- Email: [email protected]
Specific detection and quantification of Aspergillus flavus and Aspergillus parasiticus in wheat flour by SYBR® Green quantitative PCR
International Journal of Food Microbiology 145 (2011) 121–125
Contents lists available at ScienceDirect
International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o
Specific detection and quantification of Aspergillus flavus and Aspergillus parasiticus in wheat flour by SYBR® Green quantitative PCR Noelia Sardiñas a, Covadonga Vázquez a, Jéssica Gil-Serna a, Ma Teresa González-Jaén b, Belén Patiño a,⁎ a b
Dpto. Microbiología III, Universidad Complutense de Madrid, Madrid, Spain Dpto. Genética, Universidad Complutense de Madrid, Madrid, Spain
a r t i c l e
i n f o
Article history: Received 23 June 2010 Received in revised form 8 November 2010 Accepted 30 November 2010 Keywords: Aspergillus parasiticus Aspergillus flavus Aflatoxins Wheat flour qPCR
a b s t r a c t Aflatoxins are important mycotoxins that represent a serious risk for human and animal health. These mycotoxins are mainly produced by Aspergillus flavus and Aspergillus parasiticus, two closely related species with different array of aflatoxins. In this work, two specific quantitative PCR (qPCR) assays were developed to detect and quantify both species in wheat flour using primers based on the multicopy ITS2 rDNA target sequence. The species specificity of the assays was tested in a wide range of strains of these species and others colonizing the same commodities. The sensitivity of the assay was estimated in 2.5 pg/reaction in both species. Discrimination capacity for detection and relative quantification of A. flavus and A. parasiticus DNA were analyzed using samples with DNA mixtures containing also other fungal species at different ratios. Both qPCR assays could detect spore concentrations equal or higher than 106 spores/g in flour samples without prior incubation. These assays are valuable tools to improve diagnosis at an early stage and in all critical control points of food chain integrated in HACCP strategies. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Aflatoxins are the most potent natural carcinogens known (JECFA, 1997) and they are recognized as a possible human carcinogen (group 1A) by International Agency of Research of Cancer (IARC, 1993). Additionally, they have hepatotoxic and immunosuppressive properties which cause acute liver damage, liver cirrhosis, tumour induction and teratogenesis (Chu, 1991). These mycotoxins are produced by several Aspergillus species which contaminate food and raw products. Because of the risk these represent for human and animal health, they are under stringent regulation (Commission of the European Communities, 2006), obliging the destruction of contaminated agricultural products which results in significant economic losses. Aspergillus flavus and Aspergillus parasiticus, both belonging to the section Flavi, are the two major aflatoxin-producing species (Bennett and Klich, 2003; Horn, 2007). These species contaminate numerous food commodities including cereals (Pittet, 1998), pistachios, nuts and peanuts (Jelinek et al., 1989), spices (Bartine and Tantaoui-Elaraki, 1997) and figs (Doster et al., 1996; Färber et al., 1997) in warm climates where they may produce aflatoxins at different points of the food chain, such as preharvest, processing, transportation or storage (Ellis et al., 1991). These species have different toxigenic profiles: A. flavus produces aflatoxin B1 (excreted in breast milk as M1) B2, cyclopiazonic acid, ⁎ Corresponding author. Departamento de Microbiología III. Facultad de Biología. Universidad Complutense de Madrid. 28040-Madrid, Spain. Tel.: +34 913 944 969; fax: +34 913 944 964. E-mail address: [email protected] (B. Patiño). 0168-1605/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2010.11.041
aflatrem, 3-nitropropionic acid, sterigmatocystin, versicolorin A and aspertoxin, whereas A. parasiticus produces aflatoxin B1, B2, G1, G2 and versicolorin A (Wilson et al., 2002). Discrimination of these two species from each other or from closely related species is difficult when conventional methods, based mainly on morphological features, are used and requires considerable expertise. The application of DNA-based techniques permits rapid, sensitive and specific detection, necessary to devise strategies to control or reduce fungal mass and toxin production at early and critical stages of the food chain. These methods have been used for the detection of aflatoxigenic strains of A. flavus and A. parasiticus. (Chen et al., 2002; Criseo et al., 2001; Färber et al., 1997; González-Salgado et al., 2008; Mayer et al., 2003; Sardiñas et al., 2010; Shapira et al., 1996; Somashekar et al., 2004; Sweeney et al., 2000; Zachová et al., 2003). Quantitative PCR (qPCR) has solved the limitations of conventional PCR, providing a tool for accurate and sensitive quantification of target DNA. The chemistries more widely used to develop qPCR assays are DNAassociating dyes (SYBR® Green I) or fluorescently labelled sequencespecific oligoprobes (TaqMan® oligoprobes) (Mackay et al., 2007). The lower cost of qPCR based on SYBR® Green provides an advantage for choice of this method for routine control analyses of commodities. However, SYBR® Green binds nonspecifically to double helix and this may involve a loss of specificity if primers–dimers or nonspecific fragments are present (Kubista et al., 2006). Because of this, we must consider the target sequence used to design the primers because it could condition the power of discrimination and the sensitivity of the assay. Most PCR assays for detection and quantification of mycotoxigenic fungi have been developed using as a target single copy mycotoxin
122
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
biosynthetic genes (Bluhm et al., 2002; Jurado et al., 2006; Mayer et al, 2003). However, the sensitivity of the assay is considerably improved when multi-copy sequences are used such as ITS1 and ITS2 (Internal Transcribed Spacers or the rDNA) regions. Furthermore, they are highly variable allowing discriminate among closely related species in the Aspergillus genus (Edwards et al., 2002). Both regions have been successfully used to detect and identify aflatoxigenic Aspergillus species (González-Salgado et al., 2008; Sardiñas et al., 2010). In this work, we develop a sensitive and specific assay to detect and quantify A. flavus and A. parasiticus in wheat flour, a basic product in human diet. Detection and quantification of these two important aflatoxin-producing species will provide critical information to predict mycotoxin profiles which may be present in this matrix. Moreover, previous reports indicated that mycotoxin concentration can be correlated with levels of fungi detected on naturally contaminated samples (Lund and Frisvad, 2003). 2. Materials and methods 2.1. Fungal isolates and culture conditions All the isolates used in this study are shown in Table 1. Fungal strains were obtained from different Culture Collections or were isolated from
diverse food matrices in our laboratory. The isolates were maintained by regular subculturing on Potato Dextrose Agar (PDA) (Pronadisa, Madrid, Spain) at 28± 1 °C for 3–4 days and then stored as spore suspension in 15% glycerol at −80 °C. Fungal strains were cultured for DNA extraction in Erlenmeyer flasks containing 20 ml of Sabouraud Broth (Pronadisa, Madrid, Spain) and incubated at 28 ± 1 °C in an orbital shaker (140 rpm) for 2 days. Mycelia were filtered through Whatman paper no. 1 and kept at −80 °C for DNA isolation. 2.2. DNA extraction DNeasy Plant Mini Kit (Qiagen, Valencia, Spain) was used according to manufacturer´s instructions to obtain genomic DNA, from 100 mg of fungal pure cultures and wheat flour. The yield of the method was evaluated in three independent extractions of A. flavus CECT 4592 and A. parasiticus CECT 2680. DNA concentrations were determined using a NanoDrop® ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, USA). The purity of the extractions was between 1.6 and 1.9. The DNA of the samples was diluted to 50 ng/μl. All genomic DNAs used in this work were tested for suitability for PCR amplification using primers 5.8 S1/5.8 S2 (Gil-Serna et al., 2009). The amplification program used was described by Henry et al. (2000).
Table 1 Fungal strains analysed indicating origin, species and host. STRAIN NRRL 502T NRRL 465 ATCC 56775 ATCC 22789 ATCC 15517 ATCC 22789 C31 C32 CECT 2680 CECT 2681 Cab5dch6 CECT 4592 FLA 9 FLA 109 ITEM 5135 ITEM 4592 ITEM 4591 ATCC 20043 NRRL 453T NRRL 1957 JMC 12721 IHEM 16077 M6hip1 IHEM 19289 IHEM 18041 T.TT.A.13 R.T.A.16 CECT 2808 CECT 2091 CECT 2574 TB 20 1 TB 2 1 TB 5 2 350a 190a CECT 2086 ITEM 4158b ITEM 4685b CECT 2092 CECT 2948 CECT 2093 CECT 2148 CECT 2906 a b
ORIGIN
Valladolid (Sp) Valladolid (Sp)
Albacete (Sp) Tunisia Tunisia Italy France France
Belgium Albacete (Sp) Japan French Guiana Zamora (Sp) Valladolid (Sp) Canada Valladolid (Sp) Soria (Sp) Valladolid (Sp) Spain Spain Italy Portugal
SPECIES A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. tamarii A. tamarii A. bombycis A. nomius A. fumigatus A. fumigatus A. terreus A. niger A. niger A. tubingensis A. tubingensis A. tubingensis A. carbonarius A. carbonarius A. carbonarius A. japonicus A. japonicus A. ochraceus A. ochraceus A. ochraceus Fusarium culmorum Penicillium verrucosum
Strains supplied by Dr. Sanchis (University of Lleida, Spain). Strains supplied by Dr. Moretti (ISP-NRC, Bari, Italy).
HOST
Barley Barley
Barley
Flour Wheat Wheat Soil Brazil nut Cellophane diaphragm Cottonseed Bread Barley Silkworm disease Mango tree Grapes Grapes
Wheat Wheat Wheat Grapes Grapes Grapes Grapes
FLAVIQ1/FLAQ2
FLAVIQ1/PARQ2
− − − − − − − − − − − + + + + + + + + + + − − − − − − − − − − − − − − − − − − − − − −
+ + + + + + + + + + + − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
2.3. Primer design We designed primers on the basis of sequence alignments of the ITS2 region of several strains from different origins and other related species obtained in our laboratory in previous works or retrieved from databases. The primers FLAVIQ1 (5′ GTCGTCCCCTCTCCGG 3′) and FLAQ2 (5′ CTGGAAAAAGATTGATTTGCG 3′) for A. flavus and FLAVIQ1 and PARQ2 (5′ GAAAAAATGGTTGTTTTGCG 3′) for A. parasiticus, fulfilled the requirements of specificity and efficacy required for qPCR use. Specificity of both primer sets was tested by conventional PCR using a wide and diverse sample of isolates (Table 1). The assays were performed in an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany). Amplification reactions were carried out in volumes of 25 μL containing 2 μL (5–50 ng) of template DNA, 1 μL of each primer (20 μM), 2.5 μL of 10× PCR buffer, 1 μL of MgCl2 (50 mM), 0.2 μL of dNTPs (100 mM) and 0.15 μL of Taq DNA polymerase (5 U/μL) supplied by the manufacturer (Biotools, Madrid, Spain). Specific PCR assay carried out using primers FLAVIQ1/FLAQ2 for A. flavus was performed according to the following protocol: 1 cycle of 4 min and 30 s at 95 °C, 24 cycles of 30 s at 95 °C (denaturation), 20 s at 60 °C (annealing), 35 s at 72 °C (extension) and finally 3 min at 72 °C. In the case of A. parasiticus (FLAVIQ1/PARQ2), the protocol was: 1 cycle of 5 min at 95 °C, 25 cycles of 30 s at 95 °C (denaturation), 30 s at 69.3 °C (annealing), 30 s at 72 °C (extension) and finally 1 cycle of 5 min at 72 °C. PCR products were detected in 2% agarose ethidium bromide gels in TAE 1X buffer (Tris–acetate 40 mM and EDTA 1.0 mM). The 100 bp DNA ladder (MBI Fermentas, Vilnius, Lithuania) was used as molecular size marker. 2.4. Quantitative PCR amplification Quantitative PCR assay was performed and monitored using the ABI PRISM 7900HT system (Applied Biosystems, Madrid, Spain) in the Genomic Unit of the University Complutense of Madrid. Each reaction contained, for both species specific protocols: 10 μl SYBR® Green PCR Master Mix (Applied Biosystems, Madrid, Spain), 1.2 μl forward primer 5 μM, 1.2 μl reverse primer 5 μM, 5 μl DNA template in suitable concentration (from 5×10−4 to 50 ng/μl) and molecular biology water (MO-BIO, Carlsbad, USA) up to 20 μl. Both qPCR assays were carried out using a standard program: 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min. All reactions were carried out by duplicate in MicroAmp 96-well plates (Applied Biosystems, Madrid, Spain). 2.5. Standard curves Ten-fold serial dilutions of DNA from both A. flavus CECT 4592 and A. parasiticus CECT 2680 strains (from 50 to 5 × 10−4 ng/μl) were used to obtain the standard curve. Ct values were plotted against the logarithm of starting quantity of template for each dilution. Then, amplification efficiencies were calculated from the slopes of the standard curves (Kubista et al, 2006). Additionally, different serial dilutions of fungal DNAs extracted from pure culture were evaluated to determine detection limits of the qPCR assays. 2.6. Specificity of qPCR reactions The exclusive binding of SYBR Green® to the amplicons derived from specific reactions was tested after the qPCR program described above, by analyzing the melting curve performed, according the following protocol: 15 s at 95 °C, 15 s at 60 °C and 20 min slow ramp between 60 and 95 °C. The specificity of the primer pairs FLAVIQ1/FLAQ2 (A. flavus) and FLAVIQ1/PARQ2 (A. parasiticus) was also tested in qPCR assays using genomic DNA from closely related species and genera which usually contaminate the same products (Table 2). The samples were prepared
123
with different proportion of DNA from these species and A. flavus CECT 4592 (2 ng/μl) (Table 2A) or A. parasiticus (0.5 ng/μl) CECT 2680 (Table 2B). Both groups of mixtures were evaluated independently. Ct values obtained were interpolated from the standard curve to calculate initial DNA concentration. Additionally, reactions with universal primers 5.8 S1/5.8 S2 (Gil-Serna et al., 2009) were carried out to test amplification in samples where neither A. flavus nor A. parasiticus were present. 2.7. Fungal detection in artificially contaminated samples We inoculated 1 g of wheat flour commercial samples with 1 ml of spore suspensions at concentrations 102, 104 and 106 spores/ml (low, medium and high concentration respectively) from three strains each of A. flavus (CECT 4592, FLA 9, FLA 109) and A. parasiticus (CECT 2680, CECT 2681,Cab5dch6). Fungal conidia suspensions were prepared from a sporulating culture (7 day-old) grown on Rose Bengal Chloramphenicol Agar (Pronadisa, Madrid, Spain) and filtered through Whatman No. 1 paper. Concentrations were measured by microscopy using a Thoma counting chamber. Spore suspensions were diluted when necessary. Inoculated samples were incubated at 28 °C for 0, 8, 16 and 24 h before genomic DNA was extracted. As negative control, we inoculated 1 g of wheat flour with 1 ml of sterile saline solution and were subsequently incubated following the same protocol. 3. Results 3.1. Specificity and sensitivity of the qPCR assays The specificity of both primer pairs was analysed by conventional PCR in a number of A. flavus and A. parasiticus strains from diverse origins as indicated above (Table 1). When genomic DNA from A. flavus or A. parasiticus was used, a single fragment of about 100 bp was amplified. No amplification product was observed with genomic DNA from isolates of the other species tested. All DNA tested showed positive amplification in PCR assays with primers 5.8 S1/5.8 S2 (Gil-Serna et al., 2009). Both standard curves, generated with the pairs FLAVIQ1/FLAQ2 and FLAVIQ1/PARQ2, showed linearity across all the range of concentrations used and showed a high correlation coefficient (R2 N 0.99) indicating very low inter-assay variability in both cases. The slope of the standard curve obtained for A. flavus was −3.33 and for A. parasiticus −3.43 which corresponded to amplification efficiencies of 95% and 99% respectively. Non-target control (NTC) values were 37.58 and 34.75, for A. flavus and A. parasiticus, respectively. Evaluation of serial dilutions of DNA obtained from A. flavus and A. parasiticus by qPCR was performed and the lowest DNA target concentration was 0.5 ng/μl which corresponded to 2.5 pg/reaction. The derivative melting curve obtained showed a single peak in both assays indicating that single amplicons were generated by qPCR and primer–dimers did not occur. The Tm was 89.3 °C for A. parasiticus and 88.0 °C for A. flavus. The results of the analyses performed by qPCR of samples containing different relative amounts of fungal DNAs are shown in Table 2 (A and B). DNA samples containing neither A. flavus nor A. parasiticus DNA did not amplify with the corresponding primers. qPCR values were in agreement with the relative amount of initial DNA of A. flavus or A. parasiticus in the samples. All the samples analysed showed positive amplification with the primer pair 5.8 S1/5.8 S2 in all the samples analyzed. 3.2. Detection and quantification of A. flavus and A. parasiticus in artificially contaminated samples Detection and quantification values of A. flavus and A. parasiticus genomic DNA in artificially contaminated wheat flour samples after
124
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
Table 2 qPCR analyses of samples containing DNA of two or more fungal species at different proportions. A) Assay with mixes containing A. flavus DNA. B) Assay with mixes containing A. parasiticus DNA. *Ct values obtained in qPCR assays corresponded to the average of the reaction duplicates. DNA concentration was determined by interpolating from the standard curve. A. Aspergillus flavus DNA mix 1 2 3 4 5 6 7 8 9
10
A. flavus A. parasiticus A .parasiticus A. flavus A. parasiticus A. bombycis A. parasiticus A. carbonarius A. parasiticus A. niger F. culmorum A. niger A. parasiticus A. westerdijkiae A. parasiticus A bombycis A. flavus A. parasiticus A. flavus
B. Aspergillus parasiticus Ratio
Ct value
DNA concentration (ng/μl)
DNA mix
Ratio
*Ct value
DNA concentration (ng/μl)
100 100 50:50
36,03 ± 0,38 19,37 ± 0,03 20,62 ± 0,09
0 0,55 0,24
1 2 3
A. bombycis A. parasiticus A. flavus
100 100 100
35,79 ± 1,23 30,14 ± 0,09 17,96 ± 0,02
0 0 2
50:50
20,33 ± 0,26
0,28
4
50:50
18,85 ± 0,02
1,2
50:50
20,42 ± 0,25
0,27
5
50:50
19,05 ± 0,31
1
50:50
20,40 ± 0,22
0,27
6
50:50
18,76 ± 0,01
1,2
50:50
33,15 ± 0,36
0
7
50:50
18,87 ± 0,16
1,1
25:75
22,00 ± 0,02
0,15
8
50:50
32,49 ± 0,17
0
33:33:33
21,15 ± 0,09
0,16
9
33:33:33
20,37 ± 0,06
0,39
25:75
21,45 ± 0,01
0,14
10
A. flavus A. bombycis A. flavus A. parasiticus A. flavus A. carbonarius A. flavus A. niger A. nomius A. westerdijkiae A. parasiticus A bombycis A. flavus A. flavus A. parasiticus
25:75
19,94 ± 0,20
0,53
different times of incubation are shown in Table 3. When this matrix was inoculated with 106 spores/ml, target fungal DNA was detected even without prior incubation in both species. A. flavus DNA was detected at intermediate spore concentration values (104) after 16 h of incubation and after 8 h in the case of A. parasiticus. Both species were detected by qPCR in samples inoculated with a low spore concentration (102) after 16 h of incubation. No detectable signal was observed in negative controls.
Table 3 DNA detection of A. flavus CECT 4592 (A) and A. parasiticus CECT 2680 (B) in inoculated wheat flour by qPCR. Values corresponded to each spore concentration (102, 104 and 106) at different incubation times (0, 8, 16 and 24 h). Genomic equivalent has been calculated assuming that the genome of A. parasiticus is similar to that of A. flavus (4.6 × 10− 5 ng, for a haploid genome) reported in the website: http://www.aspergillusflavus.org/genomics/. Spore concentration
Time of incubation (h)
[DNA] ng/μl
[DNA]ng/g flour
Genomic equivalent (per g flour)
A. Aspergillus flavus 102 spores/ml 0 8 16 24 4 10 spores/ml 0 8 16 24 106 spores/ml 0 8 16 24
0 0 0.002 0.008 0 0 0.03 0.07 0.002 0.008 1 10.2
0 0 1 4 0 0 15 35 1 4 500 5100
0 0 2.17 × 104 8.60 × 104 0 0 3.26 × 105 7.60 × 105 2.17 × 104 8.60 × 104 1.08 × 107 1.10 × 108
B. Aspergillus parasiticus 102 spores/ml 0 8 16 24 4 10 spores/ml 0 8 16 24 106 spores/ml 0 8 16 24
0 0 0.002 0.008 0 0.008 0.017 0.3 0.008 0.67 8.23 41.34
0 0 1 4 0 4 8.5 150 4 335 4115 20670
0 0 2.17 × 104 8.60 × 104 0 8.60 × 104 1.85 × 105 3.26 × 106 8.60 × 104 7.28 × 106 8.94 × 107 4.49 × 108
4. Discussion In this work, we developed highly specific methods that allow the detection and quantification of A. flavus and A. parasiticus in wheat flour. The fact that both species often share substrates such as wheat, corn and nuts; enhances the importance of discrimination of these two highly similar species. This will permit prediction of the presence of G1 and G2 aflatoxins besides aflatoxins B1 and B2. The parameters obtained from the standard curve, such as efficency or R2 coefficient, are good indicators of robust and reproducible assays. Due to the similar conditions of both qPCR protocols, both PCR assays can be performed simultaneously reducing time of analysis. The sensitivity of PCR assays is dependent on the copy number of the target DNA, the use of target sequences based on rDNA units can enhance the sensitivity about 100 times in comparison with singlecopy target sequences (Jurado et al., 2006). The lowest detection limit of the target DNA from pure culture was estimated to be 2.5 pg/ reaction in both species. In wheat flour, target DNA from both species spores could be achieved at a concentration of 106 spores/ml, without prior incubation. Short incubation times, up to 16 h, allowed detection of 102 spores/ml. The specificity of the assays was confirmed by conventional and qPCR assays in a wide and diverse selection of strains. The discrimination power for detection and relative quantification of A. flavus and A. parasiticus DNA were also confirmed using samples containing DNAs mixtures of different ratios. These showed a good relationship with the relative template amount. Moreover, the accuracy of the method to quantify these fungi in artificially contaminated matrices was confirmed improving detection at longer times of incubation. The possibility to quantify contamination levels in food matrices is essential because previous studies have demonstrated that levels of mycotoxigenic fungi can be related with mycotoxin concentration that exceed legal limits (Lund and Frisvad, 2003). A previous qPCR report describes a protocol to quantify A. flavus and A. parasiticus in soil (Luo et al., 2009), however the authors point out that their protocol might be specific only to the isolates in California, since they tested no isolates collected from other geographical areas or Culture Collections. On the other hand, primers–dimers were detected in none of the two qPCR assays as the analyses of the melting curves demonstrated. This confirmed their specificity in spite of using SYBR Green, reducing
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
significantly the cost of analyses of high number of samples. Previous reports indicate similar results when specificity and efficiency with SYBR Green and TaqMan chemistries were compared (GonzálezSalgado et al., 2009). This method provided a specific, accurate and sensitive detection and quantification of the aflatoxigenic species A. flavus and A. parasiticus in order to estimate their relative occurrence in commodities and predict the toxin profiles which might be present. This will improve diagnosis at an early stage and in all critical control points integrated in HAPPC strategies. Additionally, these assays will gain knowledge about these species in relation with ecophysiological factors, distribution or host/matrix preferences in order to improve strategies to prevent and control fungal colonization and aflatoxins risk in commodities. Acknowledgements This work was supported by the Spanish Ministry of Science and Innovation (AGL 2007-66416-C05-02/ALI) and by the UCM-SCH GR58/08. J. Gil-Serna and N. Sardiñas were supported by FPU fellowships by the Spanish Ministry of Science and Innovation and UCM fellowship by the University Complutense of Madrid, respectively. References Bartine, H., Tantaoui-Elaraki, A., 1997. Growth and toxigenesis of Aspergillus flavus isolates on selected spices. Journal of Environmental Pathology, Toxicology and Oncology 16, 61–65. Bennett, J.W., Klich, M., 2003. Mycotoxins. Clinical Microbiology Reviews 16, 479–516. Bluhm, B.H., Flaherty, J.E., Cousin, M.A., Woloshuk, C.P., 2002. Multiplex Polymerase Chain Reaction assay for the differential detection of Trichothecene- and Fumonisinproducing species of Fusarium in cornmeal. Journal of Food Protection 65, 1955–1961. Commission of the European Communities, 2006. EC No 1881/2006 setting maximum levels for certain contaminants in foodstuffs. Official Journal of the European Union, Brussels. Chen, R.S., Tsay, J.G., Huang, Y.F., Chiou, R.Y.Y., 2002. Polymerase chain reaction mediated characterization of molds belonging to the Aspergillus flavus group and detection of A. parasiticus in peanut kernels by multiplex plymerase chain reaction. Journal of Food Protection 65, 840–844. Chu, F.S., 1991. Mycotoxins: foof contamination, mechanisms, carcinogenic potential and preventative measures. Mutation Research 259, 291–306. Criseo, G., Bagnara, A., Bisignano, G., 2001. Differentiation of aflatoxin producing and non-producing strains of Aspergillus flavus group. Letters in Applied Microbiology 33, 291–295. Doster, M.A., Michailides, T.J., Morgan, D.P., 1996. Aspergillus species and mycotoxins in figs from California orchards. Plant Disease 80, 484–489. Edwards, S.G., O'Callaghan, J., Dobson, A.D.W., 2002. PCR-based detection and quantification of mycotoxigenic fungi. Mycological Research 106, 1005–1025. Ellis, W.O., Smith, J.P., Simpson, B.K., 1991. Aflatoxin in food: occurrence, biosynthesis, effects on organisms, detection, and methods of control. Critical Reviews in Food Science and Nutrition 30, 403–439. Färber, P., Geisen, R., Holzapfel, W.H., 1997. Detection of aflatoxinogenic fungi in figs by a PCR reaction. International Journal of Food Microbiology 36, 215–220. Gil-Serna, J., Vázquez, C., Sardiñas, N., González-Jaén, M.T., Patiño, B., 2009. Discrimination of the main Ochratoxin A-producing species in Aspergillus section
125
Circumdati by specific PCR assays. International Journal of Food Microbiology 136, 83–87. González-Salgado, A., González-Jaén, M.T., Vázquez, C., Patiño, B., 2008. Highly sensitive PCR-based detection method specific for Aspergillus flavus in wheat flour. Food Additives and Contaminants 25, 758–764. González-Salgado, A., Patiño, B., Gil-Serna, J., Vázquez, C., González-Jaén, M.T., 2009. Specific detection of Aspergillus carbonarius by SYBR Green® and TaqMan® quantitative PCR assays based on the multicopy ITS2 region of the rRNAgene. FEMS Microbiology Letters 295, 57–66. Henry, T., Iwen, P.C., Hinrichs, S.H., 2000. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. Journal of Clinical Microbiology 38, 510–1515. Horn, B.W., 2007. Biodiversity of Aspergillus section Flavi in the United States: A review. Food Additives and Contaminants 24, 1088–1101. IARC, 1993. International Agency for Research on Cancer: Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 56. IARC, Lyon, France. pp. 257–263. JECFA, 1997. Evaluation of certain food additives and contaminants. Forty-sixth report of the Joint FAO/WHO Expert Committee on Food Additives 1996. : WHO Technical Report Series, 868. World Health Organization, Geneva. Jelinek, C.F., Pohland, A.E., Wood, G.E., 1989. Worldwide occurrence of mycotoxins in foods and feeds-an update. Journal of the Association of Official Analytical Chemist 72, 223–230. Jurado, M., Vázquez, C., Marín, S., Sanchis, V., González-Jaén, M.T., 2006. PCR-based strategy to detect contamination with mycotoxigenic Fusarium species in maize. Systematic and Applied Microbiology 29, 681–689. Kubista, M., Andrade, J.M., Bengtsoon, M., Forootan, A., Jonák, J., Lind, K., Sindelka, R., Sjöback, R., Sjögreen, B., Strömbom, L., Stahlberg, A., Zoric, N., 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27, 95–125. Lund, F., Frisvad, J.C., 2003. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A. Journal of Applied Microbiology 95, 1117–1123. Luo, Y., Gao, W., Doster, M., Michailides, T.J., 2009. Quantification of conidial density of Asperfillus flavus and A. parasiticus in soil from almond orchards using real-time PCR. Journal of Applied Microbiology 106, 1649–1660. Mackay, I.M., Mackay, J.F., Nissen, M.D., Sloots, T.P., 2007. Real-time PCR: history and fluorogenic chemistries. In: Mackay, I.M. (Ed.), Real-Time PCR in Microbiology: From Diagnosis to Characterization. Horizon Scientific Press, Norfolk, pp. 1–40. Mayer, Z., Färber, P., Geisen, R., 2003. Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Applied and Environmental Microbiology 69, 1154–1158. Pittet, A., 1998. Natural occurrence of mycotoxins in foods and feeds — an update review. Revue de Médecine Vétérinaire 149, 479–492. Sardiñas, N., Vázquez, C., Gil-Serna, J., González-Jaén, M.T., Patiño, B., 2010. Specific detection of Aspergillus parasiticus in wheat flour by a highly sensitive PCR assay. Food Additives and Contaminants 27, 853–858. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A., Salomon, R., 1996. Detection of aflatoxinogenic molds in grains by PCR. Applied and Environmental Microbiology 62, 3270–3273. Somashekar, D., Rati, E.R., Chandrashekar, A., 2004. PCR-restriction fragment length analysis of aflR gene for differentiation and detection of Aspergillus flavus and Aspergillus parasiticus in maize. International Journal of Food Microbiology 93, 101–107. Sweeney, M.J., Pamies, P., Dobson, A.D.W., 2000. The use of reverse transcription polymerase chain reaction (RT-PCR) for monitoring aflatoxin production in Aspergillus parasiticus 439. International Journal of Food Microbiology 56, 97–103. Wilson, D.M., Mubatanhema, W., Jurjevic, Z., 2002. Biology and ecology of mycotoxigenic Aspergillus species as related to economic and health concerns. Advances in Experimental Medicine and Biology 504, 3–17. Zachová, I., Vytrasova, J., Peichalova, M., Cervenka, L., Tavcar-Kalcher, G., 2003. Detection of aflatoxigenic fungi in feeds using the PCR method. Folia Microbiologica 48, 817–821.
Contents lists available at ScienceDirect
International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o
Specific detection and quantification of Aspergillus flavus and Aspergillus parasiticus in wheat flour by SYBR® Green quantitative PCR Noelia Sardiñas a, Covadonga Vázquez a, Jéssica Gil-Serna a, Ma Teresa González-Jaén b, Belén Patiño a,⁎ a b
Dpto. Microbiología III, Universidad Complutense de Madrid, Madrid, Spain Dpto. Genética, Universidad Complutense de Madrid, Madrid, Spain
a r t i c l e
i n f o
Article history: Received 23 June 2010 Received in revised form 8 November 2010 Accepted 30 November 2010 Keywords: Aspergillus parasiticus Aspergillus flavus Aflatoxins Wheat flour qPCR
a b s t r a c t Aflatoxins are important mycotoxins that represent a serious risk for human and animal health. These mycotoxins are mainly produced by Aspergillus flavus and Aspergillus parasiticus, two closely related species with different array of aflatoxins. In this work, two specific quantitative PCR (qPCR) assays were developed to detect and quantify both species in wheat flour using primers based on the multicopy ITS2 rDNA target sequence. The species specificity of the assays was tested in a wide range of strains of these species and others colonizing the same commodities. The sensitivity of the assay was estimated in 2.5 pg/reaction in both species. Discrimination capacity for detection and relative quantification of A. flavus and A. parasiticus DNA were analyzed using samples with DNA mixtures containing also other fungal species at different ratios. Both qPCR assays could detect spore concentrations equal or higher than 106 spores/g in flour samples without prior incubation. These assays are valuable tools to improve diagnosis at an early stage and in all critical control points of food chain integrated in HACCP strategies. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Aflatoxins are the most potent natural carcinogens known (JECFA, 1997) and they are recognized as a possible human carcinogen (group 1A) by International Agency of Research of Cancer (IARC, 1993). Additionally, they have hepatotoxic and immunosuppressive properties which cause acute liver damage, liver cirrhosis, tumour induction and teratogenesis (Chu, 1991). These mycotoxins are produced by several Aspergillus species which contaminate food and raw products. Because of the risk these represent for human and animal health, they are under stringent regulation (Commission of the European Communities, 2006), obliging the destruction of contaminated agricultural products which results in significant economic losses. Aspergillus flavus and Aspergillus parasiticus, both belonging to the section Flavi, are the two major aflatoxin-producing species (Bennett and Klich, 2003; Horn, 2007). These species contaminate numerous food commodities including cereals (Pittet, 1998), pistachios, nuts and peanuts (Jelinek et al., 1989), spices (Bartine and Tantaoui-Elaraki, 1997) and figs (Doster et al., 1996; Färber et al., 1997) in warm climates where they may produce aflatoxins at different points of the food chain, such as preharvest, processing, transportation or storage (Ellis et al., 1991). These species have different toxigenic profiles: A. flavus produces aflatoxin B1 (excreted in breast milk as M1) B2, cyclopiazonic acid, ⁎ Corresponding author. Departamento de Microbiología III. Facultad de Biología. Universidad Complutense de Madrid. 28040-Madrid, Spain. Tel.: +34 913 944 969; fax: +34 913 944 964. E-mail address: [email protected] (B. Patiño). 0168-1605/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2010.11.041
aflatrem, 3-nitropropionic acid, sterigmatocystin, versicolorin A and aspertoxin, whereas A. parasiticus produces aflatoxin B1, B2, G1, G2 and versicolorin A (Wilson et al., 2002). Discrimination of these two species from each other or from closely related species is difficult when conventional methods, based mainly on morphological features, are used and requires considerable expertise. The application of DNA-based techniques permits rapid, sensitive and specific detection, necessary to devise strategies to control or reduce fungal mass and toxin production at early and critical stages of the food chain. These methods have been used for the detection of aflatoxigenic strains of A. flavus and A. parasiticus. (Chen et al., 2002; Criseo et al., 2001; Färber et al., 1997; González-Salgado et al., 2008; Mayer et al., 2003; Sardiñas et al., 2010; Shapira et al., 1996; Somashekar et al., 2004; Sweeney et al., 2000; Zachová et al., 2003). Quantitative PCR (qPCR) has solved the limitations of conventional PCR, providing a tool for accurate and sensitive quantification of target DNA. The chemistries more widely used to develop qPCR assays are DNAassociating dyes (SYBR® Green I) or fluorescently labelled sequencespecific oligoprobes (TaqMan® oligoprobes) (Mackay et al., 2007). The lower cost of qPCR based on SYBR® Green provides an advantage for choice of this method for routine control analyses of commodities. However, SYBR® Green binds nonspecifically to double helix and this may involve a loss of specificity if primers–dimers or nonspecific fragments are present (Kubista et al., 2006). Because of this, we must consider the target sequence used to design the primers because it could condition the power of discrimination and the sensitivity of the assay. Most PCR assays for detection and quantification of mycotoxigenic fungi have been developed using as a target single copy mycotoxin
122
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
biosynthetic genes (Bluhm et al., 2002; Jurado et al., 2006; Mayer et al, 2003). However, the sensitivity of the assay is considerably improved when multi-copy sequences are used such as ITS1 and ITS2 (Internal Transcribed Spacers or the rDNA) regions. Furthermore, they are highly variable allowing discriminate among closely related species in the Aspergillus genus (Edwards et al., 2002). Both regions have been successfully used to detect and identify aflatoxigenic Aspergillus species (González-Salgado et al., 2008; Sardiñas et al., 2010). In this work, we develop a sensitive and specific assay to detect and quantify A. flavus and A. parasiticus in wheat flour, a basic product in human diet. Detection and quantification of these two important aflatoxin-producing species will provide critical information to predict mycotoxin profiles which may be present in this matrix. Moreover, previous reports indicated that mycotoxin concentration can be correlated with levels of fungi detected on naturally contaminated samples (Lund and Frisvad, 2003). 2. Materials and methods 2.1. Fungal isolates and culture conditions All the isolates used in this study are shown in Table 1. Fungal strains were obtained from different Culture Collections or were isolated from
diverse food matrices in our laboratory. The isolates were maintained by regular subculturing on Potato Dextrose Agar (PDA) (Pronadisa, Madrid, Spain) at 28± 1 °C for 3–4 days and then stored as spore suspension in 15% glycerol at −80 °C. Fungal strains were cultured for DNA extraction in Erlenmeyer flasks containing 20 ml of Sabouraud Broth (Pronadisa, Madrid, Spain) and incubated at 28 ± 1 °C in an orbital shaker (140 rpm) for 2 days. Mycelia were filtered through Whatman paper no. 1 and kept at −80 °C for DNA isolation. 2.2. DNA extraction DNeasy Plant Mini Kit (Qiagen, Valencia, Spain) was used according to manufacturer´s instructions to obtain genomic DNA, from 100 mg of fungal pure cultures and wheat flour. The yield of the method was evaluated in three independent extractions of A. flavus CECT 4592 and A. parasiticus CECT 2680. DNA concentrations were determined using a NanoDrop® ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, USA). The purity of the extractions was between 1.6 and 1.9. The DNA of the samples was diluted to 50 ng/μl. All genomic DNAs used in this work were tested for suitability for PCR amplification using primers 5.8 S1/5.8 S2 (Gil-Serna et al., 2009). The amplification program used was described by Henry et al. (2000).
Table 1 Fungal strains analysed indicating origin, species and host. STRAIN NRRL 502T NRRL 465 ATCC 56775 ATCC 22789 ATCC 15517 ATCC 22789 C31 C32 CECT 2680 CECT 2681 Cab5dch6 CECT 4592 FLA 9 FLA 109 ITEM 5135 ITEM 4592 ITEM 4591 ATCC 20043 NRRL 453T NRRL 1957 JMC 12721 IHEM 16077 M6hip1 IHEM 19289 IHEM 18041 T.TT.A.13 R.T.A.16 CECT 2808 CECT 2091 CECT 2574 TB 20 1 TB 2 1 TB 5 2 350a 190a CECT 2086 ITEM 4158b ITEM 4685b CECT 2092 CECT 2948 CECT 2093 CECT 2148 CECT 2906 a b
ORIGIN
Valladolid (Sp) Valladolid (Sp)
Albacete (Sp) Tunisia Tunisia Italy France France
Belgium Albacete (Sp) Japan French Guiana Zamora (Sp) Valladolid (Sp) Canada Valladolid (Sp) Soria (Sp) Valladolid (Sp) Spain Spain Italy Portugal
SPECIES A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. tamarii A. tamarii A. bombycis A. nomius A. fumigatus A. fumigatus A. terreus A. niger A. niger A. tubingensis A. tubingensis A. tubingensis A. carbonarius A. carbonarius A. carbonarius A. japonicus A. japonicus A. ochraceus A. ochraceus A. ochraceus Fusarium culmorum Penicillium verrucosum
Strains supplied by Dr. Sanchis (University of Lleida, Spain). Strains supplied by Dr. Moretti (ISP-NRC, Bari, Italy).
HOST
Barley Barley
Barley
Flour Wheat Wheat Soil Brazil nut Cellophane diaphragm Cottonseed Bread Barley Silkworm disease Mango tree Grapes Grapes
Wheat Wheat Wheat Grapes Grapes Grapes Grapes
FLAVIQ1/FLAQ2
FLAVIQ1/PARQ2
− − − − − − − − − − − + + + + + + + + + + − − − − − − − − − − − − − − − − − − − − − −
+ + + + + + + + + + + − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
2.3. Primer design We designed primers on the basis of sequence alignments of the ITS2 region of several strains from different origins and other related species obtained in our laboratory in previous works or retrieved from databases. The primers FLAVIQ1 (5′ GTCGTCCCCTCTCCGG 3′) and FLAQ2 (5′ CTGGAAAAAGATTGATTTGCG 3′) for A. flavus and FLAVIQ1 and PARQ2 (5′ GAAAAAATGGTTGTTTTGCG 3′) for A. parasiticus, fulfilled the requirements of specificity and efficacy required for qPCR use. Specificity of both primer sets was tested by conventional PCR using a wide and diverse sample of isolates (Table 1). The assays were performed in an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany). Amplification reactions were carried out in volumes of 25 μL containing 2 μL (5–50 ng) of template DNA, 1 μL of each primer (20 μM), 2.5 μL of 10× PCR buffer, 1 μL of MgCl2 (50 mM), 0.2 μL of dNTPs (100 mM) and 0.15 μL of Taq DNA polymerase (5 U/μL) supplied by the manufacturer (Biotools, Madrid, Spain). Specific PCR assay carried out using primers FLAVIQ1/FLAQ2 for A. flavus was performed according to the following protocol: 1 cycle of 4 min and 30 s at 95 °C, 24 cycles of 30 s at 95 °C (denaturation), 20 s at 60 °C (annealing), 35 s at 72 °C (extension) and finally 3 min at 72 °C. In the case of A. parasiticus (FLAVIQ1/PARQ2), the protocol was: 1 cycle of 5 min at 95 °C, 25 cycles of 30 s at 95 °C (denaturation), 30 s at 69.3 °C (annealing), 30 s at 72 °C (extension) and finally 1 cycle of 5 min at 72 °C. PCR products were detected in 2% agarose ethidium bromide gels in TAE 1X buffer (Tris–acetate 40 mM and EDTA 1.0 mM). The 100 bp DNA ladder (MBI Fermentas, Vilnius, Lithuania) was used as molecular size marker. 2.4. Quantitative PCR amplification Quantitative PCR assay was performed and monitored using the ABI PRISM 7900HT system (Applied Biosystems, Madrid, Spain) in the Genomic Unit of the University Complutense of Madrid. Each reaction contained, for both species specific protocols: 10 μl SYBR® Green PCR Master Mix (Applied Biosystems, Madrid, Spain), 1.2 μl forward primer 5 μM, 1.2 μl reverse primer 5 μM, 5 μl DNA template in suitable concentration (from 5×10−4 to 50 ng/μl) and molecular biology water (MO-BIO, Carlsbad, USA) up to 20 μl. Both qPCR assays were carried out using a standard program: 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min. All reactions were carried out by duplicate in MicroAmp 96-well plates (Applied Biosystems, Madrid, Spain). 2.5. Standard curves Ten-fold serial dilutions of DNA from both A. flavus CECT 4592 and A. parasiticus CECT 2680 strains (from 50 to 5 × 10−4 ng/μl) were used to obtain the standard curve. Ct values were plotted against the logarithm of starting quantity of template for each dilution. Then, amplification efficiencies were calculated from the slopes of the standard curves (Kubista et al, 2006). Additionally, different serial dilutions of fungal DNAs extracted from pure culture were evaluated to determine detection limits of the qPCR assays. 2.6. Specificity of qPCR reactions The exclusive binding of SYBR Green® to the amplicons derived from specific reactions was tested after the qPCR program described above, by analyzing the melting curve performed, according the following protocol: 15 s at 95 °C, 15 s at 60 °C and 20 min slow ramp between 60 and 95 °C. The specificity of the primer pairs FLAVIQ1/FLAQ2 (A. flavus) and FLAVIQ1/PARQ2 (A. parasiticus) was also tested in qPCR assays using genomic DNA from closely related species and genera which usually contaminate the same products (Table 2). The samples were prepared
123
with different proportion of DNA from these species and A. flavus CECT 4592 (2 ng/μl) (Table 2A) or A. parasiticus (0.5 ng/μl) CECT 2680 (Table 2B). Both groups of mixtures were evaluated independently. Ct values obtained were interpolated from the standard curve to calculate initial DNA concentration. Additionally, reactions with universal primers 5.8 S1/5.8 S2 (Gil-Serna et al., 2009) were carried out to test amplification in samples where neither A. flavus nor A. parasiticus were present. 2.7. Fungal detection in artificially contaminated samples We inoculated 1 g of wheat flour commercial samples with 1 ml of spore suspensions at concentrations 102, 104 and 106 spores/ml (low, medium and high concentration respectively) from three strains each of A. flavus (CECT 4592, FLA 9, FLA 109) and A. parasiticus (CECT 2680, CECT 2681,Cab5dch6). Fungal conidia suspensions were prepared from a sporulating culture (7 day-old) grown on Rose Bengal Chloramphenicol Agar (Pronadisa, Madrid, Spain) and filtered through Whatman No. 1 paper. Concentrations were measured by microscopy using a Thoma counting chamber. Spore suspensions were diluted when necessary. Inoculated samples were incubated at 28 °C for 0, 8, 16 and 24 h before genomic DNA was extracted. As negative control, we inoculated 1 g of wheat flour with 1 ml of sterile saline solution and were subsequently incubated following the same protocol. 3. Results 3.1. Specificity and sensitivity of the qPCR assays The specificity of both primer pairs was analysed by conventional PCR in a number of A. flavus and A. parasiticus strains from diverse origins as indicated above (Table 1). When genomic DNA from A. flavus or A. parasiticus was used, a single fragment of about 100 bp was amplified. No amplification product was observed with genomic DNA from isolates of the other species tested. All DNA tested showed positive amplification in PCR assays with primers 5.8 S1/5.8 S2 (Gil-Serna et al., 2009). Both standard curves, generated with the pairs FLAVIQ1/FLAQ2 and FLAVIQ1/PARQ2, showed linearity across all the range of concentrations used and showed a high correlation coefficient (R2 N 0.99) indicating very low inter-assay variability in both cases. The slope of the standard curve obtained for A. flavus was −3.33 and for A. parasiticus −3.43 which corresponded to amplification efficiencies of 95% and 99% respectively. Non-target control (NTC) values were 37.58 and 34.75, for A. flavus and A. parasiticus, respectively. Evaluation of serial dilutions of DNA obtained from A. flavus and A. parasiticus by qPCR was performed and the lowest DNA target concentration was 0.5 ng/μl which corresponded to 2.5 pg/reaction. The derivative melting curve obtained showed a single peak in both assays indicating that single amplicons were generated by qPCR and primer–dimers did not occur. The Tm was 89.3 °C for A. parasiticus and 88.0 °C for A. flavus. The results of the analyses performed by qPCR of samples containing different relative amounts of fungal DNAs are shown in Table 2 (A and B). DNA samples containing neither A. flavus nor A. parasiticus DNA did not amplify with the corresponding primers. qPCR values were in agreement with the relative amount of initial DNA of A. flavus or A. parasiticus in the samples. All the samples analysed showed positive amplification with the primer pair 5.8 S1/5.8 S2 in all the samples analyzed. 3.2. Detection and quantification of A. flavus and A. parasiticus in artificially contaminated samples Detection and quantification values of A. flavus and A. parasiticus genomic DNA in artificially contaminated wheat flour samples after
124
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
Table 2 qPCR analyses of samples containing DNA of two or more fungal species at different proportions. A) Assay with mixes containing A. flavus DNA. B) Assay with mixes containing A. parasiticus DNA. *Ct values obtained in qPCR assays corresponded to the average of the reaction duplicates. DNA concentration was determined by interpolating from the standard curve. A. Aspergillus flavus DNA mix 1 2 3 4 5 6 7 8 9
10
A. flavus A. parasiticus A .parasiticus A. flavus A. parasiticus A. bombycis A. parasiticus A. carbonarius A. parasiticus A. niger F. culmorum A. niger A. parasiticus A. westerdijkiae A. parasiticus A bombycis A. flavus A. parasiticus A. flavus
B. Aspergillus parasiticus Ratio
Ct value
DNA concentration (ng/μl)
DNA mix
Ratio
*Ct value
DNA concentration (ng/μl)
100 100 50:50
36,03 ± 0,38 19,37 ± 0,03 20,62 ± 0,09
0 0,55 0,24
1 2 3
A. bombycis A. parasiticus A. flavus
100 100 100
35,79 ± 1,23 30,14 ± 0,09 17,96 ± 0,02
0 0 2
50:50
20,33 ± 0,26
0,28
4
50:50
18,85 ± 0,02
1,2
50:50
20,42 ± 0,25
0,27
5
50:50
19,05 ± 0,31
1
50:50
20,40 ± 0,22
0,27
6
50:50
18,76 ± 0,01
1,2
50:50
33,15 ± 0,36
0
7
50:50
18,87 ± 0,16
1,1
25:75
22,00 ± 0,02
0,15
8
50:50
32,49 ± 0,17
0
33:33:33
21,15 ± 0,09
0,16
9
33:33:33
20,37 ± 0,06
0,39
25:75
21,45 ± 0,01
0,14
10
A. flavus A. bombycis A. flavus A. parasiticus A. flavus A. carbonarius A. flavus A. niger A. nomius A. westerdijkiae A. parasiticus A bombycis A. flavus A. flavus A. parasiticus
25:75
19,94 ± 0,20
0,53
different times of incubation are shown in Table 3. When this matrix was inoculated with 106 spores/ml, target fungal DNA was detected even without prior incubation in both species. A. flavus DNA was detected at intermediate spore concentration values (104) after 16 h of incubation and after 8 h in the case of A. parasiticus. Both species were detected by qPCR in samples inoculated with a low spore concentration (102) after 16 h of incubation. No detectable signal was observed in negative controls.
Table 3 DNA detection of A. flavus CECT 4592 (A) and A. parasiticus CECT 2680 (B) in inoculated wheat flour by qPCR. Values corresponded to each spore concentration (102, 104 and 106) at different incubation times (0, 8, 16 and 24 h). Genomic equivalent has been calculated assuming that the genome of A. parasiticus is similar to that of A. flavus (4.6 × 10− 5 ng, for a haploid genome) reported in the website: http://www.aspergillusflavus.org/genomics/. Spore concentration
Time of incubation (h)
[DNA] ng/μl
[DNA]ng/g flour
Genomic equivalent (per g flour)
A. Aspergillus flavus 102 spores/ml 0 8 16 24 4 10 spores/ml 0 8 16 24 106 spores/ml 0 8 16 24
0 0 0.002 0.008 0 0 0.03 0.07 0.002 0.008 1 10.2
0 0 1 4 0 0 15 35 1 4 500 5100
0 0 2.17 × 104 8.60 × 104 0 0 3.26 × 105 7.60 × 105 2.17 × 104 8.60 × 104 1.08 × 107 1.10 × 108
B. Aspergillus parasiticus 102 spores/ml 0 8 16 24 4 10 spores/ml 0 8 16 24 106 spores/ml 0 8 16 24
0 0 0.002 0.008 0 0.008 0.017 0.3 0.008 0.67 8.23 41.34
0 0 1 4 0 4 8.5 150 4 335 4115 20670
0 0 2.17 × 104 8.60 × 104 0 8.60 × 104 1.85 × 105 3.26 × 106 8.60 × 104 7.28 × 106 8.94 × 107 4.49 × 108
4. Discussion In this work, we developed highly specific methods that allow the detection and quantification of A. flavus and A. parasiticus in wheat flour. The fact that both species often share substrates such as wheat, corn and nuts; enhances the importance of discrimination of these two highly similar species. This will permit prediction of the presence of G1 and G2 aflatoxins besides aflatoxins B1 and B2. The parameters obtained from the standard curve, such as efficency or R2 coefficient, are good indicators of robust and reproducible assays. Due to the similar conditions of both qPCR protocols, both PCR assays can be performed simultaneously reducing time of analysis. The sensitivity of PCR assays is dependent on the copy number of the target DNA, the use of target sequences based on rDNA units can enhance the sensitivity about 100 times in comparison with singlecopy target sequences (Jurado et al., 2006). The lowest detection limit of the target DNA from pure culture was estimated to be 2.5 pg/ reaction in both species. In wheat flour, target DNA from both species spores could be achieved at a concentration of 106 spores/ml, without prior incubation. Short incubation times, up to 16 h, allowed detection of 102 spores/ml. The specificity of the assays was confirmed by conventional and qPCR assays in a wide and diverse selection of strains. The discrimination power for detection and relative quantification of A. flavus and A. parasiticus DNA were also confirmed using samples containing DNAs mixtures of different ratios. These showed a good relationship with the relative template amount. Moreover, the accuracy of the method to quantify these fungi in artificially contaminated matrices was confirmed improving detection at longer times of incubation. The possibility to quantify contamination levels in food matrices is essential because previous studies have demonstrated that levels of mycotoxigenic fungi can be related with mycotoxin concentration that exceed legal limits (Lund and Frisvad, 2003). A previous qPCR report describes a protocol to quantify A. flavus and A. parasiticus in soil (Luo et al., 2009), however the authors point out that their protocol might be specific only to the isolates in California, since they tested no isolates collected from other geographical areas or Culture Collections. On the other hand, primers–dimers were detected in none of the two qPCR assays as the analyses of the melting curves demonstrated. This confirmed their specificity in spite of using SYBR Green, reducing
N. Sardiñas et al. / International Journal of Food Microbiology 145 (2011) 121–125
significantly the cost of analyses of high number of samples. Previous reports indicate similar results when specificity and efficiency with SYBR Green and TaqMan chemistries were compared (GonzálezSalgado et al., 2009). This method provided a specific, accurate and sensitive detection and quantification of the aflatoxigenic species A. flavus and A. parasiticus in order to estimate their relative occurrence in commodities and predict the toxin profiles which might be present. This will improve diagnosis at an early stage and in all critical control points integrated in HAPPC strategies. Additionally, these assays will gain knowledge about these species in relation with ecophysiological factors, distribution or host/matrix preferences in order to improve strategies to prevent and control fungal colonization and aflatoxins risk in commodities. Acknowledgements This work was supported by the Spanish Ministry of Science and Innovation (AGL 2007-66416-C05-02/ALI) and by the UCM-SCH GR58/08. J. Gil-Serna and N. Sardiñas were supported by FPU fellowships by the Spanish Ministry of Science and Innovation and UCM fellowship by the University Complutense of Madrid, respectively. References Bartine, H., Tantaoui-Elaraki, A., 1997. Growth and toxigenesis of Aspergillus flavus isolates on selected spices. Journal of Environmental Pathology, Toxicology and Oncology 16, 61–65. Bennett, J.W., Klich, M., 2003. Mycotoxins. Clinical Microbiology Reviews 16, 479–516. Bluhm, B.H., Flaherty, J.E., Cousin, M.A., Woloshuk, C.P., 2002. Multiplex Polymerase Chain Reaction assay for the differential detection of Trichothecene- and Fumonisinproducing species of Fusarium in cornmeal. Journal of Food Protection 65, 1955–1961. Commission of the European Communities, 2006. EC No 1881/2006 setting maximum levels for certain contaminants in foodstuffs. Official Journal of the European Union, Brussels. Chen, R.S., Tsay, J.G., Huang, Y.F., Chiou, R.Y.Y., 2002. Polymerase chain reaction mediated characterization of molds belonging to the Aspergillus flavus group and detection of A. parasiticus in peanut kernels by multiplex plymerase chain reaction. Journal of Food Protection 65, 840–844. Chu, F.S., 1991. Mycotoxins: foof contamination, mechanisms, carcinogenic potential and preventative measures. Mutation Research 259, 291–306. Criseo, G., Bagnara, A., Bisignano, G., 2001. Differentiation of aflatoxin producing and non-producing strains of Aspergillus flavus group. Letters in Applied Microbiology 33, 291–295. Doster, M.A., Michailides, T.J., Morgan, D.P., 1996. Aspergillus species and mycotoxins in figs from California orchards. Plant Disease 80, 484–489. Edwards, S.G., O'Callaghan, J., Dobson, A.D.W., 2002. PCR-based detection and quantification of mycotoxigenic fungi. Mycological Research 106, 1005–1025. Ellis, W.O., Smith, J.P., Simpson, B.K., 1991. Aflatoxin in food: occurrence, biosynthesis, effects on organisms, detection, and methods of control. Critical Reviews in Food Science and Nutrition 30, 403–439. Färber, P., Geisen, R., Holzapfel, W.H., 1997. Detection of aflatoxinogenic fungi in figs by a PCR reaction. International Journal of Food Microbiology 36, 215–220. Gil-Serna, J., Vázquez, C., Sardiñas, N., González-Jaén, M.T., Patiño, B., 2009. Discrimination of the main Ochratoxin A-producing species in Aspergillus section
125
Circumdati by specific PCR assays. International Journal of Food Microbiology 136, 83–87. González-Salgado, A., González-Jaén, M.T., Vázquez, C., Patiño, B., 2008. Highly sensitive PCR-based detection method specific for Aspergillus flavus in wheat flour. Food Additives and Contaminants 25, 758–764. González-Salgado, A., Patiño, B., Gil-Serna, J., Vázquez, C., González-Jaén, M.T., 2009. Specific detection of Aspergillus carbonarius by SYBR Green® and TaqMan® quantitative PCR assays based on the multicopy ITS2 region of the rRNAgene. FEMS Microbiology Letters 295, 57–66. Henry, T., Iwen, P.C., Hinrichs, S.H., 2000. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. Journal of Clinical Microbiology 38, 510–1515. Horn, B.W., 2007. Biodiversity of Aspergillus section Flavi in the United States: A review. Food Additives and Contaminants 24, 1088–1101. IARC, 1993. International Agency for Research on Cancer: Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 56. IARC, Lyon, France. pp. 257–263. JECFA, 1997. Evaluation of certain food additives and contaminants. Forty-sixth report of the Joint FAO/WHO Expert Committee on Food Additives 1996. : WHO Technical Report Series, 868. World Health Organization, Geneva. Jelinek, C.F., Pohland, A.E., Wood, G.E., 1989. Worldwide occurrence of mycotoxins in foods and feeds-an update. Journal of the Association of Official Analytical Chemist 72, 223–230. Jurado, M., Vázquez, C., Marín, S., Sanchis, V., González-Jaén, M.T., 2006. PCR-based strategy to detect contamination with mycotoxigenic Fusarium species in maize. Systematic and Applied Microbiology 29, 681–689. Kubista, M., Andrade, J.M., Bengtsoon, M., Forootan, A., Jonák, J., Lind, K., Sindelka, R., Sjöback, R., Sjögreen, B., Strömbom, L., Stahlberg, A., Zoric, N., 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27, 95–125. Lund, F., Frisvad, J.C., 2003. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A. Journal of Applied Microbiology 95, 1117–1123. Luo, Y., Gao, W., Doster, M., Michailides, T.J., 2009. Quantification of conidial density of Asperfillus flavus and A. parasiticus in soil from almond orchards using real-time PCR. Journal of Applied Microbiology 106, 1649–1660. Mackay, I.M., Mackay, J.F., Nissen, M.D., Sloots, T.P., 2007. Real-time PCR: history and fluorogenic chemistries. In: Mackay, I.M. (Ed.), Real-Time PCR in Microbiology: From Diagnosis to Characterization. Horizon Scientific Press, Norfolk, pp. 1–40. Mayer, Z., Färber, P., Geisen, R., 2003. Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Applied and Environmental Microbiology 69, 1154–1158. Pittet, A., 1998. Natural occurrence of mycotoxins in foods and feeds — an update review. Revue de Médecine Vétérinaire 149, 479–492. Sardiñas, N., Vázquez, C., Gil-Serna, J., González-Jaén, M.T., Patiño, B., 2010. Specific detection of Aspergillus parasiticus in wheat flour by a highly sensitive PCR assay. Food Additives and Contaminants 27, 853–858. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A., Salomon, R., 1996. Detection of aflatoxinogenic molds in grains by PCR. Applied and Environmental Microbiology 62, 3270–3273. Somashekar, D., Rati, E.R., Chandrashekar, A., 2004. PCR-restriction fragment length analysis of aflR gene for differentiation and detection of Aspergillus flavus and Aspergillus parasiticus in maize. International Journal of Food Microbiology 93, 101–107. Sweeney, M.J., Pamies, P., Dobson, A.D.W., 2000. The use of reverse transcription polymerase chain reaction (RT-PCR) for monitoring aflatoxin production in Aspergillus parasiticus 439. International Journal of Food Microbiology 56, 97–103. Wilson, D.M., Mubatanhema, W., Jurjevic, Z., 2002. Biology and ecology of mycotoxigenic Aspergillus species as related to economic and health concerns. Advances in Experimental Medicine and Biology 504, 3–17. Zachová, I., Vytrasova, J., Peichalova, M., Cervenka, L., Tavcar-Kalcher, G., 2003. Detection of aflatoxigenic fungi in feeds using the PCR method. Folia Microbiologica 48, 817–821.