Signal Transducer and Activator of Transcription 3 Protects From Liver Injury and Fibrosis in a Mouse Model of Sclerosing Cholangitis

GASTROENTEROLOGY 2010;138:2499 –2508

Signal Transducer and Activator of Transcription 3 Protects From Liver Injury and Fibrosis in a Mouse Model of Sclerosing Cholangitis MARKUS MAIR,* GERNOT ZOLLNER,‡ DORIS SCHNELLER,§ MONICA MUSTEANU,* PETER FICKERT,‡ JUDITH GUMHOLD,‡ CHRISTIAN SCHUSTER,储 ANDREA FUCHSBICHLER,‡ MARTIN BILBAN,¶ STEFANIE TAUBER,¶ HARALD ESTERBAUER,¶ LUKAS KENNER,* VALERIA POLI,# LEANDER BLAAS,* JAN WILHELM KORNFELD,* EMILIO CASANOVA,* WOLFGANG MIKULITS,§ MICHAEL TRAUNER,‡ and ROBERT EFERL*

BACKGROUND & AIMS: Signal transducer and activator of transcription 3 (Stat3) is the main mediator of interleukin-6 –type cytokine signaling required for hepatocyte proliferation and hepatoprotection, but its role in sclerosing cholangitis and other cholestatic liver diseases remains unresolved. METHODS: We investigated the role of Stat3 in inflammation-induced cholestatic liver injury and used mice lacking the multidrug resistance gene 2 (mdr2⫺/⫺) as a model for SC. RESULTS: We show that conditional inactivation of Stat3 in hepatocytes and cholangiocytes (stat3⌬hc) of mdr2⫺/⫺ mice strongly aggravated bile acid–induced liver injury and fibrosis. A similar phenotype was observed in mdr2⫺/⫺ mice lacking interleukin-6 production. Biochemical and molecular characterization suggested that Stat3 exerts hepatoprotective functions in both hepatocytes and cholangiocytes. Loss of Stat3 led to increased expression of tumor necrosis factor ␣, which might reduce the barrier function of bile ducts. Moreover, Stat3-deficient hepatocytes displayed up-regulation of bile acid biosynthesis genes and downregulation of hepatoprotective epidermal growth factor receptor and insulin-like growth factor 1 signaling pathways. Consistently, stat3⌬hc mice were more sensitive to cholic acid–induced liver damage than control mice. CONCLUSIONS: Our data suggest that Stat3 prevents cholestasis and liver damage in sclerosing cholangitis via regulation of pivotal functions in hepatocytes and cholangiocytes. Keywords: Stat3; Liver; Conditional Mouse Model; Cholestasis.

C

hronic cholestatic liver diseases such as primary biliary cirrhosis, primary sclerosing cholangitis, and secondary sclerosing cholangitis are characterized by injury of different parts of the biliary tree, which can be caused by autoimmunity (primary biliary cirrhosis), gallstones (secondary sclerosing cholangitis), or unknown etiology (primary sclerosing cholangitis).1 Irrespective of which part of the biliary tree is affected, resulting cho-

lestasis leads to bile acid–induced cholangiocyte and hepatocyte damage that eventually progresses toward biliary fibrosis and cirrhosis, a fatal end-stage condition of many chronic liver diseases. During fibrosis progression, inflammation and liver damage trigger a plethora of cellular events that results in collagen deposition, disruption of the liver architecture, and liver failure.2 Kupffer cells and stellate cells are the major effectors that respond to cellular debris or inflammatory cytokines. Activated Kupffer cells start to secrete transforming growth factor-␤, which stimulates resting stellate cells to undergo several morphologic and molecular changes. Activated stellate cells and portal myofibroblasts deposit collagen and other extracellular matrix components in the pericentral or periportal regions.3 Despite profound knowledge about the executing cell types and mechanisms leading to collagen deposition, little is known about the hepatoprotective factors that regulate initial events in biliary fibrosis. The transcription factor Stat3 has been shown to be important for regenerative hepatocyte proliferation and hepatoprotection.4,5 Stat3 is activated mainly in hepatic cells by interleukin (IL)-6 and IL-22, but also by other factors such as IL-10 or epidermal growth factor (EGF).6 Conditional inactivation of Stat3 in hepatocytes of mice causes impaired liver regeneration after partial hepatectomy5 and affects metabolic functions.7 Overexpression of constitutively activated Stat3 protects from Fas-induced fulminant hepatitis.4 Several Stat3 target genes have been identified that mediate these hepatoprotective and mitogenic effects. They include bcl-2, bcl-xL, mcl-1, flip, ref-1, cyclinD1, and c-myc.6 Abbreviations used in this paper: CA, cholic acid; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; GSEA, Gene Set Enrichment Analysis; IGF-1, insulin-like growth factor 1; IL, interleukin; mdr2ⴚ/ⴚ, multidrug resistance gene 2; NF-␬B, nuclear factor␬B; PCR, polymerase chain reaction. © 2010 by the AGA Institute 0016-5085/$36.00 doi:10.1053/j.gastro.2010.02.049

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

*Ludwig Boltzmann Institute for Cancer Research, Vienna, Austria; ‡Laboratory of Experimental and Molecular Hepatology, Department of Internal Medicine, Division of Gastroenterology and Hepatology, Medical University of Graz, Graz, Austria; §Department of Medicine I, Division of Cancer Research, ¶Department of Medical and Chemical Laboratory Diagnostics, Medical University of Vienna, Vienna, Austria; 储Division of Signal Transduction und Growth Control, Deutsches Krebsforschungszentrum (DKFZ), Heidelberg, Germany; #Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy

2500

MAIR ET AL

In this study, we used multidrug resistance gene 2 (mdr2⫺/⫺) mice as a model for SC8 to investigate the function of Stat3 in bile acid–induced liver injury and fibrogenesis. Importantly, conditional inactivation of Stat3 in hepatocytes and cholangiocytes (stat3⌬hc) of mdr2⫺/⫺ mice strongly aggravated hepatic fibrosis, finally leading to severe jaundice and premature lethality. This phenotype was associated with cholangiocyte damage, formation of bile infarcts, and defective regenerative hepatocyte proliferation. Importantly, feeding with cholic acid (CA) resulted in pronounced formation of bile infarcts and hepatic fibrosis in stat3⌬hc mice but not in stat3flox/flox mice. These data suggest a pivotal hepatoprotective function for Stat3 in bile acid–induced liver injury and fibrosis.

Materials and Methods Mice

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

Mice carrying floxed alleles of stat3 (stat3flox/flox; C57BL/6)9 were crossed to Alfp-cre transgenic mice (129Sv/C57BL/6).10 The resulting Alfp-cre stat3flox/flox (stat3⌬hc) animals were bred with mdr2⫺/⫺ mice (Balb/c)8 to generate stat3⌬hc mdr2⫺/⫺ mice. IL-6 – deficient mice (C57BL/6) were purchased from Jackson Laboratories (Bar Harbor, ME) and crossed with mdr2⫺/⫺ mice (Balb/c)8 to generate IL-6⫺/⫺ mdr2⫺/⫺ mice. Offspring were intercrossed for 6 –10 generations to obtain an inbred strain with a homogeneous genetic background. Only littermates were used as control. For hepatocyte immortalization, stat3⌬hc mice were crossed with p19ARF null mice11 to obtain stat3⌬hc p19ARF double-null mice. Bile acid overload was induced in mice with a diet containing 1% (wt/wt) CA for 28 days. Insulin-like growth factor-1 (IGF-1) treatment was performed by intraperitoneal injection of recombinant mouse IGF-1 (20 ng/g/day; Immunotools, Friesoyte, Germany) for 28 days. All animal experiments were performed in accordance with Austrian and European laws and with the general regulations specified by the Good Scientific Practices guidelines of the Medical University of Vienna.

Southern Blot and Electrophoretic Mobility Shift Assay Genomic DNA was digested with EcoRV for Southern blotting, yielding a wild-type fragment of 11 kb, a floxed allele of 4.1 kb, and a deleted allele of 2.2 kb. A 2.1-kb EcoRV/EcoRI fragment from intron 11 of the stat3 gene was used as a probe. Electrophoretic mobility shift assay analysis was performed as described previously12 using a nuclear factor-␬B (NF-␬B) consensus probe (5=-AGTTGAGGGGACTTTCCCAGGC-3=). For supershifts a p65 antibody (#sc-8008; Santa Cruz Biotechnologies, Santa Cruz, CA) was used.

GASTROENTEROLOGY Vol. 138, No. 7

Histology, Immunohistochemistry, Western Blot, and Terminal Deoxynucleotidyl Transferase–Mediated Deoxyuridine Triphosphate Nick-End Labeling Assay Livers were fixed in 4% buffered formaldehyde and embedded in paraffin. Sections (4-␮m thick) were stained with H&E, Chromotrope aniline blue, or Trichrome for collagen and periodic acid–Schiff for glycogen using standard procedures. Immunohistochemistry and Western blots were performed using antibodies against Phospho-Tyr705 Stat3 (#9131; Cell Signaling, Danvers, MA), Stat3 (#06-596; BD Biosciences, PharMingen, San Diego, CA), EGF receptor (EGFR) (#1001; Santa Cruz), IGF-1 (#ab63926; Abcam, Cambridge, UK), p65 (#sc-109; Santa Cruz), phospho–NF-␬B p65 (Ser536; #3033, Cell Signaling), F4/80 (clone CI:A3-1; Serotec), K7 (#ab9021; Abcam), cleaved caspase-3 (#9661S; Cell Signaling), Heat Shock Cognate 70 (HSC70) (#7298; Santa Cruz), K19 (monoclonal rat anti–Troma-III antibody developed by Rolf Kemler), MRP3 (gift from James Boyer), MRP4 (gift from John Schuetz), sodium taurocholate cotransporting polypeptide (NTCP) and Mrp2 (gifts from Bruno Stieger), Ki67 (NCL-Ki67-P; Novocastra, Newcastle, UK), Smad2/3 (#610842; BD Biosciences), phospho-Smad2 (05-953; Upstate), ␣-SMA (clone 1A4; Dako, Glostrup, Denmark), and ␤-actin (#A5441; Sigma, Steinheim, Germany). Terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling staining was performed using the in situ cell death detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions. Quantitation of histochemically stained sections was performed using HistoQuest software (TissueGnostics GmbH, Vienna, Austria; www. tissuegnostics.com).

Polymerase Chain Reaction Analysis Polymerase chain reaction (PCR) for genotyping of the cre transgene was performed with primers CreI CGGTCGATGCAACGAGTGATGAGG and CreII CCAGAGACGGAAATCCATCGCTCG. Wild-type, floxed, and deleted stat3 alleles were detected with primers APRF_11_up CACCAACACATGCTATTTGTAGG, APRF_11_do CCTGTCTCTGACAGGCCATC, and APRF_14_do GCAGCAGAATACTCTACAGCT. Wild-type and mdr2-knockout alleles were detected with primers MDR2-F GCTGAGATGGATCTTGAG, MDR2-R GTCGAGTAGCCAGATGATGG, Neo-F TGTCAAGACCGACCTGTCCG, and Neo-R TATTCGGCAAGCAGGCATCG. An Eppendorf light cycler was used for real-time PCR. Primer sequences are available on request. RNA from at least 4 animals was analyzed in triplicate and the expression levels of transcripts were calculated with the comparative threshold concentration method. The individual RNA levels were normalized for glyceraldehyde-3-phosphate dehydrogenase and are depicted as relative expression levels.

June 2010

STAT3 AND SCLEROSING CHOLANGITIS

2501

Microarray Analysis Livers from stat3 flox/flox , stat3 ⌬hc , stat3 flox/flox and stat3⌬hc mdr2⫺/⫺ mice were removed at the age of 2 weeks and lysed in TRIzol reagent (Invitrogen, Groningen, The Netherlands). Preparation of complementary RNA (cRNA), hybridization to the GeneChip Mouse Gene 1.0 ST Array (Affymetrix, Santa Clara, CA), and scanning of arrays were conducted according to the manufacturer’s protocols (http://www.affymetrix.com). Analysis was performed using Gene Set Enrichment Analysis software (GSEA; http://www.broad.mit.edu/gsea/ msigdb/annotate.jsp). The whole dataset has been deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus and is accessible through GEO Series accession number GSE18759).

mdr2⫺/⫺,

Hepatic Hydroxyproline Determination To quantify liver fibrosis, hepatic hydroxyproline was measured as described previously.13

Analysis of serum alkaline phosphatase, aspartate aminotransferase and alanine aminotransferase, bilirubin, triglyceride, and cholesterol levels was performed using the Reflotron Plus System (Roche Diagnostics). The mouse tumor necrosis factor ␣ (TNF␣) enzyme-linked immunosorbent assay Ready-SET-Go Kit (eBioscience, San Diego, CA) was used for analysis of TNF␣ protein in liver extracts. For analysis of total serum bile acid content a commercial 3␣hydroxysteroid dehydrogenase assay (Ecoline S⫹; Diagnostic Systems GmBH, Holzheim, Germany) was used. Bile duct ligations were performed as described previously.14

Statistical Analyses All values are represented as means ⫾ standard deviation. We evaluated semiquantitative PCRs and metabolic measurement data for significance by 2-tailed unpaired Student t tests. The Kaplan–Meier plot was analyzed for significance using the log-rank test. P values less than .05 were considered significant for all analyses. Significant differences between experimental groups were as follows: *P ⬍ .05, **P ⬍ .01, or ***P ⬍ .005. Calculation was performed using GraphPad Prism 5 software (GraphPad Software, Inc, San Diego, CA).

Results Stat3 Protects From Severe Bile Acid–Induced Liver Injury in Mdr2ⴚ/ⴚ Mice Bile toxicity is increased in mdr2⫺/⫺ mice, which leads to bile acid–induced liver injury resembling SC.8 We used mdr2⫺/⫺ mice as a model to investigate the role of Stat3 in bile acid–induced liver injury. For that purpose, Stat3 conditionally was inactivated in hepatocytes and

Figure 1. Severe jaundice and premature lethality in stat3⌬hc mdr2⫺/⫺ mice. (A) Macroscopically, stat3⌬hc mdr2⫺/⫺ livers showed accumulation of bile in the gallbladder (arrow) and bile infarcts (arrowheads). (B) Serum analysis showing high levels of bilirubin in the serum of stat3⌬hc mdr2⫺/⫺ mice indicative for jaundice (n ⱖ 4 animals per genotype; age, 7 wk). (C) Kaplan–Meier plot showing premature lethality of stat3⌬hc mdr2⫺/⫺ mice (n ⫽ 14 per genotype).

cholangiocytes using Alfp-cre transgenic mice.9,10 The Alfp-cre transgene drives expression of the Cre recombinase under control of an albumin promoter that contains ␣-fetoprotein enhancer elements and allows conditional inactivation of floxed alleles in hepatocytes and cholangiocytes.10 Resulting Alfp-cre stat3flox/flox mdr2⫺/⫺ mice therefore are referred to as stat3⌬hc mdr2⫺/⫺ mice. Deletion of stat3 in hepatocytes and cholangiocytes was confirmed by Southern blot analysis (Supplementary Figure 1A) and Western blot analysis (Supplementary Figure 1B). Stat3⌬hc mdr2⫺/⫺ mice were born at Mendelian frequency and were indistinguishable from stat3flox/flox mdr2⫺/⫺ mice until weaning age. Thereafter, they started to lose weight and became moribund (Supplementary Figure 1C and D). Macroscopically, livers of stat3⌬hc mdr2⫺/⫺ mice showed accumulation of dark bile in the gallbladder indicative of disturbed biliary tree integrity and secondary obstruction of bile ducts (Figure 1A). Of note, gallstones were not found in stat3⌬hc mdr2⫺/⫺ mice. The skin of ears, paws, and tail showed a yellowish coloration typical for jaundice (Supplementary Figure 1E). Consistently, serum levels for bilirubin were increased substantially (Figure 1B and Supplementary Figure 1F) and stat3⌬hc mdr2⫺/⫺ mice displayed premature lethality (Figure 1C). These data show that loss of Stat3 in hepatocytes and cholangiocytes leads to severe hepatic damage in mdr2⫺/⫺ mice.

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

Serum Biochemistry, Enzyme-Linked Immunosorbent Assay, and Bile Duct Ligation

2502

MAIR ET AL

Loss of Stat3 Aggravates Liver Fibrosis in Mdr2ⴚ/ⴚ Mice Mdr2⫺/⫺ mice display hepatic injury and fibrosis, which strongly was aggravated in stat3⌬hc mdr2⫺/⫺ mice (Figure 2A). Chromotrope aniline blue staining showed bridging fibrosis and chicken wire fibrosis with collagen deposition in the periportal areas (Figure 2B). Terminally sick animals displayed disturbed liver architecture, insulated liver lobes, and onion-skin–type fibrosis of bile ducts (Supplementary Figure 2A–C). Consistently, levels of hydroxyproline, a quantitative measure for collagen

GASTROENTEROLOGY Vol. 138, No. 7

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

deposition, were increased markedly in stat3⌬hc mdr2⫺/⫺ mice (Figure 2D). Periodic acid–Schiff staining for glycogen showed depleted patches of hepatocytes (Figure 2C). Bile infarcts with necrotic areas of hepatocytes were visible (Figure 2C; Supplementary Figure 2D–F), leading to increased liver damage parameters (Figure 2D). Levels of serum triglycerides were unchanged and cholesterol levels were not increased because they did not exceed 100 mg/dL (Figure 2D and data not shown). Deletion of a single Stat3 allele was not sufficient to significantly aggravate bile acid–induced hepatic fibrosis in mdr2⫺/⫺ mice because Alfp-cre stat3flox/⫹ mdr2⫺/⫺ mice were indistinguishable macroscopically and histopathologically from stat3flox/flox mdr2⫺/⫺ mice (Supplementary Figure 3). Stat3 is activated by various cytokines via phosphorylation at Tyr705.15 Basal levels of P-Stat3 (Tyr705-phosphorylated Stat3) in stat3flox/flox mice were below the detection limit (data not shown). However, P-Stat3 was detected in cholangiocytes and hepatocytes of stat3flox/flox mdr2⫺/⫺ mice (Figure 3A). In contrast, stat3⌬hc mdr2⫺/⫺ mice displayed strong staining in nonparenchymal cells of the fibrotic regions and in Kupffer cells, but not in cholangiocytes and hepatocytes (Figure 3A). P-Stat3 also was detected prominently in cholangiocytes and hepatocytes after bile duct ligation (Figure 3B). These data show that Stat3 is activated in cholangiocytes and hepatocytes under cholestatic conditions. A major cytokine that activates DNA binding of Stat3 in the liver is IL-6.15 We hypothesized that IL-6 –mediated activation of Stat3 is required for its hepatoprotective activity in mdr2⫺/⫺ mice. Indeed, IL-6⫺/⫺ mdr2⫺/⫺ double-mutant mice phenocopied the phenotype of stat3⌬hc mdr2⫺/⫺ mice (Figure 3C). They showed aggravated fibrosis (Figure 3C and D) and increased levels of liver damage parameters (Figure 3D) when compared with IL-6⫹/⫺ mdr2⫺/⫺ littermate controls. We performed terminal deoxynucleotidyl transferase– mediated deoxyuridine triphosphate nick-end labeling

4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™

Figure 2. Bridging fibrosis in 7-week-old stat3⌬hc mdr2⫺/⫺ mice. (A) H&E-stained sections from stat3flox/flox mdr2⫺/⫺ and stat3⌬hc mdr2⫺/⫺ mice. Bile infarcts (arrow) and giant hepatocytes (inset in A) were present in stat3⌬hc mdr2⫺/⫺ mice. The fibrotic changes in the periportal areas (arrowheads) strongly were aggravated in stat3⌬hc mdr2⫺/⫺ mice when compared with stat3flox/flox mdr2⫺/⫺ mice. (B) Chromotrope aniline blue staining showed collagen deposition (blue) in periportal areas (arrowheads) of stat3⌬hc mdr2⫺/⫺ mice. Bridges of collagen connected the periportal areas. Collagen deposition between hepatocytes (chickenwire fibrosis) was increased in stat3⌬hc mdr2⫺/⫺ mice when compared with stat3flox/flox mdr2⫺/⫺ mice (insets in B). (C) Periodic acid–Schiff staining for hepatocellular glycogen storage function (glycogen in red) indicated patches of periodic acid–Schiff–negative, nonfunctional hepatocytes in stat3⌬hc mdr2⫺/⫺ mice (arrowheads). (D) Increased fibrosis and liver damage in stat3⌬hc mdr2⫺/⫺ mice was confirmed by quantitative analyses. Fibrosis was quantified by measuring the amount of hydroxyproline (HP) in a liver lobe. Bars represent data from 3 or more animals. ALP, alkaline phosphatase; TGL, triglycerides.

staining and analysis of caspase-3 cleavage to investigate if the observed liver injury in stat3⌬hc mdr2⫺/⫺ mice is caused by an apoptotic or necrotic mechanism. Neither increased numbers of terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling–positive hepatic cells nor caspase-3 activation was evident in stat3⌬hc mdr2⫺/⫺ mice (Supplementary Figure 4A and B). Moreover, expression of known stat3 target genes implicated in the regulation of apoptosis was similar in stat3flox/flox mdr2⫺/⫺ and stat3⌬hc mdr2⫺/⫺ mice (Supplementary Figure 4C). These data indicate that bile acid–induced liver injury in stat3⌬hc mdr2⫺/⫺ mice is owing to necrosis rather than apoptosis.

STAT3 AND SCLEROSING CHOLANGITIS

2503

Fibrogenic Effector Pathways Are Activated and Regenerative Hepatocyte Proliferation Is Reduced in Stat3⌬hc Mdr2ⴚ/ⴚ Mice Liver fibrosis is associated with activation of Kupffer cells, stellate cells, or portal myofibroblasts that express a variety of profibrogenic factors.16 Most of these hallmarks were identified in stat3⌬hc mdr2⫺/⫺ mice (Supplementary Figure 5). Kupffer cell numbers were not increased in stat3⌬hc mdr2⫺/⫺ mice when compared with stat3flox/flox mdr2⫺/⫺ mice (Supplementary Figure 6). However, cytokine expression analysis suggested that they are activated in stat3⌬hc mdr2⫺/⫺ mice (see later). Proliferation of hepatocytes during liver injury might be important for resolution of fibrosis. The basal proliferation of hepatocytes was similar in stat3flox/flox and stat3⌬hc mice (data not shown). Under cholestatic conditions in stat3flox/flox mdr2⫺/⫺ mice, increased numbers of Ki67positive hepatocytes indicative for compensatory hepatocyte proliferation were observed (Supplementary Figure 7A and B). In contrast, stat3⌬hc mdr2⫺/⫺ mice showed markedly reduced compensatory hepatocyte proliferation (Supplementary Figure 7A and B). Instead, Ki67-positive, keratin-19 – and keratin-7– expressing cholangiocytes were observed (Supplementary Figure 7), resulting in pronounced ductular proliferation. These data indicate that Stat3 is required for proliferation of hepatocytes but not cholangiocytes after bile acid–induced liver injury.

Loss of Stat3 Sensitizes Mice to Bile Acid–Induced Hepatotoxicity and Cholestasis In addition to the mdr2⫺/⫺ mouse model, a chemical model was used to further investigate the susceptibility of stat3⌬hc mice to cholestatic liver injury and fibrosis. For that purpose, cholestatic liver injury was

4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™ Figure 3. Stat3 is activated in hepatocytes and cholangiocytes under cholestatic conditions. (A) Immunohistochemical staining for PhosphoStat3 on sections from stat3flox/flox mdr2⫺/⫺ mice showed nuclear signals in hepatocytes (arrow) and cholangiocytes (arrowhead) whereas stat3⌬hc mdr2⫺/⫺ mice showed no signals in these cell types. Instead, Kupffer cells (arrowheads) in stat3⌬hc mdr2⫺/⫺ mice displayed strong activation of Stat3, which was confirmed by double-immunohistochemistry for F4/80 (brown) and Phospho-Stat3 (red; upper insets). The lower insets represent images of the fibrotic regions after double-immunohistochemistry for F4/80 (brown) and Phospho-Stat3 (red), indicating that Stat3 also was activated in F4/80-negative nonparenchymal cells (n ⫽ 4 animals per genotype; age, 7 wk). *Bile infarct with background staining. (B) Immunohistochemical staining for Phospho-Stat3 on sections from stat3flox/flox and stat3⌬hc mice after bile duct ligation. Sham-operated animals displayed no activation of Stat3 (upper images). Bile duct ligation–induced Stat3 activation in hepatocytes (arrow) and cholangiocytes (arrowhead) of stat3flox/flox but not stat3⌬hc mice (lower images; n ⱖ 6 animals per genotype). (C) Chromotrope aniline blue staining and (D) quantitation of chromotrope aniline blue–stained area (bars, % chromotrope aniline blue–stained area per liver area) showed aggravated collagen deposition (blue) in IL-6⫺/⫺ mdr2⫺/⫺ mice when compared with IL-6⫹/⫺ mdr2⫺/⫺ littermates (n ⫽ 4). (D) Consistently, liver damage parameters were increased. Bars represent data from 4 animals.

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

June 2010

2504

MAIR ET AL

GASTROENTEROLOGY Vol. 138, No. 7

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

Figure 4. Stat3 protects from CA-induced hepatic injury. Three-week-old stat3flox/flox and stat3⌬hc mice (n ⱖ 4 animals per genotype) were fed with 1% CA chow for 28 days and analyzed thereafter. A second experiment yielded similar results. (A) H&E-stained sections revealed severe hepatic injury and formation of bile infarcts (arrowheads) in CA-fed stat3⌬hc mice but not in stat3flox/flox mice. (B) Quantitation of bile infarcts in the percentage of liver area (ND, not detectable) on H&E-stained sections. (C and D) Trichrome staining showed deposition of collagen (green; arrowheads) in CA-fed stat3⌬hc animals. Bars represent the percentage of trichrome-stained collagen per liver area. (E) Stat3⌬hc mice showed increased expression of collagen type I and type III (COL I, COL III) in response to CA-induced hepatic injury. Bars represent real-time PCR data from 3 or more animals per genotype. (F) Liver damage parameters are increased in CA-fed stat3⌬hc mice when compared with stat3flox/flox mice. Bars represent data from 4 or more animals per genotype. ALP, alkaline phosphatase.

induced in stat3⌬hc and stat3flox/flox mice through feeding with a diet containing 1% CA. After 4 weeks of CA feeding, stat3⌬hc mice showed bile infarcts (Figure 4A and B), hepatic fibrosis (Figure 4C and D), increased expression of collagens (Figure 4E), and increased serum parameters for cholangiocyte and hepatocyte damage when compared with stat3flox/flox mice (Figure 4F). These results indicate that stat3⌬hc mice are more susceptible to CAinduced liver toxicity. Affymetrix microarray analyses were performed to identify affected metabolic and molecular pathways in livers of stat3⌬hc mdr2⫺/⫺ mice that lead to cholestasis and bile acid–induced liver injury. To avoid false-positive results that are caused by differential cellular composition, we defined the onset of fibrosis (Supplementary Figure 8) and used 2-week-old mice. GSEA of the microarray data revealed induction of several enzymes for bile acid biosynthesis pathways in stat3⌬hc and stat3⌬hc mdr2⫺/⫺ mice (Figure 5A). We further investigated cho-

lestasis in stat3⌬hc and stat3⌬hc mdr2⫺/⫺ mice and analyzed levels of bile acids in the serum as indicators. Bile acids were increased significantly in stat3⌬hc mdr2⫺/⫺ mice when compared with stat3flox/flox mdr2⫺/⫺ mice (Figure 5B) and tended to be increased in stat3⌬hc mice (Figure 5B), indicating susceptibility to cholestasis or hypercholanemia. Hepatocytes compensate cholestasis by modulating expression of bile acid transport proteins, leading to a net increase in bile acid export. We observed down-regulation of basolateral bile acid importers and up-regulation of apical exporters in stat3⌬hc and stat3⌬hc mdr2⫺/⫺ mice (Supplementary Figure 9). In contrast, deregulation of bile acid transporters was not observed in a Stat3-deficient hepatocyte cell line established from stat3⌬hc p19⫺/⫺ mice under noncholestatic conditions in vitro (data not shown). Therefore, the changed expression pattern of bile acid transporters in stat3⌬hc and stat3⌬hc mdr2⫺/⫺ is most likely a secondary effect, confirming hypercholanemia or cholestasis.

STAT3 AND SCLEROSING CHOLANGITIS

2505

Figure 5. Stat3⌬hc mdr2⫺/⫺ mice show aggravation of cholestasis. (A) Heat map revealing up-regulation of bile acid biosynthesis genes in the absence of Stat3. (B) Bile acid (BA) concentrations in the serum are increased in the absence of Stat3 (n ⱖ 3 animals per genotype; age, 7 wk). (C) Real-time PCR analysis showing up-regulation of IL-6 and TNF␣ expression in stat3⌬hc mdr2⫺/⫺ mice (n ⱖ 3 animals per genotype; age, 7 wk). (D) Enzyme-linked immunosorbent analysis for TNF␣ protein in liver lysates (n ⫽ 4; age, 7 wk). (E) Electrophoretic mobility shift assay for NF-␬B activity. Whole-liver lysates from stat3⌬hc mdr2⫺/⫺ and stat3flox/flox mdr2⫺/⫺ mice were used for electrophoretic mobility shift assay (lanes 1– 6). Competition assays were performed by adding unlabeled oligonucleotides in 25-fold molar excess (lanes 7 and 8). As control, HEK 293 cells were transfected with plasmids expressing p65 (lane 9). Supershift assays were performed by preincubation with 1 ␮g (lane 10) and 4 ␮g (lane 11) p65 antibody to the reaction mixture. (F) Double immunofluorescence of liver sections showed localization of activated Phospho-Ser-536-p65 (green) in F4/80⫹ Kupffer cells (red; arrowheads in the merged column) of stat3⌬hc mdr2⫺/⫺ mice (n ⫽ 4; age, 7 wk).

We next evaluated cytokine expression indicative for the presence of T cells and activated Kupffer cells. Levels of IL-6 messenger RNA (mRNA), TNF␣ mRNA, and protein were increased in stat3⌬hc mdr2⫺/⫺ mice (Figure 5C and D and Supplementary Figure 10). TNF␣ is a procholestatic cytokine that affects the barrier function of cholangiocytes.17,18 It is produced mainly by Kupffer cells and regulated by the transcription factor NF-␬B.19 The latter was found activated in stat3⌬hc mdr2⫺/⫺ mice (Figure 5E). Interestingly, immunohistochemistry showed that (in addition to nonparenchymal cells) predominantly cholangiocytes of stat3⌬hc mdr2⫺/⫺ mice stained positive for the NF-␬B subunit p65 (Supplementary Figure 11A). Quantitative histomorphometry showed that p65 is located in the nucleus of at least a subset of cholangiocytes (Supplementary Figure 11B and C). To address the question if Stat3-deficient cholangiocytes contribute to TNF␣ production, we performed in vitro short hairpin RNA knockdown experiments with an immortalized murine cholangiocyte cell line. Knockdown of

Stat3 did not affect cholangiocyte proliferation but induced TNF␣ mRNA expression (Supplementary Figure 11D and data not shown). However, Western blot experiments from cell lysates and enzyme-linked immunosorbent assays from cell culture supernatants showed that Stat3 knockdown cholangiocytes did not produce more TNF␣ protein despite increased mRNA levels (data not shown). Moreover, NF-␬B was activated mainly in Kupffer cells of stat3⌬hc mdr2⫺/⫺ mice as shown by double immunofluorescence for activated Phospho-p65 and F4/80 (Figure 5F). These data suggest that Kupffer cells are the major producers of TNF␣ in stat3⌬hc mdr2⫺/⫺ mice.

Hepatoprotective Pathways Are Affected in Stat3⌬hc Mdr2ⴚ/ⴚ Mice In addition to deregulated bile acid biosynthesis, GSEA analysis revealed down-regulation of hepatoprotective pathways for EGFR and IGF-1 in stat3⌬hc and in stat3⌬hc mdr2⫺/⫺ mice (Figure 6A). Reduced mRNA ex-

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

June 2010

2506

MAIR ET AL

GASTROENTEROLOGY Vol. 138, No. 7

Figure 6. Down-regulation of signaling pathways that protect from bile acid–induced hepatic injury in stat3⌬hc mice. (A) Heat map revealing down-regulation of IGF-1 and EGFR in liver samples lacking Stat3. (B) Confirmation of reduced mRNA expression for IGF-1 and EGFR in liver samples of stat3⌬hc mice, stat3⌬hc mdr2⫺/⫺ mice, and stat3⌬hc mice after CA feeding by real-time PCR (n ⱖ 3 animals per genotype; age, 7 wk). (C) Western blot data showing reduced protein expression for EGFR and IGF-1 in stat3⌬hc mice and stat3⌬hc mdr2⫺/⫺ mice when compared with controls. The substantial amount of P-Stat3 in stat3⌬hc mdr2⫺/⫺ mice is most likely owing to activation of Stat3 in Kupffer cells and other nonparenchymal cells. Expression of Hsc-70 was used as loading control. (D) Model of how Stat3 may protect from bile acid–induced hepatic injury. For details see the Discussion section. BD, bile duct; BA, bile acids.

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

pression for EGFR and IGF-1 was confirmed by real-time PCR analysis in stat3⌬hc, stat3⌬hc mdr2⫺/⫺, and stat3⌬hc mice treated with CA (Figure 6B). Immunoblotting confirmed reduced expression of EGFR and IGF-1 at the protein level (Figure 6C). We next substituted IGF-1 levels in stat3⌬hc mdr2⫺/⫺ mice by injection of recombinant murine IGF-1. Treatment of mice for 4 weeks slightly ameliorated collagen deposition but the beneficial effect was not significant (Supplementary Figure 12). These data support our hypothesis that development of fibrosis in stat3⌬hc mdr2⫺/⫺ mice is owing to synergistic effects in cholangiocytes and hepatocytes (Figure 6D).

Discussion Recent advances in the treatment of chronic liver diseases suggest that hepatic fibrosis is a reversible process. Therefore, the identification of genes and cellular mechanisms implicated in fibrosis progression has gained importance for therapeutic purposes. Stat3⌬hc mdr2⫺/⫺ mice combine several molecular and cellular events of fibrotic liver diseases that might explain the severity of liver fibrosis in stat3⌬hc mdr2⫺/⫺ mice that resembled cirrhosis in terminally sick animals.

The mdr2 (Abcb4) gene encodes a pump in the canalicular membrane that enriches the bile with phospholipids. The latter form mixed micelles with bile acids, which reduces their toxicity. Consequently, the bile of mdr2⫺/⫺ mice is more toxic and causes damage of bile ducts, leading to mild cholestasis and periportal fibrosis.20 Stat3 is activated by phosphorylation at Tyr705 in hepatocytes and cholangiocytes of mdr2⫺/⫺ mice, suggesting a hepatoprotective function for IL-6/Stat3 signaling in bile acid–induced liver injury. Consistently, loss of IL-6 or conditional inactivation of stat3 in cholangiocytes and hepatocytes strongly aggravated hepatocellular damage of mdr2⫺/⫺ mice. Interestingly, stat3⌬hc mdr2⫺/⫺ mice displayed strong activation of Stat3 in nonparenchymal cells including Kupffer cells. Further investigations are needed to address the question of whether the increase of Tyr705-phosphorylated Stat3 in nonparenchymal cells is secondary owing to the altered cytokine milieu (eg, up-regulation of IL-6 expression) or related directly to increased fibrosis. The hepatoprotective function for IL-6/Stat3 signaling in bile acid–induced liver injury is underlined by the observation that IL-6⫺/⫺ mice developed more severe fibrosis after bile duct ligation

than control mice.21,22 Moreover, bile duct ligation in IL-6⫺/⫺ mice and mice with conditional deletion of the gp130 receptor in the liver resulted in accumulation of black bile in the gallbladder,21–23 which is the consequence of a continuous leakage of the biliary tree.24 Similarly, black bile was present in diseased stat3⌬hc mdr2⫺/⫺ mice, and levels of alkaline phosphatase were increased before severe hepatic injury in 2-week-old animals. This suggests that damage of cholangiocytes and leakage of bile ducts is an early event of fibrosis development in stat3⌬hc mdr2⫺/⫺ mice. IL-6/gp130/Stat3 signaling has been implicated in the maintenance of cholangiocyte barrier function via regulation of cholangioprotective factors such as trefoil and small prolinerich proteins.25 However, microarray analysis showed that mRNA expression of trefoil-1 and small proline-rich proteins small proline-rich 1a and small proline-rich 2a was similar in stat3flox/flox mdr2⫺/⫺ and stat3⌬hc mdr2⫺/⫺ mice. Expression of trefoil-3 was even up-regulated in stat3⌬hc mdr2⫺/⫺ mice. Moreover, cholangiocyte barrier function is affected by the cytokines TNF␣ and interferon-␥, which are produced by inflammatory cells and activated Kupffer cells.17,18 Our data suggest that TNF␣ production by Kupffer cells is increased in stat3⌬hc mdr2⫺/⫺ mice, which might affect barrier function of cholangiocytes. In addition to cholangiocytes, hepatocytes contribute to cholestasis and severe liver damage in stat3⌬hc mdr2⫺/⫺ mice. Loss of Stat3 leads to up-regulation of bile acid biosynthesis genes such as cyp7a1 and cyp27a1, which encode key enzymes for classic and alternative bile acid synthesis pathways, respectively.26 Increased bile acid biosynthesis might synergize with reduced barrier function and aggravate cholestasis. Further studies will show if Stat3 controls expression of bile acid biosynthesis genes independently or together with known regulators such as farnesoid x receptor-alpha (FXR-␣) or hepatocyte nuclear factor-4 (HNF-4).27,28 In cell culture and during chronic cholestatic diseases, bile acid–induced hepatocyte apoptosis occurs in a Fasand Trail-dependent manner.29,30 In contrast, during acute cholestasis (eg, after bile duct ligation in rodents), necrosis might be the predominant form of cell death.31 The absence of DNA fragmentation and the presence of bile infarcts in stat3⌬hc mdr2⫺/⫺ mice point to necrotic damage of hepatocytes. However, we cannot exclude apoptosis at an earlier stage of disease development before bile infarcts are evident. GSEA analysis of genes expressed at lower levels in stat3⌬hc and stat3⌬hc mdr2⫺/⫺ mice revealed down-regulation of the EGFR and IGF-1 pathways. EGFR and IGF-1 signaling protect hepatocytes from toxic bile acids. This has been shown in vitro where expression of a dominant-negative IGF-1 receptor or dominant-negative ERBB1 sensitized hepatocytes to bile acids. A similar effect was observed after pretreatment of hepatocytes with NVP-ADW742 (IGF-1 antagonist) or

STAT3 AND SCLEROSING CHOLANGITIS

2507

Iressa (EGFR antagonist).32–35 Therefore, our results suggest that Stat3 prevents bile acid–induced liver injury and fibrosis by a dual mechanism that involves cholangiocytes, hepatocytes, and Kupffer cells (Figure 6D): (1), Stat3 prevents damage of cholangiocytes and cholestasis, thereby reducing TNF␣ production by Kupffer cells and further TNF␣-mediated leakage of bile ducts; (2) Stat3 activates hepatoprotective EGFR and IGF-1 signaling pathways in hepatocytes and negatively regulates bile acid biosynthesis that would aggravate cholestasis. Interestingly, Stat3 activity is reduced in patients suffering from hepatitis C virus–induced and alcohol-induced cirrhosis.36,37 This suggests that Stat3 also could protect from liver fibrosis with nonbiliary etiology, which deserves further studies.

Supplementary Material Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at www.gastrojournal.org, and at doi: 10.1053/j.gastro.2010.02.049. References 1. Trauner M, Boyer JL. Cholestatic syndromes. Curr Opin Gastroenterol 2004;20:220 –230. 2. Bataller R, Brenner DA. Liver fibrosis. J Clin Invest 2005;115: 209 –218. 3. Weiler-Normann C, Herkel J, Lohse AW. Mouse models of liver fibrosis. Z Gastroenterol 2007;45:43–50. 4. Haga S, Terui K, Zhang HQ, et al. Stat3 protects against Fasinduced liver injury by redox-dependent and -independent mechanisms. J Clin Invest 2003;112:989 –998. 5. Li W, Liang X, Kellendonk C, et al. STAT3 contributes to the mitogenic response of hepatocytes during liver regeneration. J Biol Chem 2002;277:28411–28417. 6. Gao B. Cytokines, STATs and liver disease. Cell Mol Immunol 2005;2:92–100. 7. Inoue H, Ogawa W, Ozaki M, et al. Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo. Nat Med 2004;10:168 –174. 8. Smit JJ, Schinkel AH, Oude Elferink RP, et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451– 462. 9. Alonzi T, Maritano D, Gorgoni B, et al. Essential role of STAT3 in the control of the acute-phase response as revealed by inducible gene inactivation [correction of activation] in the liver. Mol Cell Biol 2001;21:1621–1632. 10. Kellendonk C, Opherk C, Anlag K, et al. Hepatocyte-specific expression of Cre recombinase. Genesis 2000;26:151–153. 11. Kamijo T, Zindy F, Roussel MF, et al. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell 1997;91:649 – 659. 12. Moriggl R, Gouilleux-Gruart V, Jahne R, et al. Deletion of the carboxyl-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype. Mol Cell Biol 1996;16:5691–5700. 13. Jamall IS, Finelli VN, Que Hee SS. A simple method to determine nanogram levels of 4-hydroxyproline in biological tissues. Anal Biochem 1981;112:70 –75. 14. Fickert P, Zollner G, Fuchsbichler A, et al. Ursodeoxycholic acid aggravates bile infarcts in bile duct-ligated and Mdr2 knockout

BASIC–LIVER, PANCREAS, AND BILIARY TRACT

June 2010

2508

15. 16. 17.

18.

19.

20.

21.

22.

23.

24. 25.

26.

27. BASIC–LIVER, PANCREAS, AND BILIARY TRACT

28.

29.

30.

MAIR ET AL

mice via disruption of cholangioles. Gastroenterology 2002;123: 1238 –1251. Murray PJ. The JAK-STAT signaling pathway: input and output integration. J Immunol 2007;178:2623–2629. Friedman SL. Mechanisms of hepatic fibrogenesis. Gastroenterology 2008;134:1655–1669. Hanada S, Harada M, Koga H, et al. Tumor necrosis factor-alpha and interferon-gamma directly impair epithelial barrier function in cultured mouse cholangiocytes. Liver Int 2003;23:3–11. Spirli C, Nathanson MH, Fiorotto R, et al. Proinflammatory cytokines inhibit secretion in rat bile duct epithelium. Gastroenterology 2001;121:156 –169. Shakhov AN, Collart MA, Vassalli P, et al. Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages. J Exp Med 1990;171:35– 47. Fickert P, Fuchsbichler A, Wagner M, et al. Regurgitation of bile acids from leaky bile ducts causes sclerosing cholangitis in Mdr2 (Abcb4) knockout mice. Gastroenterology 2004;127:261–274. Ezure T, Sakamoto T, Tsuji H, et al. The development and compensation of biliary cirrhosis in interleukin-6-deficient mice. Am J Pathol 2000;156:1627–1639. Liu Z, Sakamoto T, Yokomuro S, et al. Acute obstructive cholangiopathy in interleukin-6 deficient mice: compensation by leukemia inhibitory factor (LIF) suggests importance of gp-130 signaling in the ductular reaction. Liver 2000;20:114 –124. Wuestefeld T, Klein C, Streetz KL, et al. Lack of gp130 expression results in more bacterial infection and higher mortality during chronic cholestasis in mice. Hepatology 2005;42:1082–1090. Hashmonai M, Kam I, Schramek A. The etiology of ”white bile” in the biliary tree. J Surg Res 1984;37:479 – 486. Demetris AJ, Lunz JG 3rd, Specht S, et al. Biliary wound healing, ductular reactions, and IL-6/gp130 signaling in the development of liver disease. World J Gastroenterol 2006;12:3512–3522. Thomas C, Pellicciari R, Pruzanski M, et al. Targeting bile-acid signalling for metabolic diseases. Nat Rev Drug Discov 2008;7: 678 – 693. Goodwin B, Jones SA, Price RR, et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000;6:517–526. Zhang M, Chiang JY. Transcriptional regulation of the human sterol 12alpha-hydroxylase gene (CYP8B1): roles of hepatocyte nuclear factor 4alpha in mediating bile acid repression. J Biol Chem 2001;276:41690 – 41699. Faubion WA, Guicciardi ME, Miyoshi H, et al. Toxic bile salts induce rodent hepatocyte apoptosis via direct activation of Fas. J Clin Invest 1999;103:137–145. Higuchi H, Yoon JH, Grambihler A, et al. Bile acids stimulate cFLIP phosphorylation enhancing TRAIL-mediated apoptosis. J Biol Chem 2003;278:454 – 461.

GASTROENTEROLOGY Vol. 138, No. 7

31. Fickert P, Trauner M, Fuchsbichler A, et al. Oncosis represents the main type of cell death in mouse models of cholestasis. J Hepatol 2005;42:378 –385. 32. Dent P, Han SI, Mitchell C, et al. Inhibition of insulin/IGF-1 receptor signaling enhances bile acid toxicity in primary hepatocytes. Biochem Pharmacol 2005;70:1685–1696. 33. Qiao L, Studer E, Leach K, et al. Deoxycholic acid (DCA) causes ligand-independent activation of epidermal growth factor receptor (EGFR) and FAS receptor in primary hepatocytes: inhibition of EGFR/ mitogen-activated protein kinase-signaling module enhances DCAinduced apoptosis. Mol Biol Cell 2001;12:2629 –2645. 34. Qiao L, Yacoub A, Studer E, et al. Inhibition of the MAPK and PI3K pathways enhances UDCA-induced apoptosis in primary rodent hepatocytes. Hepatology 2002;35:779 –789. 35. Rao YP, Studer EJ, Stravitz RT, et al. Activation of the Raf-1/ MEK/ERK cascade by bile acids occurs via the epidermal growth factor receptor in primary rat hepatocytes. Hepatology 2002;35: 307–314. 36. Horiguchi N, Ishac EJ, Gao B. Liver regeneration is suppressed in alcoholic cirrhosis: correlation with decreased STAT3 activation. Alcohol 2007;41:271–280. 37. Starkel P, Saeger CD, Leclercq I, et al. Role of signal transducer and activator of transcription 3 in liver fibrosis progression in chronic hepatitis C-infected patients. Lab Invest 2007;87:173– 181. Received February 23, 2009. Accepted February 16, 2010. Reprint requests Address requests for reprints to: Robert Eferl, MD, Ludwig Boltzmann Institute for Cancer Research, Waehringer Strasse 13a, A-1090 Vienna, Austria. e-mail: [email protected]; fax: (43) 1-4277-9641. Acknowledgments The authors thank Dr Ilan Stein for providing mdr2ⴚ/ⴚ mice; Drs Maria Sibilia and Peter Hasselblatt for helpful discussions; and Deeba Kahn and Michaela Schlederer for technical assistance. The rat anti–Troma-III antibody against K19 developed by Dr Rolf Kemler was obtained from the Developmental Studies Hybridoma Bank (developed under the auspices of the National Institute of Child Health and Human Development and maintained by the University of Iowa). GEO series accession number: GSE18759. Conflicts of interest The authors disclose no conflicts. Funding This work was supported by the Austrian Science Fund (FWF) grants SFB F28 (R.E. and W.M.), GENAU “Austromouse” (R.E. and E.C.), P18613-B05 (M.T.), and P19118-B05 (M.T.).