Single-nucleotide polymorphism analysis by hybridization protection assay on solid support

ANALYTICAL BIOCHEMISTRY Analytical Biochemistry 307 (2002) 25–32 www.academicpress.com

Single-nucleotide polymorphism analysis by hybridization protection assay on solid support Susumu Goto,* Aki Takahashi, Keiichi Kamisango, and Koichi Matsubara Chugai Diagnostics Science, Takada 3-41-8, Toshima-ku, Tokyo 171-8545, Japan Received 12 October 2001

Abstract The clinical need for high-throughput typing methods of single-nucleotide polymorphisms (SNPs) has been increasing. Conventional methods do not perform well enough in terms of speed and accuracy to process a large number of samples, as in clinical testing. We report a new DNA microarray method that uses hybridization protection assay (HPA) by acridinium-ester-labeled DNA probes. Probes were immobilized on the bottom of streptavidin-coated microtiter plates by streptavidin–biotin binding. We studied aldehyde dehydrogenase 2 (ALDH2) genotyping using two probes, discriminating A/G polymorphism. We also designed four probes to type the Alzheimer’s disease-related gene ApoE, which has three genotypes (ApoE2, 3, and 4) determined by two SNP loci (C/T polymorphism). SNP analysis of the ALDH2 gene or the ApoE gene from human genome samples by solid-phase HPA was successful. Unlike other methods, the microarray by HPA does not require a washing step and can be completed within 30 min. It also has advantages in discriminating one-base mismatch in targets. These characteristics make it a good candidate for practical SNP analysis of disease-related genes or drug-metabolizing enzymes in large numbers of samples. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: SNP; HPA; DNA microarray; ApoE gene; Aldehyde dehydrogenase gene

Single-nucleotide polymorphisms (SNPs)1 in the human genome play an important role in the progression of diseases. The genome-wide distribution of SNPs can be utilized to screen for disease-related genes by linkage analysis or LOH (loss of heterogeneity) analysis, such as microsatellite markers. SNP can affect gene function through amino acid substitution, modification of gene expression, or splicing. Thus SNP analysis of diseaserelated genes or genes encoding drug-metabolizing enzymes could be utilized for disease prevention and to obtain important information for therapeutic strategies. Although DNA sequencing by the dideoxy method has become the gold standard for SNP analysis, it is not appropriate for clinical testing, because it is time and labor intensive. SNP analyses based on allelic discrimination by *

Corresponding author. Fax: +81-3-3989-0785. E-mail address: [email protected] (S. Goto). 1 Abbreviations used: SNP, single-nucleotide polymorphism; HPA, hybridization protection assay; AE, acridinium-ester; ALDH, aldehyde dehydrogenase.

gene amplification methods such as PCR have been evaluated extensively [1–6]. The minisequencing by mass spectrometry, pyrosequencing, or flow cytometry has also been assessed recently as detection methods for PCR products or SNP analysis methods by themselves [7–13]. The DNA microarray approach [14–18] would be one of the most practical methods of clinical application of SNP analysis, however, certain improvements are required. Conventional microarrays are time consuming, with most of them requiring hours or even overnight for the hybridization step [18]. The magnitude of Tm difference by SNP depends on the surrounding sequence including polymorphic base itself. Thus, it is difficult to distinguish one base substitution only by Tm difference on many targets having different sequences under identical assay condition. Since microarray was originally designed to analyze thousands of genes in fewer samples, it is not suitable for analyses of large numbers of samples. In future applications, lower numbers of clinically significant SNPs (a few hundred) will be selected and analyzed routinely in each disease area, such as

0003-2697/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 0 3 - 2 6 9 7 ( 0 2 ) 0 0 0 1 9 - 2

26

S. Goto et al. / Analytical Biochemistry 307 (2002) 25–32

cancer or circulation-related diseases. Speed, accuracy, assay automation, and low cost will be required for these screening purposes. To overcome the limitations of conventional SNP analysis methods, we assessed solid-phase hybridization protection assay (HPA) using acridinium-ester-labeled DNA oligomers as probes immobilized on solid substrate by streptavidin–biotin binding. The acridinium-ester is protected from hydrolysis in the hydrophobic regions of double-stranded DNA when the probe is hybridized with its target. Bound-free separation is not required, since the acridinium-esters of the free probes are hydrolyzed and lose their luminescence quickly. When there is a nucleotide sequence mismatch between the probe and the target, the double-stranded structure of DNA is destroyed, and the acridinium-ester is also hydrolyzed [19,20]. We assessed two genes, aldehyde dehydrogenase 2 (ALDH2) and ApoE as a model system by using two probes for ALDH2 and four probes for ApoE, labeled with acridinium-ester for human genome typing. These two genes were examined to assess the performance of solid-phase HPA with lower (41–44%, ALDH2) or higher (57–84%, ApoE) GC content of the probe sequences. ALDH2 responsible for the oxidation of acetaldehyde produced during ethanol metabolism, represents two genotypes (active form ALDH21 and inactive form ALDH22 ) determined by G/A polymorphism at codon 487 in exon 12 [21]. The Alzheimer’sdisease-related gene ApoE, represents three genotypes (ApoE2, 3, and 4) determined by C/T polymorphism at codons 112 and 158 [22–26] (Table 1).

syl, and 0.1 M mercaptoethanol, and the mixture was vortexed for 1 min. After adding 0.7 ml of ethanol to the mixture, the suspension was shaken several times until the DNA was visible. After centrifugation (12,000g, 10 min, 4 °C), the pellet was rinsed with 75% ethanol, dried, and dissolved in 100 ll of H2 O. Sequencing The ALDH2 gene and ApoE gene sequence of genome samples were determined by the dideoxy method. Asymmetric PCR The reaction mixture contained 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, 1 unit of Taq DNA polymerase in 50 ll. ALDH2 gene was amplified using 2 pmol of DWC11 (CAAA TTACAGGGTCAACTGCTATG) and 20 pmol of DWC10 (CCACACTCACAGTTTTCAC). For ApoE gene amplification, DMSO was added to 10% with 1.7 pmol Primer-Up (TCCAAGGAGCTGCAGGCG GCGCA), 50 pmol Primer-Down (ACAGAATTCGCC CCGGCCTGGTACACTGCCA). ALDH2 gene was amplified by 35 cycles of the following incubations: 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. ApoE gene amplification was achieved as follows. The reaction mixture was heated to 94 °C for 5 min, then subjected to 40 cycles of 94 °C for 30 s, 65 °C for 30 s, 72 °C for 90 s, and final extension at 72 °C for 5 min. The amplification product was heated at 94 °C and cooled on ice prior to HPA.

Materials and methods

Synthesis of acridinium-ester-labeled biotinylated probe

Preparation of genomic DNA

30 -biotinylated probes were synthesized with a DNA synthesizer (ABI 394 DNA/RNA synthesizer) by using a 30 -biotin TEG CPG column (Glen Research) and acridinium-ester labeled via an amino linker arm (Gen-Probe). The free acridinium-esters were removed by reverse phase HPLC purification. The probes were spotted on the bottom of a white streptavidin-coated microtiter plate (Labsystems) with thin tips. The probe on each spot was estimated to be 50–100 nl, 1–5  106 relative light

A 5-ml blood specimen was collected from healthy volunteers, and genome samples were prepared by the method described in a previous report [27]. Briefly, the red blood cells in 200 ll of peripheral blood were lysed with hypotonic buffer. The leukocytes were then mixed with 0.7 ml of solution D (pH 7), containing 4 M guanidine thiocyanate, 25 mM sodium citrate, 0.5% sarko-

Table 1 Combination of genotypes and probe reaction for SNP typing of the ApoE gene Probes for codon 112

Genotype (combination)

Probes for codon 158

p112Arg

p112Cys

p158Arg

p158Cys

) ) + ) + +

+ + + + + )

) + + + + +

+ + + ) ) )

ApoE ApoE ApoE ApoE ApoE ApoE

2/2 2/3 2/4 3/3 3/4 4/4

Note. Polymorphism of amino acid Arg (CGC) or Cys (TGC) is determined by SNPs at codons 112 and 158 on the ApoE gene.

S. Goto et al. / Analytical Biochemistry 307 (2002) 25–32

units with a chemiluminescence analyzer (Leader 450, Gen-Probe). The probe sequences are as follows: pAL21, 50 -CAGGCATACACT*GAAGTGAAAACTGTGtaaa aaaaaaaaaaa-30 (biotin); pAL22, 50 -CAGGCATACA CT*AAAGTGAAAACTGTataaaaaaaaaaaaa-30 (biotin); p112Arg, 50 -GAGGACGTG*CGCGGCCGCC aaaaaaaaaaaaaaa-30 (biotin); p112Cys, 50 -AGGACG TGT*GCGGCCGCCTGaaaaaaaaaaaaaaa-30 (biotin); p158Arg, 50 -CTGCAGAAG*CGCCTGGCAGTGTA aaaaaaaaaaaaaaa-30 (biotin); p159Cys, 50 -CTGCAGAA GT*GCCTGGCAGTGTAaaaaaaaaaaaaaaa-30 (biotin). Asterisks indicate the positions of acridinium-ester on the probes. The SNP regions are underlined. Target hybridization sequences are designated by capitals. The probes are biotinylated on their 30 ends spaced by 15 adenine bases (thymidine is used partially to avoid complement to target sequence). Following two probes were synthesized to assess the effect of the polyadenine spacer sequence: 158A6b, 50 -CTGCAGAAG*CGCCTG GCAG-30 (biotin); 158A6bs, 50 -CTGCAGAAG*CGCC TGGCAGaaaaaaaaaaaaaaaaaaaa-30 (biotin). Solid-phase HPA Probe spots were dried and then washed three times with 10 mM Tris–HCl buffer (pH 7.0) containing 100 mM NaCl. After adding 15 ll each of hybridization buffer [230 mM LiOH, 10 mM EGTA, 20 mM EDTA, 100 mM succinic acid, 1.2 M LiCl, 2% lauryl lithium sulfate, 15 mM aldrithiol (pH 4.7)] and target solution, the plate was incubation at 60 °C for 15 min. Then, 75 ll of selection reagent (600 mM boric acid, 182 mM NaOH, 1% Triton X-100) was added, and the plate was incubated at 60 or 47 °C (to assess the effect of spacer in the probe sequence) for 10 min. A 100-ll volume of detection reagent (0.1% H2 O2 , 0.001 N HNO3 , 1 N NaOH) was dispensed, and images were captured for 7 s by an Aquacosmos photon-counting imaging system (Hamamatsu). A black sheet was inserted into the inner wall of the well to avoid light scattering.

27

were spotted and immobilized on the bottoms of the streptavidin-coated microtiter plate. PCR products from human genome samples, complementary and/or mismatch oligomers, were added to the wells and incubated at 60 °C for 15 min. The probes were hybridized with complementary targets and partially with mismatch targets. The selection reagent was then added to the wells, and the plate was incubated at 60 °C for 10 min so that acridinium-ester of the free probes and probes hybridized with mismatch targets were hydrolyzed and lost luminescence (Fig. 1B and D). The acridinium-ester of the probes with full complementary target was protected from hydrolysis in the hydrophobic region of the double-stranded DNA structure (Fig. 1C). When the detection reagent was added, only the probes with the full complementary target emitted intense chemiluminescence. Imaging system The imaging system is one of the systems in the Aquacosmos series by Hamamatsu Photonics K. K. and based on a photon-counting CCD (charge-coupled device) camera (VIM Camera C2400-35). Examination of probe sequence The sensitivity and specificity of the probes were evaluated by using full complementary and mismatched

Dynamic range of the imaging system The acridinium-ester-labeled probe was diluted 1– 3000 times with hybridization buffer. A 5-ll volume of diluent was added to the microtiter well, and chemiluminescence was detected for 7 s with the Aquacosmos (Hamamatsu).

Results Solid-phase HPA The two AE-labeled probes with biotin on their 30 end required for ALDH2 genotyping, or four for ApoE,

Fig. 1. Scheme diagrams of the solid-phase HPA. (A) Probe before hybridization and (B–D) detection step after hydrolysis without a target (B), with a full complementary target (C), and with a mismatched target (D). The acridinium-esters on the free probes and on the probes hybridized with mismatched targets are hydrolyzed and lose their luminescence.

28

S. Goto et al. / Analytical Biochemistry 307 (2002) 25–32

Table 2 Results of the solid-phase HPA with (158A6bs) or without (158A6b) 20 bases of adenine spacer in the probe Target oligomer

158A6b 158A6bs

t158A

t158C

1338 6117

383 622

S/N ratio (t158A/t158C) 3.5 9.8

Note. Numbers represent chemiluminescence counts and S/N ratios. See Materials and methods for probe sequences.

target oligomers. Two probes (pAL21, pAL22) for ALDH2 typing and four probes (p112Arg, p112Cys, p158Arg, p158Cys) for ApoE typing were selected and used for solid-phase HPA (see Materials and methods for probe sequences). The polyadenine spacer sequence between the target hybridization sequence and the biotin at the 30 -end improved both the positive signal and the S/N (signal by the complementary target to noise by the mismatched target) ratio (Table 2). The probe spot area was about 2.7 times larger than that in Fig. 2 or 3 since the spot was single in each well in this experiment. The selection step was performed at 47 °C in order to achieve suffi-

Fig. 2. The spot arrangement of the two probes in a well is shown in A. The results with 10 nM of full complementary oligomers are shown in two left panels in B. Target oligomer tgt21, complementary to the probe pAL21, was added in the leftmost panel. Target oligomer tgt22, complementary to the probe pAL22, was added in the second panel. Examples of the amplified ALDH2 gene detection by solid-phase HPA are shown in the next three panels in B and C based on data in Table 3.

cient positive signal by the probe without spacer (158A6b). Results of ALDH2 probes with complementary oligonucleotide targets As shown in Fig. 2B and C, the luminescence of the probes with mismatched targets were suppressed compared to the luminescence of the probes with complementary targets and produced a sufficient S/N ratio. As shown in leftmost panel in Fig. 2B, when target oligomer tgt21 was added, complementary AE probe pAL21 emitted high chemiluminescence, but the chemiluminescence of AE probe pAL22 was suppressed. An equal result was obtained with the other probes and the target combination in the second panel. ALDH2 genotyping The ALDH2 gene was amplified from 10 genome samples according to the method described by Crabb

Fig. 3. The spot arrangement of the four probes in a well is shown in A. The results with 10 nM each of two full complementary oligomers are shown in two left panels in B. A combination of t112A and t158C, complementary to probes p112Arg and p158Cys, respectively, was added in the leftmost panel. A combination of t112C and t158A, complementary to probes p112Cys and p158Arg, respectively, was added in the second panel. Examples of the amplified ApoE gene detection by solid-phase HPA are shown in the next three panels in B and C based on data in Table 4.

S. Goto et al. / Analytical Biochemistry 307 (2002) 25–32 Table 3 ALDH2 genotyping of clinical samples by solid-phase HPA Target oligomer

Clinical sample

Probe pAL21

pAL22

tgt21 tgt22

1806 226

416 1328

a b c d e f g h i j

2364 1796 1246 280 1191 826 1011 208 1007 1185

380 198 887 1180 224 1211 230 736 260 244

ALDH2 genotype

1/1 1/1 1/2 2/2 1/1 1/2 1/1 2/2 1/1 1/1

29

the luminescence of the probes with mismatched targets was suppressed compared to the probes with complementary targets and produce a sufficient S/N ratio even with higher GC content. Since there were no sequence similarities between the two loci (codons 112 and 158), no cross reaction was seen. ApoE genotyping The ApoE gene was amplified from 20 genome samples according by the method described by Wenham et al. [22] and detected by solid-phase HPA. A good S/N ratio was obtained with the three genotypes in our samples (Table 4, Fig. 3B and C). The ApoE sequences of the SNP regions were confirmed by the dideoxy method in these genome samples.

Note. Underline indicate positive signals.

et al. [21] and detected by solid-phase HPA. A good S/N ratio was obtained with all the three genotypes (Table 3, Fig. 2B and C). The ALDH2 sequences of the SNP regions were confirmed by the dideoxy sequencing method. Results of ApoE probe with complementary oligonucleotide targets ApoE gene has examined to assess the simultaneous detection of multiple (two) SNP regions. ApoE gene is also a good example with higher GC content of the probe sequences (57–84%). As shown in Fig. 3B and C,

Results of sample titration ALDH2 gene was amplified from the clinical sample ‘‘a’’ in Table 4 and diluted by 1–16 times, followed by solid-phase HPA detection to assess the effect of target concentration (Fig. 4). Dilution of the sample decreased positive signals however, 1/16 of the sample represented correct results. Dynamic range of the imaging system To evaluate the dynamic range of the imaging system, the AE-labeled probe was diluted 1–3000 times, and the

Table 4 ApoE genotyping of clinical samples by solid-phase HPA ApoE genotype

Probe p112Arg

p112Cys

p158Arg

p158Cys

Target oligomer

t112A, t158C t112C, t158A

1348 403

259 1700

278 1196

1346 329

Clinical sample

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

229 128 987 299 265 192 277 922 172 149 154 136 286 274 234 282 160 88 178 1130

992 882 1117 1266 1075 1656 979 1271 801 1045 908 1178 1052 914 906 1262 1506 1306 1100 996

980 812 1047 1391 967 1499 1296 2492 1960 1151 1622 1972 1586 1864 1780 1683 908 1223 1223 1227

1127 116 278 297 1260 272 321 328 177 257 157 180 233 227 142 203 157 143 204 213

Note. Underlines indicate positive signals.

2/3 3/3 3/4 3/3 2/3 3/3 3/3 3/4 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/4

30

S. Goto et al. / Analytical Biochemistry 307 (2002) 25–32

Fig. 4. Amplified ALDH2 gene of the clinical sample ‘‘a’’ was diluted up to 16 times with 10 mM Tris–HCl buffer (pH 7.0) containing 100 mM NaCl and 15 ll of diluent was detected by solid-phase HPA. Error bars represent standard deviations by three replications.

Fig. 5. Dynamic range of the detection system (Aquacosmos). A 5-ll volume of the diluent of an acridinium-ester-labeled probe (1–3000 times) was detected by the system together with distilled water (DW). The vertical axis represents chemiluminescence count by the same area with a probe spot in Fig. 4. Error bars show standard deviations of three replications.

chemiluminescence of 5 ll of diluent was measured by Aquacosmos in the microtiter plate (Fig. 5). The dynamic range was wide enough for solid-phase HPA imaging.

Discussion Conventional HPA has been performed in a liquid phase [19,20,27], whereas in this study we immobilized acridinium-ester-labeled probes to allow multiple HPA reactions in a single well. SNP analyses of the ALDH2 gene (example of lower GC content) or the ApoE gene (higher GC content) in human genome samples by solidphase HPA were successful. This method also includes many advantages of original HPA. Reduction of detection time by the solid-phase HPA to 30 min is a major improvement over conventional microarray. The probes used for HPA are labeled with acridinium-ester in the SNP region, so that the acridinium-ester is hydrolyzed

and loses its luminescence when the probe hybridizes with a mismatched target. This mechanism improves the S/N ratio of HPA over conventional methods that discriminate SNPs only by the Tm difference of the probe and target hybridization. The wash step is eliminated so that the selection reagent and two detection reagents are simply added to samples during the detection procedure. This feature makes HPA suitable for the automation required for clinical application. Performance of AE-labeled probes for HPA is regularly optimized by the AE label position and their target hybridization sequences including length. Since the Tm increases with higher GC content in general, the probes were designed to be shorter in high GC content compare to the probes with lower GC content (Table 5). As a consequence, these three SNP regions were detected with a moderate S/N ratio under identical analysis conditions even with the GC content variation. The probes were immobilized on the solid phase by streptavidin–biotin binding. Addition of the poly(A) spacer sequence between the target hybridization sequence and the 30 biotin end improved both the positive signal and the S/N ratio (Table 2). In the liquid-phase HPA, hybridization occurs between free molecules in three-dimensional space. Limitation of the reactions in solid-phase HPA to the two-dimensional surface on which the probes are immobilized probably decreases the opportunities for hybridization reactions. The stability of the probe-target hybrid may be affected by the probe immobilization. The additional spacer between the target hybridization sequence and the immobilized end may increases the freedom of the probe movement, consequently improves the probe performance. We assessed ALDH2 and ApoE genotyping as a SNP model to demonstrate the potential of solid-phase HPA. Practical SNP typing by 100 or more probes would require reduced spot diameter. A wider cavity area (e.g., 24- or 12-well plate) might be more suitable. Since the complementary strand of a double-stranded target competes with the probe on hybridization, detection sensitivity assumed to be better with asymmetric PCR product than symmetric PCR. From the results of the titration experiment, correct results would be expected if amplification efficiency happened to be as low as about one-tenth (Fig. 4). However, other amplifica-

Table 5 Probe length and GC%

p112Arg p112Cys p158Arg p158Cys pAL21 pAL22

Length

GC%

19 20 23 23 27 27

84 75 61 57 44 41

S. Goto et al. / Analytical Biochemistry 307 (2002) 25–32

tion method that generate single-stranded product may be applicable if asymmetric PCR is inadequate by its disadvantages on multiplex amplification. Transcription-mediated amplification (TMA, Gen-Probe) [28], NASBA [29] and PCR with RNA polymerase promoterlinked primer followed by transcription could be good candidates for future investigations. The sensitivity and resolution of the detection system (Aquacosmos) was sufficient for measurement of solidphase HPA. Chemiluminescence from the 1-mm probe spots was visualized by the system into 8–10 pixel diameters in this study. A probe spot of half or one-third the diameter can be imaged by this system if the same luminescence density is obtained. Automation would be desirable for routine SNP analysis. The automated HPA incubators with sample/ reagent dispensers for microtiter plates are already available. It would be applicable for detection of the solid-phase HPA. Extensive research has recently been focused on drugmetabolizing enzymes, such as cytochrome P450, which are potential targets of practical SNPs analysis. SNP data are anticipated to be utilized to optimize therapeutic strategies by predicting a patient’s response to agents. Many pharmaceutical companies have already begun to utilize SNP information for new drug development. HLA (human lymphocyte antigen) typing or identification of the causative organisms of infectious diseases are other possible uses of this method. In future applications, lower numbers of clinically significant targets (a few hundred) will be selected and analyzed routinely in each disease area. Solid-phase HPA would be a good candidate for such clinical SNP analyses in terms of speed, accuracy, and robustness.

Acknowledgments We thank Y. Okazaki for synthesizing and purifying the biotinylated AE probes, T. Kuda for providing basic information on ApoE genotyping by liquid-phase HPA, and M. Hirose for essential cooperation.

References [1] L.G. Lee, C.R. Connell, W. Bloch, Allelic discrimination by nicktranslation PCR with fluorogenic probes, Nucleic Acids Res. 21 (1993) 3761–3766. [2] K.J. Livak, J. Marmaro, J.A. Todd, Toward fully automated genome-wide polymorphism screening, Nat. Genet. 9 (1995) 341– 342. [3] S. Tyagi, F.R. Kramer, Molecular beacons: probes that fluoresce upon hybridization, Nat. Biotechnol. 14 (1996) 303–308. [4] S. Tyagi, D.P. Bratu, F.R. Kramer, Multicolor molecular beacons for allele discrimination, Nat. Biotechnol. 16 (1998) 49–53.

31

[5] W.M. Howell, M. Jobs, U. Gyllensten, A.J. Brookes, Dynamic allele-specific hybridization. A new method for scoring single nucleotide polymorphisms, Nat. Biotechnol. 17 (1999) 87–88. [6] J.G. Hall, P.S. Eis, S.M. Law, L.P. Reynaldo, J.R. Prudent, D.J. Marshall, H.T. Allawi, A.L. Mast, J.E. Dahlberg, R.W. Kwiatkowski, M. Arruda, B.P. Neri, V.I. Lyamichev, Sensitive detection of DNA polymorphisms by the serial invasive signal amplification reaction, Proc. Natl. Acad. Sci. USA 97 (2000) 8272–8277. [7] X. Chen, P.Y. Kwok, Template-directed dye-terminator incorporation (TDI) assay: A homogeneous DNA diagnostic method based on fluorescence resonance energy transfer, Nucleic Acids Res. 25 (1997) 347–353. [8] A.C. Syv€anen, From gels to chips: ‘‘Minisequencing’’ primer extension for analysis of point mutations and single nucleotide polymorphisms, Hum. Mutat. 13 (1999) 1–10. [9] S.J. Laken, P.E. Jackson, K.W. Kinzler, B. Vogelstein, P.T. Strickland, J.D. Groopman, M.D. Friesen, Genotyping by mass spectrometric analysis of short DNA fragments, Nat. Biotechnol. 16 (1998) 1352–1356. [10] P. Ross, L. Hall, I. Smirnov, L. Haff, High level multiplex genotyping by MALDI-TOF mass spectrometry, Nat. Biotechnol. 16 (1998) 1347–1351. [11] M. Ronaghi, M. Uhlen, P. Nyren, A sequencing method based on real-time pyrophosphate, Science 281 (1998) 363–365. [12] A. Ahmadian, B. Gharizadeh, A.C. Gustafsson, F. Sterky, P. Nyren, M. Uhlen, J. Lundeberg, Single-nucleotide polymorphism analysis by pyrosequencing, Anal. Biochem. 280 (2000) 103–110. [13] H. Cai, P.S. White, D. Torney, A. Deshpande, Z. Wang, R.A. Keller, B. Marrone, J.P. Nolan, Flow cytometry-based minisequencing: A new platform for high-throughput single-nucleotide polymorphism scoring, Genomics 66 (2000) 135–143. [14] S.P. Fodor, J.L. Read, M.C. Pirrung, L. Stryer, A.T. Lu, D. Solas, Light-directed, spatially addressable parallel chemical synthesis, Science 251 (1991) 767–773. [15] E.M. Southern, U. Maskos, J.K. Elder, Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: evaluation using experimental models, Genomics 13 (1992) 1008–1017. [16] G. Yershov, V. Barsky, A. Belgovsky, E. Kirillov, E. Kreindlin, I. Ivanov, S. Parinov, D. Guschin, A. Drobishev, S. Dubiley, A. Mirzabekov, DNA analysis and diagnostics on oligonucleotide microchips, Proc. Natl. Acad. Sci. USA 93 (1996) 4913–4918. [17] A.P. Shuber, L.A. Michalowsky, G.S. Nass, J. Skoletsky, L.M. Hire, S.K. Kotsopoulos, M.F. Phipps, D.M. Barberio, K.W. Klinger, High throughput parallel analysis of hundreds of patient samples for more than 100 mutations in multiple diseases genes, Hum. Mol. Genet. 6 (1997) 337–347. [18] C.M. Perou, T. Sørlie, M.B. Eisen, M. Rijn, S.S. Jeffrey, C.A. Rees, J.R. Pollack, D.T. Ross, H. Johnsen, L.A. Akslen, Ø. Fluge, A. Pergamenschikov, C. Williams, S.X. Zhu, P.E. Lønning, A.-L. Børresen-Dale, P.O. Brown, D. Botstein, Molecular portraits of human breast tumours, Nature 406 (2000) 747–752. [19] L.J. Arnold Jr., P.W. Hammond, W.A. Wiese, N.C. Nelson, Assay formats involving acridinium-ester-labeled DNA probes, Clin. Chem. 35 (1989) 1588–1594. [20] N.C. Nelson, P.W. Hammond, E. Matsuda, A.A. Goud, M.M. Becker, Detection of all single-base mismatches in solution by chemiluminescence, Nucleic Acids Res. 24 (1996) 4998–5003. [21] D.W. Crabb, H.J. Edenberg, W.F. Bosron, Li Ting-Kai, Genotypes for aldehyde dehydrogenase deficiency and alcohol sensitivity. The inactive ALDH22 allele is dominant, J. Clin. Invest. 83 (1989) 314–316. [22] P.R. Wenham, W.H. Price, G. Blundell, Apolipoprotein E genotyping by one-stage PCR, Lancet 337 (1991) 1158–1159. [23] E.H. Corder, A.M. Saunders, W.J. Strittmatter, D.E. Schmechel, P.C. Gaskell, G.W. Small, A.D. Roses, J.L. Haines, M.A. Pericak-Vance, Gene dose of apolipoprotein E type 4 allele and

32

S. Goto et al. / Analytical Biochemistry 307 (2002) 25–32

the risk of Alzheimer’s disease in late onset families, Science 261 (1993) 921–923. [24] K. Okuzumi, O. Onodera, H. Tanaka, H. Kobayashi, S. Tsuji, H. Takahashi, K. Oyanagi, K. Seki, M. Tanaka, S. Naruse, T. Miyatake, H. Mizusawa, I. Kanazawa, ApoE-4 and early-onset Alzheimer’s, Nat. Genet. 7 (1994) 10–11. [25] A.D. Roses, W.J. Strittmatter, M.A. Pericak-Vance, E.H. Corder, A.M. Saunders, D.E. Schmechel, Clinical application of apolipoprotein E genotyping to Alzheimer’s disease, Lancet 343 (1994) 1564–1565. [26] F. Oyama, H. Shimada, R. Oyama, Y. Ihara, Apolipoprotein E genotype, Alzheimer’s pathologies, and related gene expression in the aged population, Mol. Brain Res. 29 (1995) 92–98.

[27] K. Matsubara, Y. Koide, A. Kobayashi, R. Kaida, S. Takeda, E. Matusda, Y. Matsuoka, T.O. Yoshida, A rapid and sensitive method for HLA-DRB1 typing by acridinium-ester-labeled DNA probes, Hum. Immunol. 35 (1992) 132–139. [28] V. Jonas, M.J. Alden, J.I. Curry, K. Kamisango, C.A. Knott, R. Lankford, J.M. Wolfe, D.F. Moore, Detection and identification of Mycobacterium tuberculosis directly from sputum sediments by amplification of rRNA, J. Clin. Microbiol. 31 (1993) 2410–2416. [29] T. Kievits, B. van Gemen, D. van Strijp, R. Schukkink, M. Dircks, H. Adriaanse, L. Malek, R. Sooknanan, P. Lens, NASBA isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection, J. Virol. Methods 35 (1991) 273–286.