production. This situation is comparable to the energy crisis of the neurons due to inhibition
of Complex I in the MPP+-induced
experimental
parkinsonism
leading to the
degeneration of the nigrostriatal dopaminergic neurons (15). Effects of Complex I deterioration are reasonably assumed to be similar to a bioenergetic defect in the case of chronic ischemia in the tissue. An important point is that the degree and duration of bioenergetic defects are directly linked with clinical manifestation. The degree of bioenergetic defect due to a mutation of the mitochondrial genome could be assumed to be proportional to the ratio of deleted mtDNA to normal mtDNA in
situ , because there are several thousand copies of mtDNA exist in a cell differing from nuclear genome. For quantitative determination of the ratio, we devised a kinetic analysis of PCR products as shown in Fig. 3. PCR amplification of DNA, which is suitable for detecting DNA mutations in a 487
Vol.
172,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
small amount, has not been applied for quantitative analysis, as its millions times amplification results in complication, especially in the case of co-amplification of different-sized DNA fragments. This PCR problem is solved by a simple kinetic analysis of PCR products (Fig. 3). The kinetic analysis presented here will be applicable to many cases of mtDNA mutations which could be analyzed by PCR amplification. Another important finding in the present study is that the same mutant mtDNA exists in both the patient with PD and the normal control though in a small quantity (Fig. 2). This suggests that the mtDNA deletion reported here is accumulated in postmitotic neurons during normal lifetime. From our present results, the proportion of mutant mtDNA to normal mtDNA in the striatum of the normal control was shown to be 0.3% versus 5% in that of the parkinsonian patient. It indicates that phenotype of the mutant mtDNA as PD is expressed when the proportion of deleted mtDNA to normal mtDNA exceeds a threshold of ten times higher value than the normal subject. A progressive decline with age in the concentrations of the dopamine uptake sites in human putamen (16) and an age-related loss of nigrostriatal neurons (17) have been reported as the biochemical and morphological changes in the striatum associated with ageing. These degenerative changes could he based on the accumulation of deleted mtDNA with ageing. The present findings indicate that the accumulation of deleted mtDNA in the premature-aged neurons beyond a threshold as presented here could be an important contributor to the parkinsonism of nonmenderian occurrence and to the age-related disorder of nigrostriatal pathway. This work was supported in part by the Grants-in-aid for General Acknowledgments: Scientific Research (62570128) to M.T., and for Scientific Research on Priority Areas (Bioenergetics, 01617002) to T.O., from the Ministry of Education, Science, and Culture of Japan and by Grant 01-02-39 from the Ministry of Health and Welfare Japan to T.O.
References 1. Kurland, L.T. (1959) Epidemiology: incidence,geographic distribution and genetic consideration. in “Pathogenesis and treatment of parkinsonism” (W. Fields, ed.) pp. 5-49, Springfield,IL:Thomas. 2. Mizuno, Y., Ohta, S., Tanaka, M., Takamiya, S., Suzuki, K., Sato, T., Oya, H., Ozawa, T., and Kagawa, Y. (1989) Biochem. Biophys. Res. Commun. 163, 1450-1455. 3. Parker,W.D., Boyson,S.J., and Parks,J.K. (1989) Ann. Neurol. 26, 719-723. 4. Mizuno, Y., Sone, N., and Saitoh, T. (1987) Biochem. Biophys. Res. Commun. 143, 971. 976. 5. Early, F.G.P., Patel, S.D., Ragan, C.I., and Attardi, G.(1987) FEBS. Lett. 219, 108-113. 6. Ikebe, S., Tanaka, M., Ohno, K., Sato, W., Hattori, K.,Kondo, T., Mizuno,Y., and Ozawa, T. Bichem. Biophys. Res. Commun. (in press). 7. Linnane, A.W., Marzuki, S., Ozawa, T., and Tanaka, M. (1989) Lancet i, 642-645. 8. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijin, M.H.L., Coulson, A.R., Droujin, J., Eperom, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Standen, R., and Young, I.G. (1981) Nature 290, 457-465. 9. Tanaka M., Sato W., Ohno, K., Yamamoto, T., and Ozawa T. (1989) Biochem. Biophys. Res. Commun. 164, 156-163. 10. Tanaka-Yamamoto, T., Tanaka, M., Ohno, K., Sato, W., Horai, S., and Ozawa, T. (1989) Biochim. Biophys. Acta 1009, 15 l- 155. 11. Sato, W., Tanaka, M., Ohno, K., Yamamoto, T., Takada, G., and Ozawa, T. (1989) Biochem. Biophys. Res. Commun. 162, 664-672. 12. Ozawa, T., Yoneda, M., Tanaka, M., Ohno, K., Sato, W., Suzuki, H., Nisikimi, M., Yamamoto, M., Nonaka, I., and Hoai, S. (1988) Biochem. Biophys. Res. Commun. 154, 1240-1247. 488
Vol.
172, No. 2, 1990
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
13. Moraes, C.T., DiMauro, S., Zeviani, M., Lombes, A., Shanske, S., Miranda, A.F., Nakase, H., Bonilla, E., Wemeck, L.C., Servidei, S., Nonaka, I., Koga, Y., Spiro, A.J., Brownell, K.W., Schmidt, B., Scotland, D.L., Zupanc, M., DeVivo, D.C., Schon, E.A., and Rowland, L.P. (1989). N. Engl. J. Med. 320, 1293-1300. 14. Mita, S., Rizzuto, R., Moraes, C.T., Shanske, S., Arnaudo, E., Fabrizi, G.M., Koga, Y., DiMauro, S., and Schon, E.A. (1990) Nucl. Acid. Res. 18, 561-567. 15. Mizuno, Y., Suzuki, K., Sone, N., and Saitoh, T. (1987) Neurosci. Lett. 81: 204-208. 16. De Keizer, J., Ebinger, G., and Vauzuelin, G. (1990) Ann. Neurol. 27, 157-161. 17. McGeer, P.L., McGeer, E.G., and Suzuki, J.S. (1977) Arch. Neurol. 34, 33-35.
489
172,
No.
October
30,
BIOCHEMICAL
2, 1990
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Pages 483-489
1990
Quantitative determination of deleted mitochondrial DNA relative to normal DNA in parkinsonian striatum by a kinetic PCR analysis Takayuki Ozawa, Masashi Tanaka, Shin-ichiro Ikebe*, Kinji Ohno, Tomoyoshi Kondo”, and Yoshikuni Mizuno* Department of Biomedical Chemistry, Faculty of Medicine, University of Nagoya, Nagoya 466, Japan *Department of Neurology, Juntendo University School of Medicine, Tokyo 113, Japan Received
August
20,
1990
Summary: Deleted mitochondrial DNA (mtDNA) was accumulated in the parkinsonian striatum, but the same deleted mtDNA was also detectable in the control striatum when cycles of polymerase chain reaction were increased. To discriminate between these pathological and physiological conditions, we quantitatively analyzed the proportion of deleted mtDNA to normal mtDNA by measuring the incorporation of a-[32P]deoxycytosine triphosphate into mtDNA To estimate the molar ratio of the fragments by using a laser image analyzer. deleted mtDNA to normal mtDNA, the radioactivity was normalized by each against PCR fragment size. By plotting logarithms of normalized radioactivities amplification cycles, straight lines were obtained with different slopes. By extrapolation of the line to the zero amplification, the proportion of mutant mtDNA to normal mtDNA in the original sample from the parkinsonian striatum was estimated to be cu. 5%, which was at least ten times higher than the proportion of ca. 0.3% in the control striatum. These results indicate that phenotype of the mutant mtDNA as Parkinson’s disease is expressed when the proportion of deleted mtDNA to normal mtDNA exceeds a threshold of ten times higher value than in the normal subject. ‘01990ncademlcPress,1°C. Idiopathic Parkinson’s disease (PD) is a common degenerative brain disease. About one person in 40 will become symptomatic with PD during normal lifetime (1). Abnormality of the mitochondrial electron-transfer chain in idiopathic PD has been reported from several laboratories suggesting its etiological role in the phathogenesis of PD (2,3). Administration of 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine (MPTP) produces experimental parkinsonism by the inhibition of mitochondrial Complex I (NADH-ubiquinone phenylpyridinium
oxidoreductase) with its metabolite l-methyl+
(MPP+) (4). MPP+ was demonstrated to bind to the same site as rotenone,
another Complex I inhibitor, which has similar effects to MPP+ on the nigroshiatal pathway (5). We have demonstrated defects among the seven Complex I subunits encoded by mtDNA in the striatal mitochondria of parkinsonian patients (2). In fact, a 4,977-bp deletion between the ATPase8 gene and the ND5 gene in mitochondrial DNA (mtDNA) resulting in defects in four genes for Complex I subunits was detected in the striatum of five patients with PD using polymerase chain reaction (PCR) (6). The deleted mtDNA and the normal mtDNA heteroplasmically existed in the tissue. However, the same deletion and heteroplasmy was also detected in the stiatum of senescent controls (6) and even in young normal subjects with increased PCR amplification cycles. This 0006-291X/90
483
$1.50
Vol.
172, No. 2, 1990
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
suggests that the mtDNA deletion is accumulated in postmitotic neurons as an age-related process of normal subjects. Previously, we proposed that the accumulation of mtDNA mutations is an important contributor to the ageing process and several degenerative diseases (7). An important point to be elucidated in this proposal was how to discriminate the mutations related to the ageing from those connected to diseases, especially, in the above case where not a different but the same mutation was detected both in the patients and the controls. It could be postulated that there exists a threshold of the phenotype expression of mutant gene as PD; viz. clinical manifestation beyond the normal progression of ageing occurs when the proportion of mutant mtDNA to normal mtDNA exceeds a certain point, because several thousands copies of mtDNA exist within a cell. To examine this point, we devised a kinetic PCR method to quantify the proportion of mutant mtDNA to normal mtDNA in the tissue; viz. the proportion before PCR amplification. The present paper presents the result that the accumulation of mtDNA mutations was at least ten times higher in the idiopathic PD than in the normal control.
Materials and Methods Materials a-[32P]Deoxycytosine triphosphate (30 TBq/mmol) was obtained from Amersham, and Taq DNA polymerase from Parkin-Elmer/Cetus. Patients Brains were obtained at autopsy from a 73-year-old female patient with Parkinson’s disease and from a male control in whom no neuromuscular disorders were found. Histological diagnosis of PD was confirmed at the Department of Pathology of Jichi Medical School and Juntendo University. Nigral degeneration and the existence of Lewy bodies were observed in the brains of the patient. A 38-year-old male who died in an accident served as the control. No degenerative changes were observed either in the substantia nigra or in the striatum of the control. Post-mortem delay between the time of death and the freezing of the brain was 12 hours for the patient with PD and 3 hours for the control. Preparation of DNA The tissue of striatum was homogenized and then digested for 4 hours in 1 ml of 10 mM Tris-HCI, 0.1 M EDTA (pH 7.4) containing 0.1 mg/ml of proteinase K and 0.5% SDS. DNA was extracted twice with equal volumes of phenol/chloroform/isoamyl alcohol (25:25:1), and then once with chloroform/isoamyl alcohol (25:l). DNA was precipitated with a one-fifth volume of 5 M NaCl and two volumes of ethanol at -80°C for 1 hour, and then rinsed with 70% ethanol. The precipitated DNA was recovered in 30 ul of 10 mM Tris-HCl, 0.1 mM EDTA (pH 8.0). Oligonucleotide primers Primers used for PCR were synthesized using a Shimadzu model NS-1 DNA synthesizer and an Applied Biosystems model 308B DNA synthesizer and were purified with Oligonucleotide Purification Cartridges from Applied Biosystems. The sequences of the oligonucleotides are shown in Table 1 . PCR analysis Fragments of mtDNA were amplified from 10 ng of the total DNA in 100 ul of a reaction mixture containing 200 uM of each dNTP, 1 uM of each primer, 2.5 units of Taq Table 1. Synthesized primers used for PCR Primers*
L790 H1363
Sequence 5’+3’
TGAACCTACGAGTACACCGA CAGGTCAACCTCGCTICCCC
Complementary
7,901 13,650
to to
site**
7,920 13,631
*Primer L790 was used for amplification of the light strand of mtDNA, and Primer H1338 was used for amplification of the heavy strand of mtDNA. **Numbering of mtDNA is according to Anderson et al. (8) . 484
Vol.
172,
No.
2,
1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
DNA polymerase , 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgC12 (9). The reactions were carried out for a total of 20 cycles with the use of a Thermal Cycler supplied by PerkinElmer/Cetus. The cycle times were as follows: denaturation, 15 set at 94’C; annealing, 15 set at 45°C; primer extension, 120 set at 72°C. The amplified fragments were separated by electrophoresis on 1% agarose gels and were detected fluorographically after staining with ethidium bromide. Quantitative analysis of PCR products Fragments of mtDNA were amplified from each 10 ng of total DNA extracted from the striatum of the PD patient and that from the normal control by the same PCR condition mentioned above except in the presence of 7.4 KBq a[3*P]deoxycytosine triphosphate in the reaction mixture. The cycle times were as follows: denaturation, 15 set at 94oC; annealing, 15 set at 5oOC; primer extension, 95 set at 72°C. PCR reactions were stopped after 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28 amplification cycles, and the reaction products were electrophoresed on a 1% agarose gel at 1OOVfor 30 minutes,, transferred onto a nylon membrane (Hybond-N+, Amersham), and autoradiographed. The radioactlvlties of the labeled DNA-fragments were measured by using a laser image analyzer (Fujix BAS2000 system, Fuji Film, Tokyo).
Results As shown in Fig. 1, after 20 cycles of PCR amplification using primers L820 and H1363, a fragment of 0.77 kb was amplified from the mutant mtDNA in the striatum of the PD patient in addition to a 5.75-kb fragment derived from normal mtDNA (lane P), indicating the heteroplasmic existence of mutant mtDNA and normal mtDNA. In the previous paper (6), it was confirmed that the abnormal fragment was derived from the mutant mtDNA with a 4,977-bp deletion bp directly repeated sequences of 5’-ACCTCCCTCACCA-3’
between
13-
in both the ATPase8 gene and the
ND5 gene. The same abnormal fragment was detected in two normal aged controls (6). Further investigation revealed that the same mutation was detectable even in young normal subjects when increased cycles of PCR amplification
were performed, as shown in Fig. 2. Therefore, we
intended to discriminate the pathological phenotypic expression of the mutant gene from the normal ageing by quantitative analysis of the proportion of mutant mtDNA to normal mtDNA. For the first step, the efficiencies in PCR amplification were compared between deleted mtDNA and normal mtDNA as shown in Fig. 1. The amplifications were carried out using
u Calibration of the ratio of deleted mtDNA to normal mtDNA in the striatum of a patient with PD. The mtDNA fragments derived from the normal mt DNA and from the deleted mtDNA were amplified by PCR for 20 cyclesusing primers L790 and H1363, separatedon a 1% agarose gel, and stainedwith ethidium bromide. Sizesof amplified fragments are indicated in kb. Lane C is the samplefrom the control and lane P that from the patient. The 5.75.kb fragment derived from the normal mtDNA is indicated by the arrowhead. The 0.77-kb fragment derived from the deleted mtDNA is indicated by the asterisk. For calibration, the 0.77-kb fragment was amplified from total DNA from the striatum of the patient with PD, separatedon a 1% agarosegel, extracted from the gel, and adjustedto a concentrationof 10 ng/pl. To each 10 ng of the total DNA extractedfrom the cerebral cortex of the normal control, serially increased amounts as indicated of the 0.75.kb fragment were added asthe template and the mixture were subjectedthe PCR amplification for 20 cycle,separatedon the gel and stained. 485
Vol.
172,
No.
mixtures
2,
1990
in various ratios of the abnormal
total DNA
When
0.77-kb
the amount
10 pg to 100 pg, the relative
mtDNA
AND
was drastically
discernible
fragment
RESEARCH
amplified
of the 0.77-kb
amount
COMMUNICATIONS
from the deleted mtDNA
decreased.
of 3 pg of the 0.77-kb
The 0.77-kb
fragment
fragment
of the 5.75kb
(lane C), and this ratio was comparable
mixture
BIOPHYSICAL
and
extracted from the cerebral cortex of the control, the amount of each DNA being indicated
on the top of each lane. from
BIOCHEMICAL
fragment
fragment
in the control
and 10 ng of total DNA.
in the striatum
fragment,
and this ratio was larger than the ratio of the amplified fragment
amplified
of the parkinsonian
patient
and 10 ng of total DNA.
was slightly
was increased
from
the normal
striatum
to the ratio of the amplified
fragment
of the 0.77-kb
in the template
was barely
fragments
The amount
from the
of the 0.77-kb
larger than that of the 5.75-kb fragments
Thus, the proportion
from mixtures
of 30 pg
of deleted mtDNA
to normal
105,
104.
A
103lo*-
10’
. . . . ..61i
A 12
16
14
18
20
22
24
26
28 -
*
^
0
Normal mtDNA
A
Deleted mtDNA
”
03
*
0
2
PCR 10
20
cycles Fip. Autoradiograms of PCR products of mtDNA in the striatum of the normal control and in that of the patient with PD. The mtDNA fragments derived from the normal mtDNA (arrowhead) and from the deleted mtDNA (asterisk) were amplified by PCR as described in Fig. 1, except in the presence of a-[s2P]deoxycytosine ttiphosphate. PCR reactions were terminated after different cycles of amplification as indicated on the top of each lane. The fragments were electrophoresed on the gel, transferred on a nylon membrane, and autoradiographed. A, PCR products of mtDNA form the normal control; B, those from the patient with PD. Fie. 3. Kinetic analyses of PCR products from deleted mtDNA and normal mtDNA in the parkinsonian and control striatum. The radioactivities of the labeled DNA fragments shown in Fig. 2 were measured by a laser image analyzer. The radioactivity of fragments was normalized by each size. Logarithms of the normalized radioactivities were plotted against the number of PCR amplification cycles. Straight lines with different slopes thus obtained were extrapolated to zero cycle of the amplification. The intercepts of the vertical axis gives the amount of the deleted mtDNA relative to the normal mtDNA before PCR amplification. A, control striatum; B, parkinsonian sb-iatum.
486
30
Vol.
172,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
mtDNA in the parkinsonian striatum was estimated to be at least ten times higher than in the control stiatum.
However, as shown in the figure, the amplification efficiency of the deleted mtDNA
seems to be far higher than that of the normal mtDNA under the present PCR condition, because the length of the fragment derived from the deleted mtDNA is one seventh of the fragment amplified from the normal mtDNA. Thus, we intended to determine the proportion of deleted mtDNA to normal mtDNA before PCR amplification
to eliminate the ambiguity due to the difference in amplification efficiency
between fragments. For this purpose, we amplified mtDNA fragments from total DNA extracted from the parkinsonian striatum and from that extracted from the control striatum under the same PCR condition in the presence of a-[32P]deoxycytosine triphosphate. PCR reactions were terminated after different amplification
cycles, and the reaction products were loaded onto an
agarose gel, separated by electrophoresis, and then autoradiographed as shown in Fig. 2. For the kinetic analysis, the radioactivities of the labeled DNA fragments were measured by a laser image analyzer. To estimate the molar ratio of the deleted mt DNA to normal mtDNA, we normalized the radioactivity by each fragment size. By plotting logarithms of the normalized radioactivity against the cycle number of PCR amplification, straight lines with different slopes were obtained as shown in Fig. 3. Extrapolation of the lines to zero amplification mtDNA to normal mtDNA before the PCR amplification.
cycle gave the proportion of deleted The proportion was estimated to be ca.
0.3% in the case of the normal control (Fig. 3-A) and ca. 5% in the case of the patient with PD (Fig. 3-B).
Discussion The nonmenderian pattern of occurrence of PD and defect of subunits of the mitochondrial electron-transfer chain in the brain have raised suspicion of a defect in the mitochondrial genome (2,3). Final confirmation of the suspicion was provided by our previous report (6) and by the results presented in this paper. In the parkinsonian striatum, we found a distinct existence of mutant mtDNA with the 4,977-bp deletion (Fig. 1) which was common among five autopsied patients with PD (6). The 4,977-bp deletion between the 13-bp directly repeated sequences in the ATPase8 gene and the ND5 gene is a hot spot of mutation among many patients with mitochondrial myopathy (9-14). The mtDNA deletion, spanning the genes coding for four Complex 1 subunits will cause a defect of Complex I, both in its subunit composition and enzymic activity, leading to decreased energy production. This situation is comparable to the energy crisis of the neurons due to inhibition
of Complex I in the MPP+-induced
experimental
parkinsonism
leading to the
degeneration of the nigrostriatal dopaminergic neurons (15). Effects of Complex I deterioration are reasonably assumed to be similar to a bioenergetic defect in the case of chronic ischemia in the tissue. An important point is that the degree and duration of bioenergetic defects are directly linked with clinical manifestation. The degree of bioenergetic defect due to a mutation of the mitochondrial genome could be assumed to be proportional to the ratio of deleted mtDNA to normal mtDNA in
situ , because there are several thousand copies of mtDNA exist in a cell differing from nuclear genome. For quantitative determination of the ratio, we devised a kinetic analysis of PCR products as shown in Fig. 3. PCR amplification of DNA, which is suitable for detecting DNA mutations in a 487
Vol.
172,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
small amount, has not been applied for quantitative analysis, as its millions times amplification results in complication, especially in the case of co-amplification of different-sized DNA fragments. This PCR problem is solved by a simple kinetic analysis of PCR products (Fig. 3). The kinetic analysis presented here will be applicable to many cases of mtDNA mutations which could be analyzed by PCR amplification. Another important finding in the present study is that the same mutant mtDNA exists in both the patient with PD and the normal control though in a small quantity (Fig. 2). This suggests that the mtDNA deletion reported here is accumulated in postmitotic neurons during normal lifetime. From our present results, the proportion of mutant mtDNA to normal mtDNA in the striatum of the normal control was shown to be 0.3% versus 5% in that of the parkinsonian patient. It indicates that phenotype of the mutant mtDNA as PD is expressed when the proportion of deleted mtDNA to normal mtDNA exceeds a threshold of ten times higher value than the normal subject. A progressive decline with age in the concentrations of the dopamine uptake sites in human putamen (16) and an age-related loss of nigrostriatal neurons (17) have been reported as the biochemical and morphological changes in the striatum associated with ageing. These degenerative changes could he based on the accumulation of deleted mtDNA with ageing. The present findings indicate that the accumulation of deleted mtDNA in the premature-aged neurons beyond a threshold as presented here could be an important contributor to the parkinsonism of nonmenderian occurrence and to the age-related disorder of nigrostriatal pathway. This work was supported in part by the Grants-in-aid for General Acknowledgments: Scientific Research (62570128) to M.T., and for Scientific Research on Priority Areas (Bioenergetics, 01617002) to T.O., from the Ministry of Education, Science, and Culture of Japan and by Grant 01-02-39 from the Ministry of Health and Welfare Japan to T.O.
References 1. Kurland, L.T. (1959) Epidemiology: incidence,geographic distribution and genetic consideration. in “Pathogenesis and treatment of parkinsonism” (W. Fields, ed.) pp. 5-49, Springfield,IL:Thomas. 2. Mizuno, Y., Ohta, S., Tanaka, M., Takamiya, S., Suzuki, K., Sato, T., Oya, H., Ozawa, T., and Kagawa, Y. (1989) Biochem. Biophys. Res. Commun. 163, 1450-1455. 3. Parker,W.D., Boyson,S.J., and Parks,J.K. (1989) Ann. Neurol. 26, 719-723. 4. Mizuno, Y., Sone, N., and Saitoh, T. (1987) Biochem. Biophys. Res. Commun. 143, 971. 976. 5. Early, F.G.P., Patel, S.D., Ragan, C.I., and Attardi, G.(1987) FEBS. Lett. 219, 108-113. 6. Ikebe, S., Tanaka, M., Ohno, K., Sato, W., Hattori, K.,Kondo, T., Mizuno,Y., and Ozawa, T. Bichem. Biophys. Res. Commun. (in press). 7. Linnane, A.W., Marzuki, S., Ozawa, T., and Tanaka, M. (1989) Lancet i, 642-645. 8. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijin, M.H.L., Coulson, A.R., Droujin, J., Eperom, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Standen, R., and Young, I.G. (1981) Nature 290, 457-465. 9. Tanaka M., Sato W., Ohno, K., Yamamoto, T., and Ozawa T. (1989) Biochem. Biophys. Res. Commun. 164, 156-163. 10. Tanaka-Yamamoto, T., Tanaka, M., Ohno, K., Sato, W., Horai, S., and Ozawa, T. (1989) Biochim. Biophys. Acta 1009, 15 l- 155. 11. Sato, W., Tanaka, M., Ohno, K., Yamamoto, T., Takada, G., and Ozawa, T. (1989) Biochem. Biophys. Res. Commun. 162, 664-672. 12. Ozawa, T., Yoneda, M., Tanaka, M., Ohno, K., Sato, W., Suzuki, H., Nisikimi, M., Yamamoto, M., Nonaka, I., and Hoai, S. (1988) Biochem. Biophys. Res. Commun. 154, 1240-1247. 488
Vol.
172, No. 2, 1990
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
13. Moraes, C.T., DiMauro, S., Zeviani, M., Lombes, A., Shanske, S., Miranda, A.F., Nakase, H., Bonilla, E., Wemeck, L.C., Servidei, S., Nonaka, I., Koga, Y., Spiro, A.J., Brownell, K.W., Schmidt, B., Scotland, D.L., Zupanc, M., DeVivo, D.C., Schon, E.A., and Rowland, L.P. (1989). N. Engl. J. Med. 320, 1293-1300. 14. Mita, S., Rizzuto, R., Moraes, C.T., Shanske, S., Arnaudo, E., Fabrizi, G.M., Koga, Y., DiMauro, S., and Schon, E.A. (1990) Nucl. Acid. Res. 18, 561-567. 15. Mizuno, Y., Suzuki, K., Sone, N., and Saitoh, T. (1987) Neurosci. Lett. 81: 204-208. 16. De Keizer, J., Ebinger, G., and Vauzuelin, G. (1990) Ann. Neurol. 27, 157-161. 17. McGeer, P.L., McGeer, E.G., and Suzuki, J.S. (1977) Arch. Neurol. 34, 33-35.
489