- Email: [email protected]
Spexin: A novel regulator of adipogenesis and fat tissue metabolism
Accepted Manuscript Spexin: A novel regulator of adipogenesis and fat tissue metabolism
Pawel A. Kolodziejski, Ewa Pruszynska-Oszmalek, Maciej Micker, Marek Skrzypski, Tatiana Wojciechowicz, Patryk Szwarckopf, Kinga Skieresz-Szewczyk, Krzysztof W. Nowak, Mathias Z. Strowski PII: DOI: Reference:
S1388-1981(18)30199-9 doi:10.1016/j.bbalip.2018.08.001 BBAMCB 58342
To appear in:
BBA - Molecular and Cell Biology of Lipids
Received date: Revised date: Accepted date:
17 April 2018 31 July 2018 2 August 2018
Please cite this article as: Pawel A. Kolodziejski, Ewa Pruszynska-Oszmalek, Maciej Micker, Marek Skrzypski, Tatiana Wojciechowicz, Patryk Szwarckopf, Kinga SkiereszSzewczyk, Krzysztof W. Nowak, Mathias Z. Strowski , Spexin: A novel regulator of adipogenesis and fat tissue metabolism. Bbamcb (2018), doi:10.1016/j.bbalip.2018.08.001
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Spexin: a novel regulator of adipogenesis and fat tissue metabolism Pawel A. Kolodziejski1*, Ewa Pruszynska-Oszmalek1, Maciej Micker2, Marek Skrzypski1., Tatiana Wojciechowicz1, Patryk Szwarckopf2, Kinga Skieresz-Szewczyk 3, Krzysztof W. Nowak1, Mathias Z Strowski4,5.
PT
1. Department of Animal Physiology and Biochemistry, Poznan University of Life Sciences Wolynska Street 28, 60-637 Poznan.
RI
2. Department of General and Vascular Surgery and Angiology, Poznan University of
SC
Medical Sciences, Dojazd Street 34, 60-631 Poznan, Poland
Wojska Polskiego 71C, Poznan, Poland
NU
3. Department of Histology and Embryology, Poznan University of Life Sciences,
MA
4. Department of Hepatology and Gastroenterology & the Interdisciplinary Centre of Metabolism: Endocrinology, Diabetes and Metabolism, Charité-University Medicine Berlin, 13353 Berlin, Germany
D
5. Park-Klinik Weissensee, Internal Medicine – Gastroenterology, 13086 Berlin,
PT E
Germany
AC
CE
* -corresponding author Present address: Department of Animal Physiology and Biochemistry Poznan University of Life Sciences Wolynska 35 street 60-637 Poznan Poland
Email: [email protected], [email protected] Key words: spexin, human adipocytes, 3T3-L1, adipogenesis, lipolysis, lipogenesis Running title: Spexin effect on adipocytes
ACCEPTED MANUSCRIPT Abstract Spexin (SPX, NPQ) is a novel peptide involved in the regulation of energy metabolism. SPX inhibits food intake and reduces body weight. In obese humans, SPX is the most down-regulated gene in fat. Therefore, SPX might be involved in the
PT
regulation of lipid metabolism. Here, we study the effects of SPX on lipolysis, lipogenesis, glucose uptake, adipogenesis, cell proliferation and survival in isolated
RI
human adipocytes or murine 3T3-L1 cells. SPX and its receptors, GALR2 and GALR3,
SC
are present at mRNA and protein levels in murine 3T3-L1 cells and human adipocytes. SPX inhibits adipogenesis and down-regulates mRNA expression of proadipogenic
NU
genes such as Pparγ, C/ebpα, C/ebpβ and Fabp4. SPX stimulates lipolysis by increasing
MA
the phosphorylation of hormone sensitive lipase (HSL). Simultaneously, SPX inhibits lipogenesis and glucose uptake in human adipocytes and murine 3T3-L1 cells. SPX has no effect on murine 3T3-L1 cell proliferation and viability. Moreover, our research
PT E
D
showed that the SPX effect on adipocytes metabolism is mediated via GALR2 and GALR3 receptors. SPX is a novel regulator of lipid metabolism in murine 3T3-L1 and
AC
CE
human adipocytes.
ACCEPTED MANUSCRIPT 1. Introduction A bioinformatics method based on hidden Markow model screening allowed the discovery of a highly conserved peptide – spexin (SPX, NPQ) – consisting of 14 amino acids [1,2]. SPX arises as a result of post-translational modifications of a prepropeptide, which is composed of 116 amino-acid residues. The amino-acid sequence of SPX is
PT
homological in mice, rats and humans [3]. Structural analysis of the SPX gene showed
RI
that it belongs to the Spexin/Galanin/Kisspeptin gene family. Moreover, it was demonstrated that SPX activates galanin (GAL) receptors type 2 (GALR2) and 3
SC
(GALR3) [4]. In 2010, Porzionato et al. described SPX expression in almost all rat
NU
tissues except: acinar epithelium, spermatogonial cells, spermatocytes, oocytes, lymphatic cells, medullary region of lymph nodes, white pulp of the spleen, glias of the
MA
brain cortex, cerebellum, brainstem, eye cells (photoreceptor layer, outer nuclear layer) and plexiform layers [3]. However, little is yet known about the role of SPX in
D
regulating fat metabolism. Animal studies have shown that SPX inhibits fatty acid (FA)
PT E
uptake in primary adipocytes and hepatocytes, reduces appetite, caloric intake enhances bowel movement [5] and decreases body weight [6,7]. Moreover, SPX inhibits
CE
proliferation of adrenocortical cells [8]. SPX levels are low during oral glucose tolerance tests in patients with type 2 diabetes [9].
AC
Our previous research showed that serum SPX levels negatively correlate with obesity and insulin resistance [10]. In addition, SPX could be an important factor in regulating nociception and reproductive functions. Toll et al. demonstrated in 2012 that a central injection of SPX controlled CNS (Central nervous system) -mediated arterial blood pressure and salt and water balance, and modulated nociceptive responses [11]. Studies conducted in fish also indicate that SPX is involved in the regulation of reproductive functions by affecting the release of LH (Luteinizing hormone) [12,13]. In addition,
ACCEPTED MANUSCRIPT Porzionato et al. suggested that SPX acts in the regulation of hyperoxia [14]. Studies in goldfish have demonstrated that SPX can inhibit basal, neuropeptide Y- and orexinstimulated food consumption [15]. Additionally, Walewski et al. showed that SPX is one of the most down-regulated genes in fat tissue derived from obese humans [6]. Overall, these findings suggest that SPX could be a new regulator of fat tissue
PT
metabolism.
RI
Therefore, we investigate the effects of SPX on proliferation, cell viability, lipogenesis
SC
and lipolysis in murine 3T3-L1 cell adipocytes and/or isolated human adipocytes.
NU
2. Materials and methods
MA
2.1 Ethical approval
This research complied with all the relevant national regulations, institutional policies and is in accordance with the tenets of the Helsinki Declaration and has been accepted
PT E
D
by the authors. Informed consent was obtained from all donors before surgical procedures. The study protocol was approved by the Clinical Research Ethics
2.2 Materials
CE
Committee of Poznan University of Medical Sciences, approval number 935/16.
AC
Antibodies: Anti-Fatty Acid Synthase, anti-HSL, anti-pHSL (Ser552), anti-pHSL (Ser563), anti-pHSL (Ser650), and anti-pHSL (Ser660) antibodies were from Cell Signaling Technology (Beverly, MA, USA). Anti-SPX antibodies were purchased from Phoenix Pharmaceuticals (Karlsruhe, Germany). Anti-GALR2 and anti-GALR3 antibodies were supplied by Abgent (San Diego, CA, USA). Anti-β-actin and all secondary antibodies for Western Blot were from Sigma-Aldrich (Taufkirchen, Germany). Unless otherwise stated, all other reagents were from Sigma-Aldrich. All cell
ACCEPTED MANUSCRIPT culture media and supplements were purchased from Sigma-Aldrich. All reagents used in the experiments with isotopes, such as glucose uptake and lipolysis, were purchased from Perkin Elmer (Norwalk, CT, USA). 2.3 Murine 3T3-L1 cell culture and differentiation procedure
PT
Murine 3T3-L1 fibroblasts (ATCC, LGC Standards, Lomianki, Poland) were maintained in a standard growth medium (DMEM without sodium pyruvate; containing
RI
high glucose (25 mmol/l), L-glutamine (4 mmol/l), 10% [vol./vol.] FCS, 100 kU/l
SC
penicillin and 100 mg/l streptomycin) at 37°C in a humidified atmosphere.
NU
Differentiation of fibroblasts into adipocytes was conducted in accordance with our previously described method [16].
MA
2.4 Isolation of human and mouse adipocytes
D
Isolation of human adipocytes was conducted as described [17]. Tissue specimens of
PT E
white human adipose tissue were obtained during routing surgery from healthy patients who were free of metabolic or endocrine diseases (characteristics of our study participants: sex F/M: 5/5, age range: 46.40 ± 9.34/, 44.20 ± 8.1; BMI 23.3 ± 0.97 /
CE
23.10 ± 1.24). In brief, intraoperatively removed visceral fat pads resected from patients
AC
were transported in PBS buffer to the laboratory. Next, fat pads were cut into small pieces using scissors. Fragmented fat tissue was digested in Krebs – Ringer Hepes buffer (KRBH) (ingredients: 1l8 mM NaCl, 4.8 mM KCl, 1.3 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 24.8 mM NaHCO3) containing 10 mM Hepes, collagenase type II (3 mg/g tissue), 3% BSA and 5 mmol/l glucose for 30 to 45 min at 37°C in a shaking water bath. Then, cells were filtered through a nylon mesh (250 μm) and washed with KRBH (without collagenase). Adipocytes were counted using a Bürker– Türk counter chamber. Each experiment was repeated two or three times. To study the
ACCEPTED MANUSCRIPT localization of SPX, GALR2 and GALR3 mouse visceral adipocytes were isolated from C57BJ/6 mice in analogy to the description above. 2.5 Immunofluorescence staining of SPX in tissues and cells Identification of SPX protein by immunofluorescence in murine 3T3-L1 preadipocytes,
PT
mature murine 3T3-L1 adipocytes and human fat tissue was performed as previously described [18]. In brief, murine 3T3-L1 cells were seeded in 4-chamber tissue culture
RI
slides. murine 3T3-L1 cells were cultured for 24 h (preadipocytes) or differentiated into
SC
mature adipocytes as described [19]. Then, cells were washed in PBS and fixed in 4%
NU
paraformaldehyde in PBS for 10 min. Next, cells were permeabilized in PBS containing 0.1% Triton-100 and then washed 3 times in PBS. Unspecific binding of antibodies was
MA
blocked using 1% BSA and 15 mM glycine solution in PBS for 45 min. Thereafter, cells were incubated with primary anti-SPX antibody in a blocking solution (dilution of the
D
antibody 1:300, Phoenix Pharmaceuticals, USA) [3,12,14,15]. On the next day, cells
PT E
were washed three times in PBS and subsequently incubated with a secondary antirabbit antibody (dilution 1:500 in blocking solution, Life Technologies, Grand Island,
CE
NY, USA,) for 1.5 h in darkness and washed again, as described above. To stain nuclei and lipid droplets, cells were incubated with DAPI (1 μg/ml in PBS) and/or BODIPY
AC
(10 μg/ml in PBS) for 10 min. Cell and tissue slides were photographed at 400 × magnification using a Zeiss Axiovert 510 Meta Confocal Laser Scanning Microscope Fluorescence (Carl Zeiss, Oberkochen, Germany). Immunofluorescence detection of SPX in fat tissue was performed on paraffin embedded tissue. Dissected tissue was rinsed in 0.9% NaCl solution and immersed in Bouin’s solution. After a 24-hour fixation period, tissue samples were dehydrated using increasing concentrations of ethanol (70%–96%), and subsequently embedded in Paraplast® (Sigma-Aldrich). Paraplast® blocks were cut into thin sections of 4.5–5 µm. Next, slides with sections
ACCEPTED MANUSCRIPT were heated (58°C) in a laboratory oven for 45 min, deparaffinized in xylene for 30 min and rehydrated using gradient ethanol in water. For antigen retrieval, sections were heated in a citrate buffer (pH 6.0) for 10 min at 95°C in a microwave oven. After cooling to room temperature, non-specific antibody binding to proteins in sections was blocked using a blocking solution containing 0.2% gelatin and 15 mM glycine. The
PT
sections were then incubated with antibodies and photographed as described above for
RI
murine 3T3-L1-cells.
SC
2.6 Proliferation assay
NU
Murine 3T3-L1 cells were seeded into 96-well plates (2 × 103 cells/well) and cultured for 24 hours. Next, cells were incubated in serum-free DMEM supplemented
MA
with 0.5% BSA for 12 h and then treated with SPX (1.0, 10, 100, 1,000 nM) or 10% FCS (positive control) for a further 24 h. Cell proliferation was measured by evaluation
D
of the incorporation of bromodeoxyuridine (BrdU) into the newly synthesized DNA of
PT E
replicating cells. BrdU solution (10 µM) was added after 21 h and cells were incubated for 3 h. BrdU incorporation was measured using a commercially available Cell
CE
Proliferation ELISA BrdU colorimetric kit (Roche Diagnostics, Penzberg, Germany).
AC
2.7 Cell viability
Cells were seeded and cultured as described above. The viability of cells was studied using an MTT assay. After 24 h incubation, cells were treated with MTT solution (0.5 mg/ml) for 1 h. Next, the incubation solution was removed and blue formazan crystals were dissolved in 100 µl DMSO. The optical density of samples was measured at 570 nm (reference wavelength: 650 nm) on a Synergy 2 microplate reader (BioTek Instruments, Winooski, VT, USA). 2.8 Glucose uptake
ACCEPTED MANUSCRIPT Twelve-well plates containing mature murine 3T3-L1 cells were incubated for 6 h in serum-free DMEM and washed in PBS. Then, cells were incubated in glucose-free KRB supplemented with 0.1% BSA for 30 min. Cells were washed with PBS. Then, cells were incubated with different concentrations of test peptides or cytochalasin B (negative control) in KRB buffer. Subsequently, 18.5 kBq of 2-deoxy-D-[2,6-
PT
C12]glucose and 0.1 mmol/l 2-deoxyglucose was added. After 5 min, incubation was
RI
stopped using ice-cold PBS with 20 μmol/l of cytochalasin B. Murine 3T3-L1 cells
SC
were lysed using 0.1% SDS. Cell lysates were divided into two aliquots. One was used for liquid scintillation and the second for protein content determination using a BSA
NU
assay. Results were normalized to total protein content. 2.9 Lipogenesis
MA
Incorporation of [U-14C] glucose (PerkinElmer, Massachusetts, USA) into lipids was performed to measure lipogenesis. Murine 3T3-L1 adipocytes, seeded in 24-well plates,
PT E
D
were starved for 6 h in serum-free DMEM. Cells were then preincubated with SPX (10, 100, 1,000 nM) in DMEM supplemented with 2% fatty acid-free BSA in the presence or absence of 500 nM insulin for 2 h. Medium was then removed, cells were lysed using
CE
0.1% SDS and the lysates were divided into two aliquots. One aliquot was used to
AC
determine the lipogenesis, as follows: using Dole’s extraction method [20], the lipid fraction was separated from the cells and the lipid-containing phase was transferred into scintillation liquid for counting of β-radiation. The second aliquot was assigned to determine protein content. Results were normalized to total protein content. Similarly, isolated human adipocytes were incubated with test agents in KRB medium supplemented with [U-14C] glucose for 2 h. The incubation was terminated by adding Dole’s extraction mixture. Separation of the lipid phase was performed by adding H2O and heptane. Then, the lipid fraction was transferred into a scintillation liquid for
ACCEPTED MANUSCRIPT counting of incorporated radioactivity using a β-counter. Results are shown as the percentage of the basal (set to 100%) incorporation of 14C into NEFA. 2.10 Lipolysis After 10 days of differentiation, murine 3T3-L1 adipocytes were incubated in serum-
PT
free DMEM for 6 hours in 24-well plates. Next, these mature adipocytes were treated with different concentrations of SPX (1.0, 10, 100, 1,000 nM), or isoproterenol (ISO; 10
RI
µM), as a positive control. Lipolysis was determined by quantifying the amounts of
SC
glycerol released into the incubation medium using Free Glycerol Reagent (Sigma
NU
Aldrich, Germany).
Isolated human adipocytes were incubated with SPX in KRB for 2 h or 6 h. Then, the
D
2.11 Oil Red O (ORO) staining
MA
glycerol concentration in the incubation medium was determined.
2.12 Real Time PCR
PT E
Oil Red O staining was conducted as previously described [21].
CE
Total RNA was extracted using Tripure Reagent (Roche Diagnostics, Germany). cDNA was generated from 1 µg of Total RNA using High-Capacity cDNA Reverse
AC
Transcription according to the manufacturer’s protocol (Life Technologies, Grand Island, NY, USA). Real-Time PCR was performed using QuantStudio 12K Flex™ Real-Time PCR and Fast SYBR Green Master Mix (Life Technologies). The primers for Real-Time were designed using primer blast or Roche assay design center (Table 1). Relative gene expression was evaluated by Delta Delta CT (ΔΔCT) with Gapdh as a reference. 2.13 Western blot
ACCEPTED MANUSCRIPT Western blot analysis was performed as previously described [22].
2.14 Statistical analysis The results are presented as the arithmetic mean ± SEM (Graph Pad Prism, GraphPad Software, Inc., USA). Statistical analysis was performed using One Way ANOVA
PT
followed by Dunnett’s post hoc. For the two-tailed test or unpaired Student’s t test (two-
SC
RI
tailed distribution), statistical significance was defined as *p < 0.05, or **p < 0.01.
3. Results
NU
3.1 SPX, GALR2 and GALR3 are expressed in murine 3T3-L1 and isolated human adipocytes
MA
mRNA of SPX (Fig. 1c), GALR2 and GALR3 (Fig. 1a) were detected in preadipocytes, mature murine 3T3-L1 adipocytes and primary human and murine adipocytes. We also
D
detected GALR2 and GALR3 protein production in all tested adipocytes and
PT E
preadipocytes. (Fig. 1b). GALR3 antibodies were recognized two bands as Western blots, which correspond to glycosylated and non-glycosylated receptors [23]. SPX
CE
proteins were also found in murine 3T3-L1 preadipocytes, differentiated mature murine 3T3-L1 adipocytes and human fat tissue by using immunofluorescence technique. SPX
AC
proteins were observed in murine 3T3-L1 preadipocytes as well as in differentiated mature adipocytes. Additionally, SPX was detected in human visceral fat tissue sections (Fig. 1d). 3.2 Effects of SPX on murine 3T3-L1 cell proliferation and viability The adipogenesis process includes proliferation and differentiation of fat cells. SPX can inhibit proliferation of adrenocortical cells [8]. Therefore, we tested the ability of SPX
ACCEPTED MANUSCRIPT to regulate proliferation and viability in fat cells. SPX failed to affect murine 3T3-L1 cell proliferation and viability (Fig. 2a-b). 3.3 SPX reduces the differentiation of murine 3T3-L1 fibroblasts into mature adipocytes Next, we tested the ability of SPX to regulate the differentiation of murine 3T3-L1 into
PT
mature adipocytes. Initially, we tested the effect of SPX on triglyceride (TG)
RI
accumulation after 3, 7, 10 and 14 days of differentiation. In the early stage of differentiation (day 3), SPX only reduced TG accumulation at 100 nM (Fig. 3a). After 7
SC
days of differentiation SPX at all tested doses (1-1,000 nM), intracellular TG content
NU
decreased (Fig. 3b). After 10 and 14 days of differentiation, SPX reduced TG content at 10 nM (p < 0.05) and 100 nM (p < 0.01) (Fig. 3c-d). Representative images (ORO
MA
staining) of murine 3T3-L1 cells differentiated with or without SPX for ten days (middle panel).
D
3.4 SPX down-regulates Pparγ, C/ebpα, C/ebpβ, and Fabp4 expression
PT E
SPX at 100 nM down-regulated the expression of Pparγ, C/ebpα, and C/ebpβ mRNA (p < 0.01) (Fig. 3e, f, g) on day 3. Moreover, SPX at 1,000 nM reduced C/ebpα and β (p <
CE
0.05), and Pparγ (p < 0.01) mRNA expression. Furthermore, SPX at 10 (p < 0.05), 100
3h).
AC
(p < 0.01), and 1,000 nM (p < 0.01) down-regulated mRNA expression of Fabp4 (Fig.
3.5 SPX stimulates lipolysis SPX at 10 (p < 0.01) and 100 nM (p < 0.01) stimulated lipolysis of murine 3T3-L1 adipocytes after 120 min. After 360 min, lipolysis increased in the presence of 100 nM (p < 0.01) and 1,000 nM (p < 0.01) SPX (Fig. 4a, b). Experiments performed on human adipocytes confirmed the results obtained with murine 3T3-L1 adipocytes. SPX at 1.0, 10, and 1,000 nM (p < 0.05) and 100 nM; (p < 0.01) increased lipolysis after 120 min.
ACCEPTED MANUSCRIPT After 360 min, SPX increased lipolysis at 1.0 (p < 0.05), 100 (p < 0.01) and 1,000 nM (p < 0.01). These effects were associated with increased phosphorylation of hormonesensitive lipase (pHSL). We observed an up-regulation of Ser563 and Ser 660 HSL phosphorylation after treatment of murine 3T3-L1 cell with almost all SPX doses except 1,000 nM. SPX at 1.0, 10 and 100 nM (p < 0.01) increased HSL phosphorylation in
PT
murine 3T3-L1 cells. Additionally, Ser 552 phosphorylation increased in isolated
RI
human adipocytes exposed to 1.0 nM (p < 0.05), 10 nM (p < 0.01) and 100 nM (p <
SC
0.01) SPX, while Ser650 phosphorylation increased in cells exposed to 1 nM (p < 0.01), 10 nM (p < 0.05), 100 nM (p < 0.01) and 1,000 nM (p < 0.001) SPX. As expected,
NU
isoproterenol, when used as a positive control, stimulated HSL phosphorylation.
MA
3.6 SPX decreases lipogenesis and glucose uptake in isolated human adipocytes and murine 3T3-L1 cell lines
D
Next, we tested whether SPX can modify lipogenesis and glucose uptake. Basal
PT E
lipogenesis decreased in murine 3T3-L1 cells and isolated human adipocytes incubated with SPX at 1.0 nM (p < 0.05), 10 nM (p < 0.05), 100 nM (p < 0.01) and 1,000 nM (p <
CE
0.01) (Fig. 5a, c). Apart from 1.0 nM, all tested SPX doses inhibited insulin-stimulated lipogenesis in murine 3T3-L1 adipocytes (Fig. 5a).
AC
Next, we tested the role of SPX in regulating basal and insulin-stimulated glucose uptake in murine 3T3-L1 as well as in human adipocytes. Based on previous results (lipolysis and lipogenesis), we decided to use the most effective dose of 100 nM SPX in this part of the experiments. SPX decreased basal glucose uptake in murine 3T3L1 adipocytes (p < 0.01) as well as in isolated human adipocytes (p < 0.05) (Fig. 5b, d). Additionally, SPX attenuated insulin-stimulated glucose uptake in murine and human adipocytes (p < 0.01) (Fig. 5b, d).
ACCEPTED MANUSCRIPT Fatty acid synthase (FAS) is involved in the regulation of lipogenesis in adipocytes [24]. Therefore, we investigated the effects of SPX on the mRNA and protein production of FAS in murine 3T3-L1 adipocytes and on FAS mRNA expression in human adipocytes. SPX at 1.0, 10, 100 and 1,000 nM decreased mRNA expression as well as the protein production of FAS in murine 3T3-L1 adipocytes (Fig. 5e, f). In
PT
isolated human adipocytes, SPX at all tested levels except for 1.0 nM, down-regulated
RI
FAS mRNA expression.
SC
3.6 SPX modulates adipocyte function via GALR2 and GALR3 receptors
NU
To confirm the role of GALR2 and GALR3 in conferring the effects of SPX on lipolysis in murine 3T3-L1 adipocytes, we used specific and selective antagonists – M871 for
MA
GALR2 and SNAP37899 for GALR3 – as well as non-selective GALRs antagonists: M40. Based on previous experiments, we chose 100 nM SPX as the most potent dose.
D
Concentrations of antagonists were chosen based on the literature: M871 – 0.05 µM,
PT E
SNAP37899 – 5 µM, M40 – 1 µM. After 30 min pre-incubation with specific antagonists, i.e. M871 and SNAP37899, the effect of SPX on lipolysis was still
CE
detectable (p < 0.05). However, the stimulation of this process was less potent compared to the effect of SPX in cells incubated without antagonists (p < 0.01) after
AC
120 and 360 min (Fig. 6a, b, c, d). When both antagonists, i.e. M871 and SNAP37899, were used together (Fig. 6 e, f) or in the presence of M40 alone (Fig. 6 g, h), the stimulatory effect of SPX was completely abolished. 4. DISCUSSION In the present study, we showed for the first time that SPX decreases adipogenesis, regulates adipogenic genes, increases lipolysis as well as decreases lipogenesis and glucose uptake in murine 3T3-L1 adipocytes as well as in isolated human visceral
ACCEPTED MANUSCRIPT adipocytes. Moreover, SPX enhances HSL phosphorylation and inhibits FAS mRNA expression, and FAS protein production. Additionally, we showed that SPX mRNA and protein are present in human fat tissue. Moreover, using isolated human adipocytes, we confirmed our observations in murine 3T3-L1 adipocytes. Overall, we showed that SPX decreases lipogenesis as well as glucose uptake in isolated human adipocytes.
PT
Moreover, we found that SPX increases lipolysis and enhances HSL phosphorylation.
RI
These results suggest that SPX regulates fat tissue metabolism in murine 3T3-L1
SC
adipocytes and human adipocytes.
In 2014, Kim et al. showed that SPX activates GALR2 and GALR3 but not GALR1 [4].
NU
However, the impact of SPX on the expression and protein levels of these receptors has
MA
not so far been investigated. We found that both receptors, GALR2 and GALR3, are expressed in undifferentiated murine 3T3-L1 cells and mature murine 3T3-L1 adipocytes as well as in isolated murine and human adipocytes, and in human and
PT E
D
murine fat tissues. These findings confirm previous results reported by Kim et al. which showed that GALR2 and GALR3 are expressed in murine 3T3-L1 cell lines and in
CE
visceral and subcutaneous mouse fat tissue [25]. Additionally, previous studies have demonstrated that GALR2 mRNA is
AC
expressed in various human tissues, including adipose tissue, the pancreas, colon, and small intestine [6,26]. We report here for the first time the presence of GALR2 and GALR3 mRNA and protein in isolated human adipocytes and visceral fat tissue. We found an expression of GALR3 protein in all investigated cells and tissues: human adipocytes and fat tissue, isolated mouse adipocytes and adipose tissue as well as murine 3T3-L1 preadipocytes and murine 3T3-L1 adipocytes. In 1998, Kolakowski et al. showed that GALR3 is expressed in several human tissues, for example the testis, brain, skeletal muscle, pancreas, small intestine, large intestine, rectum, and placenta
ACCEPTED MANUSCRIPT [26]. Walewski et al. reported that GALR3 mRNA is highly expressed in mouse small intestine, adipose tissue and in the liver. Here, we showed that GALR2 as well as GALR3 are expressed on the mRNA and protein level in human adipocytes, human fat tissue as well as in the murine 3T3-L1 cell line and isolated mouse adipocytes, and fat tissue. Using the immunofluorescence technique, we showed that SPX protein is
PT
produced in murine 3T3-L1 preadipocytes and murine 3T3-L1 adipocytes as well as in
SC
method because of the small molecular weight of SPX.
RI
human visceral fat tissue. We decided to utilize the immunofluorescence-detection
The co-localization of SPX and GALR2/3 expression as well as the effect of
NU
SPX on murine 3T3-L1 and isolated human adipocytes suggest an autocrine/paracrine
MA
mode of action for SPX. Previous studies have shown that GALR2 and GALR3 are expressed in the brain and gastrointestinal tract [27–29]. SPX is expressed and modulates the function of these tissues by enhancing bowel movements and inhibiting
PT E
D
food intake [3,6,30,31]. Moreover, others have shown that other neuropeptides belong to this family such as galanin, kisspeptin, neuropeptide Y, VIP, PACAP [32–35]. Additionally, Ma et al. reported that insulin acts as an autocrine/paracrine signal to
CE
trigger SPX mRNA expression in the liver and it acts as an endocrine modulator of SPX
AC
expression in the brain in fishes [36]. These results indicate that SPX may act via endocrine and autocrine/paracrine mechanisms to regulate metabolism. SPX inhibits proliferation of adrenocortical cells [8]. Moreover, galanin, a natural agonist of GALR 1-3 receptors, can suppress cancer cell proliferation [37,38]. However, we did not observe any effect of SPX on the proliferation and viability of murine 3T3-L1 cells. The differences between our results compared to those in the published literature may be due to the different types of cells or receptor isoforms. Cancer cells, for example squamous carcinoma cells or mutant head and neck cancer
ACCEPTED MANUSCRIPT cells, are highly proliferative compared to murine 3T3-L1. Moreover, as previously described, the biological activity of SPX is mediated via GALR2 and GALR3. Depending on the binding to either one or other isoform of the receptor, SPX can activate various intracellular pathways; however, this requires further research.
PT
Mouse studies have demonstrated that SPX reduces food intake and body weight by inhibiting long chain FA uptake in isolated adipocytes and hepatocytes [6,7].
RI
Moreover, these animal studies have shown that SPX is one of the most down-regulated
SC
genes in obese humans and mice [6]. In agreement with these observations, our results indicate that SPX plays a role as an antiobesity agent by inhibiting glucose uptake and
NU
lipogenesis in human and murine 3T3-L1 adipocytes. Studies performed in patients with
MA
T2DM have shown that SPX is down-regulated during glucose tolerance tests [9]. Reduced levels of SPX after glucose tolerance tests in T2DM patients could reflect a defense mechanism. As a potent stimulator of lipolysis, SPX can be down-regulated
PT E
D
during positive energy homeostasis (defined as an increased availability of energy suppliers such as glucose or lipids) which may explain decreased SPX levels in blood
CE
serum.
Phosphorylation of HSL is a crucial step required for lipolysis [39]. Therefore, we
AC
investigated the effects of SPX on the lipolysis. We observed that SPX stimulates HSL phosphorylation which is associated with increased lipolysis in murine 3T3-L1 cells as well as in isolated human adipocytes. Moreover, we found that the presence of SPX in the differentiation medium reduces intracellular TG accumulation. Inhibitory effects on adipogenesis are also reflected in the down-regulation of several surrogate molecular parameters of adipocyte differentiation, such as PPARγ, CEBP/α, CEBP/β and FABP4 [40].
ACCEPTED MANUSCRIPT Another important process in the context of adipogenesis is lipogenesis. An increase in lipogenesis contributes to the pathophysiology of obesity [41]. In our current study, we demonstrated that SPX decreases lipogenesis as well as glucose uptake by murine 3T3-L1 and isolated human adipocytes.
PT
Previous studies have shown that SPX down-regulates food intake which suggests an anorexigenic activity of this peptide [6]. Many peptides and hormones classified as
RI
anorexigenic, for example leptin, decrease lipogenesis and glucose uptake by adipocytes
SC
in vitro [42,43]. We showed that SPX inhibits lipogenesis and glucose uptake by adipocytes in vitro. Additionally, SPX down-regulated FAS mRNA expression and
NU
protein production during the differentiation of murine 3T3-L1 cells into mature adipocytes. The role of SPX in the regulation of fat cell metabolism seems to be
MA
opposite to galanin – another GALR2 and GALR3 agonist. In a diet-induced obesity (DIO) mouse model, the GAL-mediated signaling cascade is affected in adipose tissue.
PT E
D
This study demonstrated that DIO up-regulates GALR expression and there is a possible association of the GAL-mediated signaling pathways in the HFD-induced activation of adipogenesis along with a suppression of thermogenesis, which suggests a
CE
proadipogenic role for galanin [25]. These discoveries have been confirmed using mice
AC
with chronically increased levels of circulating GAL, which led to reduced energy expenditure, insulin resistance, increased body weight and development on nonalcoholic fatty liver disease – NAFLD [44]. Moreover, serum GAL levels increased during obesity, which is in opposition to SPX levels [45]. In contrast, experiments performed in diabetic as well as healthy rats have shown that endogenous GAL reduces insulin resistance by increasing GLUT4 contents and promoting GLUT4 transportation from intracellular membranes to plasma membranes in adipocytes as well as in muscle cells [46]. Although GAL and SPX are natural agonists of GALR2 and GALR3
ACCEPTED MANUSCRIPT receptors and results suggest an opposite role for both peptides, limited knowledge of this phenomenon does not allow a clear statement of this activity. More studies are needed to explore this phenomenon. An important limitation of our study is the lack of identification of intracellular
PT
pathways conferring the effects of SPX on various cellular functions. However, previous studies conducted on fish have shown that insulin is involved in the regulation
RI
of SPX expression [36]. Moreover, GALR2 plays a role in regulating anxiety,
SC
depression and appetite. Additionally, SPX is a potent agonist of GALR2 [6]. ReyesAlcaraz et al. found that SPX-based human galanin receptor type II-specific agonists
NU
with increased biological stability are anxiolytic in mice [47]. We, therefore, plan to
MA
investigate the effects of SPX on adipokine secretion and identify molecular pathways to further explain our current findings.
D
In summary, we have shown that SPX, GALR2 and GALR3 are expressed in murine
PT E
3T3-L1 adipocytes as well as in human fat tissue. SPX controls differentiation of murine 3T3-L1 preadipocytes into mature adipocytes and this is accompanied by down-
CE
regulation of the expression of proadipogenic genes such as Pparγ, C/ebpα, C/ebpβ and Fabp4. Moreover, we showed that SPX increases lipolysis by enhancing HSL
AC
phosphorylation and decreasing glucose uptake as well as lipogenesis in murine 3T3-L1 adipocytes and isolated human adipocytes. These findings render SPX a novel anorexigenic factor with possible pathophysiological or therapeutic potential in fighting obesity. Acknowledgements
ACCEPTED MANUSCRIPT Funding: This work was supported by the National Science Centre, Poland 2015/19/N/NZ4/00572 PRELUDIUM grant. M.Z.S. was supported by the Deutsche Forschungsgemeinschaft and Deutsche Diabetes Stiftung. Author contributions
PT
PAK. designed the study, obtained the data and wrote the manuscript. EPO., contributed to the study design, experiment performing, edited, supported and critically revised the
RI
manuscript and contributed to the discussion. TW., KS., MM., PS., researched data.
SC
MZS., KWN., MS. edited, supported and critically revised the manuscript and
NU
contributed to the discussion. All authors have given final approval to the current version to be published.
MA
Conflict of interest
D
The authors declare that they have no competing interests.
PT E
References
O. Mirabeau, E. Perlas, C. Severini, E. Audero, O. Gascuel, R. Possenti, E. Birney, N. Rosenthal, C. Gross, Identification of novel peptide hormones in the human proteome by hidden Markov model screening, Genome Res. 17 (2007) 320–327. doi:10.1101/gr.5755407.320.
[2]
K. Sonmez, N.T. Zaveri, I. a. Kerman, S. Burke, C.R. Neal, X. Xie, S.J. Watson, L. Toll, Evolutionary sequence modeling for discovery of peptide hormones, PLoS Comput. Biol. 5 (2009). doi:10.1371/journal.pcbi.1000258.
[3]
A. Porzionato, M. Rucinski, V. Macchi, C. Stecco, L.K. Malendowicz, R. De Caro, Spexin expression in normal rat tissues., J. Histochem. Cytochem. 58 (2010) 825–837. doi:10.1369/jhc.2010.956300.
[4]
D.K. Kim, S. Yun, G.H. Son, J.I. Hwang, C.R. Park, J. Il Kim, K. Kim, H. Vaudry, J.Y. Seong, Coevolution of the spexin/galanin/kisspeptin family: Spexin activates galanin receptor type II and III, Endocrinology. 155 (2014) 1864–1873. doi:10.1210/en.2013-2106.
[5]
C. Lin, M. Zhang, T. Huang, L. Yang, H. Fu, L. Zhao, L.L. Zhong, H. Mu, X. Shi, C.F. Leung, B. Fan, M. Jiang, A. Lu, L. Zhu, Z. Bian, Spexin Enhances Bowel Movement through Activating L-type Voltage-dependent Calcium
AC
CE
[1]
ACCEPTED MANUSCRIPT Channel via Galanin Receptor 2 in Mice, Sci. Rep. 5 (2015) 12095. doi:10.1038/srep12095. J.L. Walewski, F. Ge, H. Lobdell, N. Levin, G.J. Schwartz, J.R. Vasselli, A. Pomp, G. Dakin, P.D. Berk, Spexin is a novel human peptide that reduces adipocyte uptake of long chain fatty acids and causes weight loss in rodents with diet-induced obesity, Obesity. 22 (2014) 1643–1652. doi:10.1002/oby.20725.
[7]
G. Jasmine, J. Walewski, D. Anglade, P. Berk, Regulation of Hepatocellular Fatty Acid Uptake in Mouse Models of Fatty Liver Disease with and without Functional Leptin Signaling: Roles of NfKB and SREBP-1C and the Effects of Spexin, Semin. Liver Dis. 36 (2016) 360–372. doi:10.1055/s-0036-1597248.
[8]
M. Rucinski, A. Porzionato, A. Ziolkowska, M. Szyszka, V. Macchi, R. De Caro, L.K. Malendowicz, Expression of the spexin gene in the rat adrenal gland and evidences suggesting that spexin inhibits adrenocortical cell proliferation, Peptides. 31 (2010) 676–682. doi:10.1016/j.peptides.2009.12.025.
[9]
L. Gu, Y. Ma, M. Gu, Y. Zhang, S. Yan, N. Li, Y. Wang, X. Ding, J. Yin, N. Fan, Y. Peng, Spexin peptide is expressed in human endocrine and epithelial tissues and reduced after glucose load in type 2 diabetes, Peptides. (2015). doi:10.1016/j.peptides.2015.07.018.
NU
SC
RI
PT
[6]
D
MA
[10] P.A. Kolodziejski, E. Pruszynska-Oszmalek, E. Korek, M. Sassek, D. Szczepankiewicz, P. Kaczmarek, L. Nogowski, P. Mackowiak, K.W. Nowak, H. Krauss, M.Z. Strowski, Serum Levels of Spexin and Kisspeptin Negatively Correlate With Obesity and Insulin Resistance in Women, Physiol. Res. 67 (2018) 45–56.
PT E
[11] L. Toll, T. V Khroyan, K. Sonmez, A. Ozawa, I. Lindberg, J.P. Mclaughlin, S.O. Eans, A.A. Shahien, D.R. Kapusta, Peptides derived from the prohormone proNPQ / spexin are potent central modulators of cardiovascular and renal function and nociception, FASEB J. 26 (2012) 947–954. doi:10.1096/fj.11192831.
AC
CE
[12] Y. Liu, S. Li, X. Qi, W. Zhou, X. Liu, H. Lin, Y. Zhang, C.H.K. Cheng, A novel neuropeptide in suppressing luteinizing hormone release in goldfish, Carassius auratus, Mol. Cell. Endocrinol. 374 (2013) 65–72. doi:10.1016/j.mce.2013.04.008. [13] A. Ma, J. Bai, M. He, A.O.L. Wong, Spexin as a neuroendocrine signal with emerging functions, Gen. Comp. Endocrinol. (2018) 1–7. doi:10.1016/j.ygcen.2018.01.015. [14] A. Porzionato, M. Rucinski, V. Macchi, C. Stecco, G. Sarasin, M.M. Sfriso, C. Di Giulio, L.K. Malendowicz, R. De Caro, Spexin Is Expressed in the Carotid Body and Is Upregulated by Postnatal Hyperoxia Exposure, Adv. Exp. Med. Biol. 758 (2012) 207–13. [15] M.K.H. Wong, K.H. Sze, T. Chen, C.K. Cho, H.C.H. Law, I.K. Chu, a. O.L. Wong, Goldfish spexin: solution structure and novel function as a satiety factor in feeding control, AJP Endocrinol. Metab. 305 (2013) E348–E366. doi:10.1152/ajpendo.00141.2013.
ACCEPTED MANUSCRIPT [16] E. Pruszynska-Oszmalek, D. Szczepankiewicz, I. Hertig, M. Skrzypski, M. Sassek, P. Kaczmarek, P.A. Kolodziejski, P. Mackowiak, K.W. Nowak, M.Z. Strowski, T. Wojciechowicz, Obestatin inhibits lipogenesis and glucose uptake in isolated primary rat adipocytes., J. Biol. Regul. Homeost. Agents. 27 (2013) 23– 33. [17] M. Rodbell, Metabolism of isolated fat cells. 1. Effects of hormones on glucose metabolism and lipolysis, J. Biol. Chem. 239 (1964) 375–380.
RI
PT
[18] M. Skrzypski, N. Khajavi, S. Mergler, D. Szczepankiewicz, P.A. Kolodziejski, D. Metzke, T. Wojciechowicz, M. Billert, K. Nowak, M. Strowski, TRPV6 channel modulates proliferation of insulin secreting INS-1E beta cell line, Biochim. Biophys. Acta - Mol. Cell Res. 1853 (2015) 3202–3210. doi:10.1016/j.bbamcr.2015.09.012.
SC
[19] E. Pruszynska-Oszmalek, P.A. Kolodziejski, M. Sassek, J.H. Sliwowska, Kisspeptin-10 inhibits proliferation and regulates lipolysis and lipogenesis processes in 3T3-L1 cells and isolated rat adipocytes, Endocrine. 56 (2017) 54– 64. doi:10.1007/s12020-017-1248-y.
NU
[20] V.P. Dole, H. Meinertz, Microdetermination of Long-chain Fatty Acids in Plasma and Tissues, J. Biol. Chem. 235 (1960) 2595–2599. http://www.jbc.org.
D
MA
[21] T. Wojciechowicz, M. Skrzypski, P.A. Koodziejski, D. Szczepankiewicz, E. Pruszyskaoszmaek, P. Kaczmarek, M.Z. Strowski, K.W. Nowak, Obestatin stimulates differentiation and regulates lipolysis and leptin secretion in rat preadipocytes, Mol. Med. Rep. 12 (2015) 8169–8175. doi:10.3892/mmr.2015.4470.
PT E
[22] P.A. Kołodziejski, E. Pruszyńska-Oszmałek, M.Z. Strowski, K.W. Nowak, Longterm obestatin treatment of mice type 2 diabetes increases insulin sensitivity and improves liver function, Endocrine. 56 (2017) 538–550. doi:10.1007/s12020017-1309-2.
CE
[23] J.J. Hawes, M.R. Picciotto, GalR3 Immunoreactivity in Catecholaminergic Nuclei of the Mouse Brain, J. Comp. Neurol. 423 (2004) 410–423. doi:10.1002/cne.20329.
AC
[24] Y. Wang, B.J. Voy, S. Urs, S. Kim, M. Soltani-bejnood, N. Quigley, Y. Heo, M. Standridge, B. Andersen, M. Dhar, R. Joshi, P. Wortman, J.W. Taylor, J. Chun, M. Leuze, K. Claycombe, A.M. Saxton, N. Moustaid-moussa, Nutrient-Gene Interactions The Human Fatty Acid Synthase Gene and De Novo Lipogenesis Are Coordinately Regulated in Human Adipose Tissue, J. Nutr. (2004) 1032– 1038. [25] A. Kim, T. Park, Diet-induced obesity regulates the galanin-mediated signaling cascade in the adipose tissue of mice, Mol. Nutr. Food Res. 54 (2010) 1361– 1370. doi:10.1002/mnfr.200900317. [26] L.F. Kolakowski, G.P.O. Neill, A.D. Howard, S.R. Broussard, A. Sullivan, D. Feighner, T. Nguyen, S. Kargman, L. Hreniuk, P. Tan, J. Evans, M. Abramovitz, A. Chateauneuf, N. Coulombe, G. Ng, M.P. Johnson, A. Tharian, H. Khoshbouei, S. George, I.G. Smith, B.F. O’Dowd, Molecular Characterization and Expression
ACCEPTED MANUSCRIPT of Cloned Human Galanin Receptors GALR2 and GALR3, J. Neurochem. 71 (1998) 2239–2251. [27] X. Lu, A. Mazarati, P. Sanna, S. Shinmei, T. Bartfai, Distribution and differential regulation of galanin receptor subtypes in rat brain: Effects of seizure activity, Neuropeptides. 39 (2005) 147–152. doi:10.1016/j.npep.2004.12.011. [28] G. Barreda-Gómez, M.T. Giralt, R. Rodríguez-Puertas, G protein-coupled galanin receptor distribution in the rat central nervous system, Neuropeptides. 39 (2005) 153–156. doi:10.1016/j.npep.2004.12.014.
RI
PT
[29] L. Anselmi, S.L. Stella, A. Lakhter, A. Hirano, M. Tonini, Catia Sternini, Galanin receptors in the rat gastrointestinal tract, Neuropeptides. 39 (2005) 349– 352. doi:10.1016/j.npep.2004.12.023.
SC
[30] C. Lin, M. Zhang, T. Huang, L. Yang, H. Fu, L. Zhao, Spexin Enhances Bowel Movement through Activating L-type Voltage- dependent Calcium Channel via Galanin Receptor 2 in Mice, Nat. Publ. Gr. (2015) 1–12. doi:10.1038/srep12095.
NU
[31] A. Pałasz, M. Janas-Kozik, A. Borrow, O. Arias-Carrión, J.J. Worthington, The potential role of the novel hypothalamic neuropeptides nesfatin-1, phoenixin, spexin and kisspeptin in the pathogenesis of anxiety and anorexia nervosa, Neurochem. Int. 113 (2018) 120–136. doi:10.1016/j.neuint.2017.12.006.
D
MA
[32] A. Berger, R. Santic, C. Hauser-Kronberger, F.H. Schilling, P. Kogner, M. Ratschek, A. Gamper, N. Jones, W. Sperl, B. Kofler, Galanin and galanin receptors in human cancers, Neuropeptides. 39 (2005) 353–359. doi:10.1016/j.npep.2004.12.016.
PT E
[33] G.G. Nussdorfer, L.K. Malendowicz, Role of VIP, PACAP, and related peptides in the regulation of the hypothalamo-pituitary-adrenal axis, Peptides. 19 (1998) 1443–1467. doi:10.1016/S0196-9781(98)00102-8.
CE
[34] G.G. Nussdorfer, G. Gottardo, Neuropeptide-Y family of peptides in the autocrine-paracrine regulation of adrenocortical function, Horm. Metab. Res. 30 (1998) 368–373. doi:10.1055/s-2007-978900.
AC
[35] Y. Uenoyama, V. Pheng, H. Tsukamura, K. Maeda, The roles of kisspeptin revisited: inside and outside the hypothalamus, J. Reprod. Dev. 62 (2016) 537– 545. doi:10.1262/jrd.2016-083. [36] A. Ma, M. He, J. Bai, M.K.H. Wong, W.K.W. Ko, A.O.L. Wong, Dual role of insulin in Spexin regulation: Functional link between food intake and Spexin expression in a fish model, Endocrinology. 158 (2017) 560–577. doi:10.1210/en.2016-1534. [37] T. Kanazawa, P.K. Kommareddi, T. Iwashita, K. Bhavna, K. Misawa, Y. Misawa, I. Jang, T.S. Nair, Y. Iino, T.E. Carey, Galanin Receptor Subtype 2 Suppresses Cell Proliferation and Induces Apoptosis in p53 Mutant Head and Neck Cancer Cells, Clin. Cancer Res. 15 (2009) 2222–2230. doi:10.1158/10780432.CCR-08-2443.Galanin. [38] T. Kanazawa, T. Iwashita, P. Kommareddi, T. Nair, K. Misawa, Y. Misawa, Y. Ueda, T. Tono, T.E. Carey, Galanin and galanin receptor type 1 suppress
ACCEPTED MANUSCRIPT proliferation in squamous carcinoma cells: activation of the extracellular signal regulated kinase pathway and induction of cyclin-dependent kinase inhibitors, Oncogene. 26 (2007) 5762–5771. doi:10.1038/sj.onc.1210384. [39] R.E. Duncan, M. Ahmadian, K. Jaworski, E. Sarkadi-Nagy, H.S. Sul, Regulation of lipolysis in adipocytes., Annu. Rev. Nutr. 27 (2007) 79–101. doi:10.1146/annurev.nutr.27.061406.093734. [40] J.M. Ntambi, Y. Kim, Adipocyte Differentiation and Gene Expression, J. Nutr. 130 (2000) 3122–3126.
RI
PT
[41] M.S. Strable, J.M. Ntambi, Genetic control of de novo lipogenesis: role in dietinduced obesity, Crit. Rev. Biochem. Mol. Biol. 45 (2010) 199–214. doi:10.3109/10409231003667500.Genetic.
SC
[42] M. Ho, S. Foxall, M. Higginbottom, D.M. Donofrio, J. Liao, P.J. Richardson, Y.P. Maneuf, Leptin-mediated inhibition of the insulin-stimulated increase in fatty acid uptake in differentiated 3T3-L1 adipocytes, Metabolism. 55 (2006) 8– 12. doi:10.1016/j.metabol.2005.06.013.
MA
NU
[43] C. Buettner, E.D. Muse, A. Cheng, L. Chen, A. Pocai, K. Su, B. Cheng, X. Li, J. Harvey-, G.J. Schwartz, G. Kunos, L. Rossetti, Leptin controls adipose tissue lipogenesis via central, STAT3– independent mechanisms, Nat. Med. 14 (2009) 667–675. doi:10.1038/nm1775.Leptin.
D
[44] N.J. Poritsanos, T.M. Mizuno, M.E. Lautatzis, M. Vrontakis, Chronic increase of circulating galanin levels induces obesity and marked alterations in lipid metabolism similar to metabolic syndrome, Int. J. Obes. 33 (2009) 1381–1389. doi:10.1038/ijo.2009.187.
PT E
[45] B. Baranowska, E. Wasilewska-Dziubinska, M. Radzikowska, a Plonowski, K. Roguski, Neuropeptide Y, galanin, and leptin release in obese women and in women with anorexia nervosa, Metabolism. 46 (1997) 1384–1389. doi:10.1016/S0026-0495(97)90136-0.
AC
CE
[46] L. Guo, M. Shi, L. Zhang, G. Li, L. Zhang, H. Shao, P. Fang, Y. Ma, J. Li, Q. Shi, Y. Sui, Galanin antagonist increases insulin resistance by reducing glucose transporter 4 effect in adipocytes of rats, Gen. Comp. Endocrinol. 173 (2011) 159–163. doi:10.1016/j.ygcen.2011.05.011. [47] A. Reyes-alcaraz, Y. Lee, G.H. Son, N.H. Kim, D. Kim, Development of Spexinbased Human Galanin Receptor Type II- Specific Agonists with Increased Stability in Serum and Anxiolytic Effect in Mice, Sci. Rep. 6 (2016) 1–10. doi:10.1038/srep21453.
ACCEPTED MANUSCRIPT Figure legends Fig.1 mRNA expression of galanin receptors (GALR2 and GALR3) in 3T3-L1 preadipocytes, 3T3-L1 adipocytes, isolated mouse adipocytes, mouse fat tissue, human adipocytes and human visceral fat tissue (A). Western blot detection of
PT
galanin receptors (GALR2 and GALR3) in 3T3-L1 preadipocytes, 3T3-L1
RI
adipocytes, isolated mouse adipocytes, mouse fat tissue, human adipocytes and
SC
human visceral fat tissue (B). mRNA expression of SPX in 3T3-L1 preadipocytes, 3T3-L1 adipocytes, isolated mouse adipocytes, mouse fat tissue, human adipocytes
NU
and human fat tissue (C). Immunofluorescence detection of SPX in 3T3-L1 preadipocytes, adipocytes and human fat tissue. Lipid droplets in mature 3T3-L1
MA
adipocytes stained using BODIPY (D). Fig.2
D
Effect of SPX on cell proliferation (A) and cell viability (B). Results are shown as
PT E
percentage of control group (set to 100%). Fetal calf serum (FCS) was used as positive control. Results are shown as mean ± standard error of mean (SEM) derived
Fig.3
CE
from n-8 replicates. The experiment was repeated at least four times.
AC
Effect of SPX (1.0–1000 nM) on triacylglycerol accumulation. Quantification of intracellular triacylglycerol content in cells incubated with or without SPX for 3 (A), 7 (B), 10 (C), 14 (D) days. Representative images (ORO staining) of 3T3-L1 cells incubated with or without SPX (1.0-1000nM) on the day 10 (middle panel). Effects of SPX on proadipogenic genes mRNA expression in 3T3-L1 cells: PPARγ (E), CEBPα (F), CEBPβ (G) and FABP4 (G). Results are shown as mean ± standard error of mean (SEM) derived from n=8 replicates. The experiment was repeated at
ACCEPTED MANUSCRIPT least four times. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus corresponding control using One Way ANOVA followed by the Dunnett post hoc test. Fig.4 Determination of
lipolysis in 3T3-L1 adipocytes (A,B) and isolated human
PT
adipocytes (D,F) exposed to SPX (1.0-1000nM) for 120 and 360 min. Isoproterenol
RI
was used as a positive control. Results are shown as percentage of basal lipolysis
SC
(set to 100%). Effect of SPX on HSL phosphorylation at S563 and S660 in 3T3-L1 cells (C) and in isolated human adipocytes atS552 and S650 (G). The images show
NU
representative (not the best) results of Western blot analysis of pHSL and total HSL. Results are shown as mean ± standard error of mean (SEM) derived from n=8
MA
replicates. The experiment was repeated at least four times. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus corresponding control
D
using One Way ANOVA followed by the Dunnett post hoc test.
PT E
Fig. 5
Effect of SPX on basal and insulin-stimulated lipogenesis measured as incorporation
CE
of C14 glucose into lipids in 3T3-L1 adipocytes (A). Effect of SPX on basal and insulin-stimulated 2-deoxy-D-[-1-3H]glucose uptake into the 3T3-L1 adipocytes
AC
(B). Negative control: cytochalasin B (cytB, 100 µM). mRNA expression of Fasn after SPX exposition (E). Insulin:positive control. Effect of SPX on basal lipogenesis measured as incorporation of C14 glucose into lipids in isolated human adipocytes. Insulin: positive control(C). Effect of SPX on basal and insulinstimulated 2-deoxy-D-[-1-3H]glucose uptake in isolated human adipocytes (D). Results (A-D) are shown as percentage of basal lipolysis (set to 100%). mRNA expression of FASN after SPX treatment of isolated human adipocytes (F). Western
ACCEPTED MANUSCRIPT blot analysis of FAS protein expression normalized to β-actin in 3T3-L1 adipocytes (G). Results are shown as mean ± standard error of mean (SEM) derived from n=8 replicates. The experiment was repeated at least four times. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus corresponding control using One Way ANOVA followed by the Dunnett post hoc test or unpaired
PT
Student’s t test (two-tailed distribution).
RI
Fig. 6
SC
Effects of GALR2/3 and GALRs antagonists on spexin induced lipolysis in 3T3-L1 adipocytes. Cells were pre-incubated 30 min with or without GALR2 antagonist
NU
M871 (Fig.6 a, b), GALR3 antagonist SNAP37889 (Fig. 6 c, d), GALR2 and 3 antagonist together (Fig. 6 e, f) and non-selective GALR 1, 2 and 3 antagonist M40
MA
(Fig. 6 g, h) and then 100 nM of SPX was added into the incubation medium. Effect of SPX was detected after 120 and 360 min of incubation. Different controls for
D
each antagonists were forced by different solvents for antagonists. Results are
PT E
shown as mean ± standard error of mean (SEM) derived from n=8 replicates. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus
AC
CE
corresponding control using unpaired Student’s t test (two-tailed distribution).
ACCEPTED MANUSCRIPT Table.1 Sequence of PCR primers and product size
Left primer (5’˃3’)
Right primer (5’˃3’)
Product Size
Spexin (Mouse)
tccttctcctggtgctgtct
tctgggtttcgtctttctgg
187
SPEXIN (Human)
tgacaagatgtccctgtgga
aggttgttgctgccagactt
184
GalR2 (Mouse)
cttaaaggcgccccatgt
cactagcgagtcacactgttcc
72
GALR2 (Human)
atggacatctgcaccttcgt
gtaggtcaggccgagaacc
63
GalR3 (Mouse)
cggccgtctcagtggata
cggccgtctcagtggata
131
GALR3 (Human)
tttacgctggctgctgtctc
cggtgccgtagtagctgag
160
Pparγ (Mouse)
ccacagactcggcactcaat
ccaagaataccaaagtgcgat
132
C/ebpα (Mouse)
aaacaacgcaacgtggaga
gcggtcattgtcactggtc
60
C/ebpβ (Mouse)
aagatgcgcaacctggag
cagggtgctgagctctcg
105
Fabp4 (Mouse)
aagagaaaacgagatggtgacaa
cttgtggaagtcacgccttt
65
FASN (Human)
catcggctccaccaagtc
gctatggaagtgcaggttgg
121
Fasn (Mouse)
ccaaatccaacatgggaca
tgctccagggataacagca
76
Gapd (Mouse)
atggtgaaggtcggtgtga
aatctccactttgccactgc
84
cgctctctgctcctcctgtt
catggtgtctgagcgatgt
81
AC
RI
SC
NU
MA
D
PT E
CE
GAPD (Human)
PT
Gene
ACCEPTED MANUSCRIPT Highlights Spexin is expressed in murine 3T3-L1 adipocytes and isolated human adipocytes
Spexin inhibits adipogenesis
Spexin stimulates lipolysis in human and murine 3T3-L1 adipocytes
Spexin inhibits lipogenesis and glucose uptake in human and murine 3T3-L1
PT
adipocytes
RI
Spexin effect on adipocytes metabolism is mediated via GALR2 and GALR3
CE
PT E
D
MA
NU
SC
receptors
AC
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Pawel A. Kolodziejski, Ewa Pruszynska-Oszmalek, Maciej Micker, Marek Skrzypski, Tatiana Wojciechowicz, Patryk Szwarckopf, Kinga Skieresz-Szewczyk, Krzysztof W. Nowak, Mathias Z. Strowski PII: DOI: Reference:
S1388-1981(18)30199-9 doi:10.1016/j.bbalip.2018.08.001 BBAMCB 58342
To appear in:
BBA - Molecular and Cell Biology of Lipids
Received date: Revised date: Accepted date:
17 April 2018 31 July 2018 2 August 2018
Please cite this article as: Pawel A. Kolodziejski, Ewa Pruszynska-Oszmalek, Maciej Micker, Marek Skrzypski, Tatiana Wojciechowicz, Patryk Szwarckopf, Kinga SkiereszSzewczyk, Krzysztof W. Nowak, Mathias Z. Strowski , Spexin: A novel regulator of adipogenesis and fat tissue metabolism. Bbamcb (2018), doi:10.1016/j.bbalip.2018.08.001
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Spexin: a novel regulator of adipogenesis and fat tissue metabolism Pawel A. Kolodziejski1*, Ewa Pruszynska-Oszmalek1, Maciej Micker2, Marek Skrzypski1., Tatiana Wojciechowicz1, Patryk Szwarckopf2, Kinga Skieresz-Szewczyk 3, Krzysztof W. Nowak1, Mathias Z Strowski4,5.
PT
1. Department of Animal Physiology and Biochemistry, Poznan University of Life Sciences Wolynska Street 28, 60-637 Poznan.
RI
2. Department of General and Vascular Surgery and Angiology, Poznan University of
SC
Medical Sciences, Dojazd Street 34, 60-631 Poznan, Poland
Wojska Polskiego 71C, Poznan, Poland
NU
3. Department of Histology and Embryology, Poznan University of Life Sciences,
MA
4. Department of Hepatology and Gastroenterology & the Interdisciplinary Centre of Metabolism: Endocrinology, Diabetes and Metabolism, Charité-University Medicine Berlin, 13353 Berlin, Germany
D
5. Park-Klinik Weissensee, Internal Medicine – Gastroenterology, 13086 Berlin,
PT E
Germany
AC
CE
* -corresponding author Present address: Department of Animal Physiology and Biochemistry Poznan University of Life Sciences Wolynska 35 street 60-637 Poznan Poland
Email: [email protected], [email protected] Key words: spexin, human adipocytes, 3T3-L1, adipogenesis, lipolysis, lipogenesis Running title: Spexin effect on adipocytes
ACCEPTED MANUSCRIPT Abstract Spexin (SPX, NPQ) is a novel peptide involved in the regulation of energy metabolism. SPX inhibits food intake and reduces body weight. In obese humans, SPX is the most down-regulated gene in fat. Therefore, SPX might be involved in the
PT
regulation of lipid metabolism. Here, we study the effects of SPX on lipolysis, lipogenesis, glucose uptake, adipogenesis, cell proliferation and survival in isolated
RI
human adipocytes or murine 3T3-L1 cells. SPX and its receptors, GALR2 and GALR3,
SC
are present at mRNA and protein levels in murine 3T3-L1 cells and human adipocytes. SPX inhibits adipogenesis and down-regulates mRNA expression of proadipogenic
NU
genes such as Pparγ, C/ebpα, C/ebpβ and Fabp4. SPX stimulates lipolysis by increasing
MA
the phosphorylation of hormone sensitive lipase (HSL). Simultaneously, SPX inhibits lipogenesis and glucose uptake in human adipocytes and murine 3T3-L1 cells. SPX has no effect on murine 3T3-L1 cell proliferation and viability. Moreover, our research
PT E
D
showed that the SPX effect on adipocytes metabolism is mediated via GALR2 and GALR3 receptors. SPX is a novel regulator of lipid metabolism in murine 3T3-L1 and
AC
CE
human adipocytes.
ACCEPTED MANUSCRIPT 1. Introduction A bioinformatics method based on hidden Markow model screening allowed the discovery of a highly conserved peptide – spexin (SPX, NPQ) – consisting of 14 amino acids [1,2]. SPX arises as a result of post-translational modifications of a prepropeptide, which is composed of 116 amino-acid residues. The amino-acid sequence of SPX is
PT
homological in mice, rats and humans [3]. Structural analysis of the SPX gene showed
RI
that it belongs to the Spexin/Galanin/Kisspeptin gene family. Moreover, it was demonstrated that SPX activates galanin (GAL) receptors type 2 (GALR2) and 3
SC
(GALR3) [4]. In 2010, Porzionato et al. described SPX expression in almost all rat
NU
tissues except: acinar epithelium, spermatogonial cells, spermatocytes, oocytes, lymphatic cells, medullary region of lymph nodes, white pulp of the spleen, glias of the
MA
brain cortex, cerebellum, brainstem, eye cells (photoreceptor layer, outer nuclear layer) and plexiform layers [3]. However, little is yet known about the role of SPX in
D
regulating fat metabolism. Animal studies have shown that SPX inhibits fatty acid (FA)
PT E
uptake in primary adipocytes and hepatocytes, reduces appetite, caloric intake enhances bowel movement [5] and decreases body weight [6,7]. Moreover, SPX inhibits
CE
proliferation of adrenocortical cells [8]. SPX levels are low during oral glucose tolerance tests in patients with type 2 diabetes [9].
AC
Our previous research showed that serum SPX levels negatively correlate with obesity and insulin resistance [10]. In addition, SPX could be an important factor in regulating nociception and reproductive functions. Toll et al. demonstrated in 2012 that a central injection of SPX controlled CNS (Central nervous system) -mediated arterial blood pressure and salt and water balance, and modulated nociceptive responses [11]. Studies conducted in fish also indicate that SPX is involved in the regulation of reproductive functions by affecting the release of LH (Luteinizing hormone) [12,13]. In addition,
ACCEPTED MANUSCRIPT Porzionato et al. suggested that SPX acts in the regulation of hyperoxia [14]. Studies in goldfish have demonstrated that SPX can inhibit basal, neuropeptide Y- and orexinstimulated food consumption [15]. Additionally, Walewski et al. showed that SPX is one of the most down-regulated genes in fat tissue derived from obese humans [6]. Overall, these findings suggest that SPX could be a new regulator of fat tissue
PT
metabolism.
RI
Therefore, we investigate the effects of SPX on proliferation, cell viability, lipogenesis
SC
and lipolysis in murine 3T3-L1 cell adipocytes and/or isolated human adipocytes.
NU
2. Materials and methods
MA
2.1 Ethical approval
This research complied with all the relevant national regulations, institutional policies and is in accordance with the tenets of the Helsinki Declaration and has been accepted
PT E
D
by the authors. Informed consent was obtained from all donors before surgical procedures. The study protocol was approved by the Clinical Research Ethics
2.2 Materials
CE
Committee of Poznan University of Medical Sciences, approval number 935/16.
AC
Antibodies: Anti-Fatty Acid Synthase, anti-HSL, anti-pHSL (Ser552), anti-pHSL (Ser563), anti-pHSL (Ser650), and anti-pHSL (Ser660) antibodies were from Cell Signaling Technology (Beverly, MA, USA). Anti-SPX antibodies were purchased from Phoenix Pharmaceuticals (Karlsruhe, Germany). Anti-GALR2 and anti-GALR3 antibodies were supplied by Abgent (San Diego, CA, USA). Anti-β-actin and all secondary antibodies for Western Blot were from Sigma-Aldrich (Taufkirchen, Germany). Unless otherwise stated, all other reagents were from Sigma-Aldrich. All cell
ACCEPTED MANUSCRIPT culture media and supplements were purchased from Sigma-Aldrich. All reagents used in the experiments with isotopes, such as glucose uptake and lipolysis, were purchased from Perkin Elmer (Norwalk, CT, USA). 2.3 Murine 3T3-L1 cell culture and differentiation procedure
PT
Murine 3T3-L1 fibroblasts (ATCC, LGC Standards, Lomianki, Poland) were maintained in a standard growth medium (DMEM without sodium pyruvate; containing
RI
high glucose (25 mmol/l), L-glutamine (4 mmol/l), 10% [vol./vol.] FCS, 100 kU/l
SC
penicillin and 100 mg/l streptomycin) at 37°C in a humidified atmosphere.
NU
Differentiation of fibroblasts into adipocytes was conducted in accordance with our previously described method [16].
MA
2.4 Isolation of human and mouse adipocytes
D
Isolation of human adipocytes was conducted as described [17]. Tissue specimens of
PT E
white human adipose tissue were obtained during routing surgery from healthy patients who were free of metabolic or endocrine diseases (characteristics of our study participants: sex F/M: 5/5, age range: 46.40 ± 9.34/, 44.20 ± 8.1; BMI 23.3 ± 0.97 /
CE
23.10 ± 1.24). In brief, intraoperatively removed visceral fat pads resected from patients
AC
were transported in PBS buffer to the laboratory. Next, fat pads were cut into small pieces using scissors. Fragmented fat tissue was digested in Krebs – Ringer Hepes buffer (KRBH) (ingredients: 1l8 mM NaCl, 4.8 mM KCl, 1.3 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 24.8 mM NaHCO3) containing 10 mM Hepes, collagenase type II (3 mg/g tissue), 3% BSA and 5 mmol/l glucose for 30 to 45 min at 37°C in a shaking water bath. Then, cells were filtered through a nylon mesh (250 μm) and washed with KRBH (without collagenase). Adipocytes were counted using a Bürker– Türk counter chamber. Each experiment was repeated two or three times. To study the
ACCEPTED MANUSCRIPT localization of SPX, GALR2 and GALR3 mouse visceral adipocytes were isolated from C57BJ/6 mice in analogy to the description above. 2.5 Immunofluorescence staining of SPX in tissues and cells Identification of SPX protein by immunofluorescence in murine 3T3-L1 preadipocytes,
PT
mature murine 3T3-L1 adipocytes and human fat tissue was performed as previously described [18]. In brief, murine 3T3-L1 cells were seeded in 4-chamber tissue culture
RI
slides. murine 3T3-L1 cells were cultured for 24 h (preadipocytes) or differentiated into
SC
mature adipocytes as described [19]. Then, cells were washed in PBS and fixed in 4%
NU
paraformaldehyde in PBS for 10 min. Next, cells were permeabilized in PBS containing 0.1% Triton-100 and then washed 3 times in PBS. Unspecific binding of antibodies was
MA
blocked using 1% BSA and 15 mM glycine solution in PBS for 45 min. Thereafter, cells were incubated with primary anti-SPX antibody in a blocking solution (dilution of the
D
antibody 1:300, Phoenix Pharmaceuticals, USA) [3,12,14,15]. On the next day, cells
PT E
were washed three times in PBS and subsequently incubated with a secondary antirabbit antibody (dilution 1:500 in blocking solution, Life Technologies, Grand Island,
CE
NY, USA,) for 1.5 h in darkness and washed again, as described above. To stain nuclei and lipid droplets, cells were incubated with DAPI (1 μg/ml in PBS) and/or BODIPY
AC
(10 μg/ml in PBS) for 10 min. Cell and tissue slides were photographed at 400 × magnification using a Zeiss Axiovert 510 Meta Confocal Laser Scanning Microscope Fluorescence (Carl Zeiss, Oberkochen, Germany). Immunofluorescence detection of SPX in fat tissue was performed on paraffin embedded tissue. Dissected tissue was rinsed in 0.9% NaCl solution and immersed in Bouin’s solution. After a 24-hour fixation period, tissue samples were dehydrated using increasing concentrations of ethanol (70%–96%), and subsequently embedded in Paraplast® (Sigma-Aldrich). Paraplast® blocks were cut into thin sections of 4.5–5 µm. Next, slides with sections
ACCEPTED MANUSCRIPT were heated (58°C) in a laboratory oven for 45 min, deparaffinized in xylene for 30 min and rehydrated using gradient ethanol in water. For antigen retrieval, sections were heated in a citrate buffer (pH 6.0) for 10 min at 95°C in a microwave oven. After cooling to room temperature, non-specific antibody binding to proteins in sections was blocked using a blocking solution containing 0.2% gelatin and 15 mM glycine. The
PT
sections were then incubated with antibodies and photographed as described above for
RI
murine 3T3-L1-cells.
SC
2.6 Proliferation assay
NU
Murine 3T3-L1 cells were seeded into 96-well plates (2 × 103 cells/well) and cultured for 24 hours. Next, cells were incubated in serum-free DMEM supplemented
MA
with 0.5% BSA for 12 h and then treated with SPX (1.0, 10, 100, 1,000 nM) or 10% FCS (positive control) for a further 24 h. Cell proliferation was measured by evaluation
D
of the incorporation of bromodeoxyuridine (BrdU) into the newly synthesized DNA of
PT E
replicating cells. BrdU solution (10 µM) was added after 21 h and cells were incubated for 3 h. BrdU incorporation was measured using a commercially available Cell
CE
Proliferation ELISA BrdU colorimetric kit (Roche Diagnostics, Penzberg, Germany).
AC
2.7 Cell viability
Cells were seeded and cultured as described above. The viability of cells was studied using an MTT assay. After 24 h incubation, cells were treated with MTT solution (0.5 mg/ml) for 1 h. Next, the incubation solution was removed and blue formazan crystals were dissolved in 100 µl DMSO. The optical density of samples was measured at 570 nm (reference wavelength: 650 nm) on a Synergy 2 microplate reader (BioTek Instruments, Winooski, VT, USA). 2.8 Glucose uptake
ACCEPTED MANUSCRIPT Twelve-well plates containing mature murine 3T3-L1 cells were incubated for 6 h in serum-free DMEM and washed in PBS. Then, cells were incubated in glucose-free KRB supplemented with 0.1% BSA for 30 min. Cells were washed with PBS. Then, cells were incubated with different concentrations of test peptides or cytochalasin B (negative control) in KRB buffer. Subsequently, 18.5 kBq of 2-deoxy-D-[2,6-
PT
C12]glucose and 0.1 mmol/l 2-deoxyglucose was added. After 5 min, incubation was
RI
stopped using ice-cold PBS with 20 μmol/l of cytochalasin B. Murine 3T3-L1 cells
SC
were lysed using 0.1% SDS. Cell lysates were divided into two aliquots. One was used for liquid scintillation and the second for protein content determination using a BSA
NU
assay. Results were normalized to total protein content. 2.9 Lipogenesis
MA
Incorporation of [U-14C] glucose (PerkinElmer, Massachusetts, USA) into lipids was performed to measure lipogenesis. Murine 3T3-L1 adipocytes, seeded in 24-well plates,
PT E
D
were starved for 6 h in serum-free DMEM. Cells were then preincubated with SPX (10, 100, 1,000 nM) in DMEM supplemented with 2% fatty acid-free BSA in the presence or absence of 500 nM insulin for 2 h. Medium was then removed, cells were lysed using
CE
0.1% SDS and the lysates were divided into two aliquots. One aliquot was used to
AC
determine the lipogenesis, as follows: using Dole’s extraction method [20], the lipid fraction was separated from the cells and the lipid-containing phase was transferred into scintillation liquid for counting of β-radiation. The second aliquot was assigned to determine protein content. Results were normalized to total protein content. Similarly, isolated human adipocytes were incubated with test agents in KRB medium supplemented with [U-14C] glucose for 2 h. The incubation was terminated by adding Dole’s extraction mixture. Separation of the lipid phase was performed by adding H2O and heptane. Then, the lipid fraction was transferred into a scintillation liquid for
ACCEPTED MANUSCRIPT counting of incorporated radioactivity using a β-counter. Results are shown as the percentage of the basal (set to 100%) incorporation of 14C into NEFA. 2.10 Lipolysis After 10 days of differentiation, murine 3T3-L1 adipocytes were incubated in serum-
PT
free DMEM for 6 hours in 24-well plates. Next, these mature adipocytes were treated with different concentrations of SPX (1.0, 10, 100, 1,000 nM), or isoproterenol (ISO; 10
RI
µM), as a positive control. Lipolysis was determined by quantifying the amounts of
SC
glycerol released into the incubation medium using Free Glycerol Reagent (Sigma
NU
Aldrich, Germany).
Isolated human adipocytes were incubated with SPX in KRB for 2 h or 6 h. Then, the
D
2.11 Oil Red O (ORO) staining
MA
glycerol concentration in the incubation medium was determined.
2.12 Real Time PCR
PT E
Oil Red O staining was conducted as previously described [21].
CE
Total RNA was extracted using Tripure Reagent (Roche Diagnostics, Germany). cDNA was generated from 1 µg of Total RNA using High-Capacity cDNA Reverse
AC
Transcription according to the manufacturer’s protocol (Life Technologies, Grand Island, NY, USA). Real-Time PCR was performed using QuantStudio 12K Flex™ Real-Time PCR and Fast SYBR Green Master Mix (Life Technologies). The primers for Real-Time were designed using primer blast or Roche assay design center (Table 1). Relative gene expression was evaluated by Delta Delta CT (ΔΔCT) with Gapdh as a reference. 2.13 Western blot
ACCEPTED MANUSCRIPT Western blot analysis was performed as previously described [22].
2.14 Statistical analysis The results are presented as the arithmetic mean ± SEM (Graph Pad Prism, GraphPad Software, Inc., USA). Statistical analysis was performed using One Way ANOVA
PT
followed by Dunnett’s post hoc. For the two-tailed test or unpaired Student’s t test (two-
SC
RI
tailed distribution), statistical significance was defined as *p < 0.05, or **p < 0.01.
3. Results
NU
3.1 SPX, GALR2 and GALR3 are expressed in murine 3T3-L1 and isolated human adipocytes
MA
mRNA of SPX (Fig. 1c), GALR2 and GALR3 (Fig. 1a) were detected in preadipocytes, mature murine 3T3-L1 adipocytes and primary human and murine adipocytes. We also
D
detected GALR2 and GALR3 protein production in all tested adipocytes and
PT E
preadipocytes. (Fig. 1b). GALR3 antibodies were recognized two bands as Western blots, which correspond to glycosylated and non-glycosylated receptors [23]. SPX
CE
proteins were also found in murine 3T3-L1 preadipocytes, differentiated mature murine 3T3-L1 adipocytes and human fat tissue by using immunofluorescence technique. SPX
AC
proteins were observed in murine 3T3-L1 preadipocytes as well as in differentiated mature adipocytes. Additionally, SPX was detected in human visceral fat tissue sections (Fig. 1d). 3.2 Effects of SPX on murine 3T3-L1 cell proliferation and viability The adipogenesis process includes proliferation and differentiation of fat cells. SPX can inhibit proliferation of adrenocortical cells [8]. Therefore, we tested the ability of SPX
ACCEPTED MANUSCRIPT to regulate proliferation and viability in fat cells. SPX failed to affect murine 3T3-L1 cell proliferation and viability (Fig. 2a-b). 3.3 SPX reduces the differentiation of murine 3T3-L1 fibroblasts into mature adipocytes Next, we tested the ability of SPX to regulate the differentiation of murine 3T3-L1 into
PT
mature adipocytes. Initially, we tested the effect of SPX on triglyceride (TG)
RI
accumulation after 3, 7, 10 and 14 days of differentiation. In the early stage of differentiation (day 3), SPX only reduced TG accumulation at 100 nM (Fig. 3a). After 7
SC
days of differentiation SPX at all tested doses (1-1,000 nM), intracellular TG content
NU
decreased (Fig. 3b). After 10 and 14 days of differentiation, SPX reduced TG content at 10 nM (p < 0.05) and 100 nM (p < 0.01) (Fig. 3c-d). Representative images (ORO
MA
staining) of murine 3T3-L1 cells differentiated with or without SPX for ten days (middle panel).
D
3.4 SPX down-regulates Pparγ, C/ebpα, C/ebpβ, and Fabp4 expression
PT E
SPX at 100 nM down-regulated the expression of Pparγ, C/ebpα, and C/ebpβ mRNA (p < 0.01) (Fig. 3e, f, g) on day 3. Moreover, SPX at 1,000 nM reduced C/ebpα and β (p <
CE
0.05), and Pparγ (p < 0.01) mRNA expression. Furthermore, SPX at 10 (p < 0.05), 100
3h).
AC
(p < 0.01), and 1,000 nM (p < 0.01) down-regulated mRNA expression of Fabp4 (Fig.
3.5 SPX stimulates lipolysis SPX at 10 (p < 0.01) and 100 nM (p < 0.01) stimulated lipolysis of murine 3T3-L1 adipocytes after 120 min. After 360 min, lipolysis increased in the presence of 100 nM (p < 0.01) and 1,000 nM (p < 0.01) SPX (Fig. 4a, b). Experiments performed on human adipocytes confirmed the results obtained with murine 3T3-L1 adipocytes. SPX at 1.0, 10, and 1,000 nM (p < 0.05) and 100 nM; (p < 0.01) increased lipolysis after 120 min.
ACCEPTED MANUSCRIPT After 360 min, SPX increased lipolysis at 1.0 (p < 0.05), 100 (p < 0.01) and 1,000 nM (p < 0.01). These effects were associated with increased phosphorylation of hormonesensitive lipase (pHSL). We observed an up-regulation of Ser563 and Ser 660 HSL phosphorylation after treatment of murine 3T3-L1 cell with almost all SPX doses except 1,000 nM. SPX at 1.0, 10 and 100 nM (p < 0.01) increased HSL phosphorylation in
PT
murine 3T3-L1 cells. Additionally, Ser 552 phosphorylation increased in isolated
RI
human adipocytes exposed to 1.0 nM (p < 0.05), 10 nM (p < 0.01) and 100 nM (p <
SC
0.01) SPX, while Ser650 phosphorylation increased in cells exposed to 1 nM (p < 0.01), 10 nM (p < 0.05), 100 nM (p < 0.01) and 1,000 nM (p < 0.001) SPX. As expected,
NU
isoproterenol, when used as a positive control, stimulated HSL phosphorylation.
MA
3.6 SPX decreases lipogenesis and glucose uptake in isolated human adipocytes and murine 3T3-L1 cell lines
D
Next, we tested whether SPX can modify lipogenesis and glucose uptake. Basal
PT E
lipogenesis decreased in murine 3T3-L1 cells and isolated human adipocytes incubated with SPX at 1.0 nM (p < 0.05), 10 nM (p < 0.05), 100 nM (p < 0.01) and 1,000 nM (p <
CE
0.01) (Fig. 5a, c). Apart from 1.0 nM, all tested SPX doses inhibited insulin-stimulated lipogenesis in murine 3T3-L1 adipocytes (Fig. 5a).
AC
Next, we tested the role of SPX in regulating basal and insulin-stimulated glucose uptake in murine 3T3-L1 as well as in human adipocytes. Based on previous results (lipolysis and lipogenesis), we decided to use the most effective dose of 100 nM SPX in this part of the experiments. SPX decreased basal glucose uptake in murine 3T3L1 adipocytes (p < 0.01) as well as in isolated human adipocytes (p < 0.05) (Fig. 5b, d). Additionally, SPX attenuated insulin-stimulated glucose uptake in murine and human adipocytes (p < 0.01) (Fig. 5b, d).
ACCEPTED MANUSCRIPT Fatty acid synthase (FAS) is involved in the regulation of lipogenesis in adipocytes [24]. Therefore, we investigated the effects of SPX on the mRNA and protein production of FAS in murine 3T3-L1 adipocytes and on FAS mRNA expression in human adipocytes. SPX at 1.0, 10, 100 and 1,000 nM decreased mRNA expression as well as the protein production of FAS in murine 3T3-L1 adipocytes (Fig. 5e, f). In
PT
isolated human adipocytes, SPX at all tested levels except for 1.0 nM, down-regulated
RI
FAS mRNA expression.
SC
3.6 SPX modulates adipocyte function via GALR2 and GALR3 receptors
NU
To confirm the role of GALR2 and GALR3 in conferring the effects of SPX on lipolysis in murine 3T3-L1 adipocytes, we used specific and selective antagonists – M871 for
MA
GALR2 and SNAP37899 for GALR3 – as well as non-selective GALRs antagonists: M40. Based on previous experiments, we chose 100 nM SPX as the most potent dose.
D
Concentrations of antagonists were chosen based on the literature: M871 – 0.05 µM,
PT E
SNAP37899 – 5 µM, M40 – 1 µM. After 30 min pre-incubation with specific antagonists, i.e. M871 and SNAP37899, the effect of SPX on lipolysis was still
CE
detectable (p < 0.05). However, the stimulation of this process was less potent compared to the effect of SPX in cells incubated without antagonists (p < 0.01) after
AC
120 and 360 min (Fig. 6a, b, c, d). When both antagonists, i.e. M871 and SNAP37899, were used together (Fig. 6 e, f) or in the presence of M40 alone (Fig. 6 g, h), the stimulatory effect of SPX was completely abolished. 4. DISCUSSION In the present study, we showed for the first time that SPX decreases adipogenesis, regulates adipogenic genes, increases lipolysis as well as decreases lipogenesis and glucose uptake in murine 3T3-L1 adipocytes as well as in isolated human visceral
ACCEPTED MANUSCRIPT adipocytes. Moreover, SPX enhances HSL phosphorylation and inhibits FAS mRNA expression, and FAS protein production. Additionally, we showed that SPX mRNA and protein are present in human fat tissue. Moreover, using isolated human adipocytes, we confirmed our observations in murine 3T3-L1 adipocytes. Overall, we showed that SPX decreases lipogenesis as well as glucose uptake in isolated human adipocytes.
PT
Moreover, we found that SPX increases lipolysis and enhances HSL phosphorylation.
RI
These results suggest that SPX regulates fat tissue metabolism in murine 3T3-L1
SC
adipocytes and human adipocytes.
In 2014, Kim et al. showed that SPX activates GALR2 and GALR3 but not GALR1 [4].
NU
However, the impact of SPX on the expression and protein levels of these receptors has
MA
not so far been investigated. We found that both receptors, GALR2 and GALR3, are expressed in undifferentiated murine 3T3-L1 cells and mature murine 3T3-L1 adipocytes as well as in isolated murine and human adipocytes, and in human and
PT E
D
murine fat tissues. These findings confirm previous results reported by Kim et al. which showed that GALR2 and GALR3 are expressed in murine 3T3-L1 cell lines and in
CE
visceral and subcutaneous mouse fat tissue [25]. Additionally, previous studies have demonstrated that GALR2 mRNA is
AC
expressed in various human tissues, including adipose tissue, the pancreas, colon, and small intestine [6,26]. We report here for the first time the presence of GALR2 and GALR3 mRNA and protein in isolated human adipocytes and visceral fat tissue. We found an expression of GALR3 protein in all investigated cells and tissues: human adipocytes and fat tissue, isolated mouse adipocytes and adipose tissue as well as murine 3T3-L1 preadipocytes and murine 3T3-L1 adipocytes. In 1998, Kolakowski et al. showed that GALR3 is expressed in several human tissues, for example the testis, brain, skeletal muscle, pancreas, small intestine, large intestine, rectum, and placenta
ACCEPTED MANUSCRIPT [26]. Walewski et al. reported that GALR3 mRNA is highly expressed in mouse small intestine, adipose tissue and in the liver. Here, we showed that GALR2 as well as GALR3 are expressed on the mRNA and protein level in human adipocytes, human fat tissue as well as in the murine 3T3-L1 cell line and isolated mouse adipocytes, and fat tissue. Using the immunofluorescence technique, we showed that SPX protein is
PT
produced in murine 3T3-L1 preadipocytes and murine 3T3-L1 adipocytes as well as in
SC
method because of the small molecular weight of SPX.
RI
human visceral fat tissue. We decided to utilize the immunofluorescence-detection
The co-localization of SPX and GALR2/3 expression as well as the effect of
NU
SPX on murine 3T3-L1 and isolated human adipocytes suggest an autocrine/paracrine
MA
mode of action for SPX. Previous studies have shown that GALR2 and GALR3 are expressed in the brain and gastrointestinal tract [27–29]. SPX is expressed and modulates the function of these tissues by enhancing bowel movements and inhibiting
PT E
D
food intake [3,6,30,31]. Moreover, others have shown that other neuropeptides belong to this family such as galanin, kisspeptin, neuropeptide Y, VIP, PACAP [32–35]. Additionally, Ma et al. reported that insulin acts as an autocrine/paracrine signal to
CE
trigger SPX mRNA expression in the liver and it acts as an endocrine modulator of SPX
AC
expression in the brain in fishes [36]. These results indicate that SPX may act via endocrine and autocrine/paracrine mechanisms to regulate metabolism. SPX inhibits proliferation of adrenocortical cells [8]. Moreover, galanin, a natural agonist of GALR 1-3 receptors, can suppress cancer cell proliferation [37,38]. However, we did not observe any effect of SPX on the proliferation and viability of murine 3T3-L1 cells. The differences between our results compared to those in the published literature may be due to the different types of cells or receptor isoforms. Cancer cells, for example squamous carcinoma cells or mutant head and neck cancer
ACCEPTED MANUSCRIPT cells, are highly proliferative compared to murine 3T3-L1. Moreover, as previously described, the biological activity of SPX is mediated via GALR2 and GALR3. Depending on the binding to either one or other isoform of the receptor, SPX can activate various intracellular pathways; however, this requires further research.
PT
Mouse studies have demonstrated that SPX reduces food intake and body weight by inhibiting long chain FA uptake in isolated adipocytes and hepatocytes [6,7].
RI
Moreover, these animal studies have shown that SPX is one of the most down-regulated
SC
genes in obese humans and mice [6]. In agreement with these observations, our results indicate that SPX plays a role as an antiobesity agent by inhibiting glucose uptake and
NU
lipogenesis in human and murine 3T3-L1 adipocytes. Studies performed in patients with
MA
T2DM have shown that SPX is down-regulated during glucose tolerance tests [9]. Reduced levels of SPX after glucose tolerance tests in T2DM patients could reflect a defense mechanism. As a potent stimulator of lipolysis, SPX can be down-regulated
PT E
D
during positive energy homeostasis (defined as an increased availability of energy suppliers such as glucose or lipids) which may explain decreased SPX levels in blood
CE
serum.
Phosphorylation of HSL is a crucial step required for lipolysis [39]. Therefore, we
AC
investigated the effects of SPX on the lipolysis. We observed that SPX stimulates HSL phosphorylation which is associated with increased lipolysis in murine 3T3-L1 cells as well as in isolated human adipocytes. Moreover, we found that the presence of SPX in the differentiation medium reduces intracellular TG accumulation. Inhibitory effects on adipogenesis are also reflected in the down-regulation of several surrogate molecular parameters of adipocyte differentiation, such as PPARγ, CEBP/α, CEBP/β and FABP4 [40].
ACCEPTED MANUSCRIPT Another important process in the context of adipogenesis is lipogenesis. An increase in lipogenesis contributes to the pathophysiology of obesity [41]. In our current study, we demonstrated that SPX decreases lipogenesis as well as glucose uptake by murine 3T3-L1 and isolated human adipocytes.
PT
Previous studies have shown that SPX down-regulates food intake which suggests an anorexigenic activity of this peptide [6]. Many peptides and hormones classified as
RI
anorexigenic, for example leptin, decrease lipogenesis and glucose uptake by adipocytes
SC
in vitro [42,43]. We showed that SPX inhibits lipogenesis and glucose uptake by adipocytes in vitro. Additionally, SPX down-regulated FAS mRNA expression and
NU
protein production during the differentiation of murine 3T3-L1 cells into mature adipocytes. The role of SPX in the regulation of fat cell metabolism seems to be
MA
opposite to galanin – another GALR2 and GALR3 agonist. In a diet-induced obesity (DIO) mouse model, the GAL-mediated signaling cascade is affected in adipose tissue.
PT E
D
This study demonstrated that DIO up-regulates GALR expression and there is a possible association of the GAL-mediated signaling pathways in the HFD-induced activation of adipogenesis along with a suppression of thermogenesis, which suggests a
CE
proadipogenic role for galanin [25]. These discoveries have been confirmed using mice
AC
with chronically increased levels of circulating GAL, which led to reduced energy expenditure, insulin resistance, increased body weight and development on nonalcoholic fatty liver disease – NAFLD [44]. Moreover, serum GAL levels increased during obesity, which is in opposition to SPX levels [45]. In contrast, experiments performed in diabetic as well as healthy rats have shown that endogenous GAL reduces insulin resistance by increasing GLUT4 contents and promoting GLUT4 transportation from intracellular membranes to plasma membranes in adipocytes as well as in muscle cells [46]. Although GAL and SPX are natural agonists of GALR2 and GALR3
ACCEPTED MANUSCRIPT receptors and results suggest an opposite role for both peptides, limited knowledge of this phenomenon does not allow a clear statement of this activity. More studies are needed to explore this phenomenon. An important limitation of our study is the lack of identification of intracellular
PT
pathways conferring the effects of SPX on various cellular functions. However, previous studies conducted on fish have shown that insulin is involved in the regulation
RI
of SPX expression [36]. Moreover, GALR2 plays a role in regulating anxiety,
SC
depression and appetite. Additionally, SPX is a potent agonist of GALR2 [6]. ReyesAlcaraz et al. found that SPX-based human galanin receptor type II-specific agonists
NU
with increased biological stability are anxiolytic in mice [47]. We, therefore, plan to
MA
investigate the effects of SPX on adipokine secretion and identify molecular pathways to further explain our current findings.
D
In summary, we have shown that SPX, GALR2 and GALR3 are expressed in murine
PT E
3T3-L1 adipocytes as well as in human fat tissue. SPX controls differentiation of murine 3T3-L1 preadipocytes into mature adipocytes and this is accompanied by down-
CE
regulation of the expression of proadipogenic genes such as Pparγ, C/ebpα, C/ebpβ and Fabp4. Moreover, we showed that SPX increases lipolysis by enhancing HSL
AC
phosphorylation and decreasing glucose uptake as well as lipogenesis in murine 3T3-L1 adipocytes and isolated human adipocytes. These findings render SPX a novel anorexigenic factor with possible pathophysiological or therapeutic potential in fighting obesity. Acknowledgements
ACCEPTED MANUSCRIPT Funding: This work was supported by the National Science Centre, Poland 2015/19/N/NZ4/00572 PRELUDIUM grant. M.Z.S. was supported by the Deutsche Forschungsgemeinschaft and Deutsche Diabetes Stiftung. Author contributions
PT
PAK. designed the study, obtained the data and wrote the manuscript. EPO., contributed to the study design, experiment performing, edited, supported and critically revised the
RI
manuscript and contributed to the discussion. TW., KS., MM., PS., researched data.
SC
MZS., KWN., MS. edited, supported and critically revised the manuscript and
NU
contributed to the discussion. All authors have given final approval to the current version to be published.
MA
Conflict of interest
D
The authors declare that they have no competing interests.
PT E
References
O. Mirabeau, E. Perlas, C. Severini, E. Audero, O. Gascuel, R. Possenti, E. Birney, N. Rosenthal, C. Gross, Identification of novel peptide hormones in the human proteome by hidden Markov model screening, Genome Res. 17 (2007) 320–327. doi:10.1101/gr.5755407.320.
[2]
K. Sonmez, N.T. Zaveri, I. a. Kerman, S. Burke, C.R. Neal, X. Xie, S.J. Watson, L. Toll, Evolutionary sequence modeling for discovery of peptide hormones, PLoS Comput. Biol. 5 (2009). doi:10.1371/journal.pcbi.1000258.
[3]
A. Porzionato, M. Rucinski, V. Macchi, C. Stecco, L.K. Malendowicz, R. De Caro, Spexin expression in normal rat tissues., J. Histochem. Cytochem. 58 (2010) 825–837. doi:10.1369/jhc.2010.956300.
[4]
D.K. Kim, S. Yun, G.H. Son, J.I. Hwang, C.R. Park, J. Il Kim, K. Kim, H. Vaudry, J.Y. Seong, Coevolution of the spexin/galanin/kisspeptin family: Spexin activates galanin receptor type II and III, Endocrinology. 155 (2014) 1864–1873. doi:10.1210/en.2013-2106.
[5]
C. Lin, M. Zhang, T. Huang, L. Yang, H. Fu, L. Zhao, L.L. Zhong, H. Mu, X. Shi, C.F. Leung, B. Fan, M. Jiang, A. Lu, L. Zhu, Z. Bian, Spexin Enhances Bowel Movement through Activating L-type Voltage-dependent Calcium
AC
CE
[1]
ACCEPTED MANUSCRIPT Channel via Galanin Receptor 2 in Mice, Sci. Rep. 5 (2015) 12095. doi:10.1038/srep12095. J.L. Walewski, F. Ge, H. Lobdell, N. Levin, G.J. Schwartz, J.R. Vasselli, A. Pomp, G. Dakin, P.D. Berk, Spexin is a novel human peptide that reduces adipocyte uptake of long chain fatty acids and causes weight loss in rodents with diet-induced obesity, Obesity. 22 (2014) 1643–1652. doi:10.1002/oby.20725.
[7]
G. Jasmine, J. Walewski, D. Anglade, P. Berk, Regulation of Hepatocellular Fatty Acid Uptake in Mouse Models of Fatty Liver Disease with and without Functional Leptin Signaling: Roles of NfKB and SREBP-1C and the Effects of Spexin, Semin. Liver Dis. 36 (2016) 360–372. doi:10.1055/s-0036-1597248.
[8]
M. Rucinski, A. Porzionato, A. Ziolkowska, M. Szyszka, V. Macchi, R. De Caro, L.K. Malendowicz, Expression of the spexin gene in the rat adrenal gland and evidences suggesting that spexin inhibits adrenocortical cell proliferation, Peptides. 31 (2010) 676–682. doi:10.1016/j.peptides.2009.12.025.
[9]
L. Gu, Y. Ma, M. Gu, Y. Zhang, S. Yan, N. Li, Y. Wang, X. Ding, J. Yin, N. Fan, Y. Peng, Spexin peptide is expressed in human endocrine and epithelial tissues and reduced after glucose load in type 2 diabetes, Peptides. (2015). doi:10.1016/j.peptides.2015.07.018.
NU
SC
RI
PT
[6]
D
MA
[10] P.A. Kolodziejski, E. Pruszynska-Oszmalek, E. Korek, M. Sassek, D. Szczepankiewicz, P. Kaczmarek, L. Nogowski, P. Mackowiak, K.W. Nowak, H. Krauss, M.Z. Strowski, Serum Levels of Spexin and Kisspeptin Negatively Correlate With Obesity and Insulin Resistance in Women, Physiol. Res. 67 (2018) 45–56.
PT E
[11] L. Toll, T. V Khroyan, K. Sonmez, A. Ozawa, I. Lindberg, J.P. Mclaughlin, S.O. Eans, A.A. Shahien, D.R. Kapusta, Peptides derived from the prohormone proNPQ / spexin are potent central modulators of cardiovascular and renal function and nociception, FASEB J. 26 (2012) 947–954. doi:10.1096/fj.11192831.
AC
CE
[12] Y. Liu, S. Li, X. Qi, W. Zhou, X. Liu, H. Lin, Y. Zhang, C.H.K. Cheng, A novel neuropeptide in suppressing luteinizing hormone release in goldfish, Carassius auratus, Mol. Cell. Endocrinol. 374 (2013) 65–72. doi:10.1016/j.mce.2013.04.008. [13] A. Ma, J. Bai, M. He, A.O.L. Wong, Spexin as a neuroendocrine signal with emerging functions, Gen. Comp. Endocrinol. (2018) 1–7. doi:10.1016/j.ygcen.2018.01.015. [14] A. Porzionato, M. Rucinski, V. Macchi, C. Stecco, G. Sarasin, M.M. Sfriso, C. Di Giulio, L.K. Malendowicz, R. De Caro, Spexin Is Expressed in the Carotid Body and Is Upregulated by Postnatal Hyperoxia Exposure, Adv. Exp. Med. Biol. 758 (2012) 207–13. [15] M.K.H. Wong, K.H. Sze, T. Chen, C.K. Cho, H.C.H. Law, I.K. Chu, a. O.L. Wong, Goldfish spexin: solution structure and novel function as a satiety factor in feeding control, AJP Endocrinol. Metab. 305 (2013) E348–E366. doi:10.1152/ajpendo.00141.2013.
ACCEPTED MANUSCRIPT [16] E. Pruszynska-Oszmalek, D. Szczepankiewicz, I. Hertig, M. Skrzypski, M. Sassek, P. Kaczmarek, P.A. Kolodziejski, P. Mackowiak, K.W. Nowak, M.Z. Strowski, T. Wojciechowicz, Obestatin inhibits lipogenesis and glucose uptake in isolated primary rat adipocytes., J. Biol. Regul. Homeost. Agents. 27 (2013) 23– 33. [17] M. Rodbell, Metabolism of isolated fat cells. 1. Effects of hormones on glucose metabolism and lipolysis, J. Biol. Chem. 239 (1964) 375–380.
RI
PT
[18] M. Skrzypski, N. Khajavi, S. Mergler, D. Szczepankiewicz, P.A. Kolodziejski, D. Metzke, T. Wojciechowicz, M. Billert, K. Nowak, M. Strowski, TRPV6 channel modulates proliferation of insulin secreting INS-1E beta cell line, Biochim. Biophys. Acta - Mol. Cell Res. 1853 (2015) 3202–3210. doi:10.1016/j.bbamcr.2015.09.012.
SC
[19] E. Pruszynska-Oszmalek, P.A. Kolodziejski, M. Sassek, J.H. Sliwowska, Kisspeptin-10 inhibits proliferation and regulates lipolysis and lipogenesis processes in 3T3-L1 cells and isolated rat adipocytes, Endocrine. 56 (2017) 54– 64. doi:10.1007/s12020-017-1248-y.
NU
[20] V.P. Dole, H. Meinertz, Microdetermination of Long-chain Fatty Acids in Plasma and Tissues, J. Biol. Chem. 235 (1960) 2595–2599. http://www.jbc.org.
D
MA
[21] T. Wojciechowicz, M. Skrzypski, P.A. Koodziejski, D. Szczepankiewicz, E. Pruszyskaoszmaek, P. Kaczmarek, M.Z. Strowski, K.W. Nowak, Obestatin stimulates differentiation and regulates lipolysis and leptin secretion in rat preadipocytes, Mol. Med. Rep. 12 (2015) 8169–8175. doi:10.3892/mmr.2015.4470.
PT E
[22] P.A. Kołodziejski, E. Pruszyńska-Oszmałek, M.Z. Strowski, K.W. Nowak, Longterm obestatin treatment of mice type 2 diabetes increases insulin sensitivity and improves liver function, Endocrine. 56 (2017) 538–550. doi:10.1007/s12020017-1309-2.
CE
[23] J.J. Hawes, M.R. Picciotto, GalR3 Immunoreactivity in Catecholaminergic Nuclei of the Mouse Brain, J. Comp. Neurol. 423 (2004) 410–423. doi:10.1002/cne.20329.
AC
[24] Y. Wang, B.J. Voy, S. Urs, S. Kim, M. Soltani-bejnood, N. Quigley, Y. Heo, M. Standridge, B. Andersen, M. Dhar, R. Joshi, P. Wortman, J.W. Taylor, J. Chun, M. Leuze, K. Claycombe, A.M. Saxton, N. Moustaid-moussa, Nutrient-Gene Interactions The Human Fatty Acid Synthase Gene and De Novo Lipogenesis Are Coordinately Regulated in Human Adipose Tissue, J. Nutr. (2004) 1032– 1038. [25] A. Kim, T. Park, Diet-induced obesity regulates the galanin-mediated signaling cascade in the adipose tissue of mice, Mol. Nutr. Food Res. 54 (2010) 1361– 1370. doi:10.1002/mnfr.200900317. [26] L.F. Kolakowski, G.P.O. Neill, A.D. Howard, S.R. Broussard, A. Sullivan, D. Feighner, T. Nguyen, S. Kargman, L. Hreniuk, P. Tan, J. Evans, M. Abramovitz, A. Chateauneuf, N. Coulombe, G. Ng, M.P. Johnson, A. Tharian, H. Khoshbouei, S. George, I.G. Smith, B.F. O’Dowd, Molecular Characterization and Expression
ACCEPTED MANUSCRIPT of Cloned Human Galanin Receptors GALR2 and GALR3, J. Neurochem. 71 (1998) 2239–2251. [27] X. Lu, A. Mazarati, P. Sanna, S. Shinmei, T. Bartfai, Distribution and differential regulation of galanin receptor subtypes in rat brain: Effects of seizure activity, Neuropeptides. 39 (2005) 147–152. doi:10.1016/j.npep.2004.12.011. [28] G. Barreda-Gómez, M.T. Giralt, R. Rodríguez-Puertas, G protein-coupled galanin receptor distribution in the rat central nervous system, Neuropeptides. 39 (2005) 153–156. doi:10.1016/j.npep.2004.12.014.
RI
PT
[29] L. Anselmi, S.L. Stella, A. Lakhter, A. Hirano, M. Tonini, Catia Sternini, Galanin receptors in the rat gastrointestinal tract, Neuropeptides. 39 (2005) 349– 352. doi:10.1016/j.npep.2004.12.023.
SC
[30] C. Lin, M. Zhang, T. Huang, L. Yang, H. Fu, L. Zhao, Spexin Enhances Bowel Movement through Activating L-type Voltage- dependent Calcium Channel via Galanin Receptor 2 in Mice, Nat. Publ. Gr. (2015) 1–12. doi:10.1038/srep12095.
NU
[31] A. Pałasz, M. Janas-Kozik, A. Borrow, O. Arias-Carrión, J.J. Worthington, The potential role of the novel hypothalamic neuropeptides nesfatin-1, phoenixin, spexin and kisspeptin in the pathogenesis of anxiety and anorexia nervosa, Neurochem. Int. 113 (2018) 120–136. doi:10.1016/j.neuint.2017.12.006.
D
MA
[32] A. Berger, R. Santic, C. Hauser-Kronberger, F.H. Schilling, P. Kogner, M. Ratschek, A. Gamper, N. Jones, W. Sperl, B. Kofler, Galanin and galanin receptors in human cancers, Neuropeptides. 39 (2005) 353–359. doi:10.1016/j.npep.2004.12.016.
PT E
[33] G.G. Nussdorfer, L.K. Malendowicz, Role of VIP, PACAP, and related peptides in the regulation of the hypothalamo-pituitary-adrenal axis, Peptides. 19 (1998) 1443–1467. doi:10.1016/S0196-9781(98)00102-8.
CE
[34] G.G. Nussdorfer, G. Gottardo, Neuropeptide-Y family of peptides in the autocrine-paracrine regulation of adrenocortical function, Horm. Metab. Res. 30 (1998) 368–373. doi:10.1055/s-2007-978900.
AC
[35] Y. Uenoyama, V. Pheng, H. Tsukamura, K. Maeda, The roles of kisspeptin revisited: inside and outside the hypothalamus, J. Reprod. Dev. 62 (2016) 537– 545. doi:10.1262/jrd.2016-083. [36] A. Ma, M. He, J. Bai, M.K.H. Wong, W.K.W. Ko, A.O.L. Wong, Dual role of insulin in Spexin regulation: Functional link between food intake and Spexin expression in a fish model, Endocrinology. 158 (2017) 560–577. doi:10.1210/en.2016-1534. [37] T. Kanazawa, P.K. Kommareddi, T. Iwashita, K. Bhavna, K. Misawa, Y. Misawa, I. Jang, T.S. Nair, Y. Iino, T.E. Carey, Galanin Receptor Subtype 2 Suppresses Cell Proliferation and Induces Apoptosis in p53 Mutant Head and Neck Cancer Cells, Clin. Cancer Res. 15 (2009) 2222–2230. doi:10.1158/10780432.CCR-08-2443.Galanin. [38] T. Kanazawa, T. Iwashita, P. Kommareddi, T. Nair, K. Misawa, Y. Misawa, Y. Ueda, T. Tono, T.E. Carey, Galanin and galanin receptor type 1 suppress
ACCEPTED MANUSCRIPT proliferation in squamous carcinoma cells: activation of the extracellular signal regulated kinase pathway and induction of cyclin-dependent kinase inhibitors, Oncogene. 26 (2007) 5762–5771. doi:10.1038/sj.onc.1210384. [39] R.E. Duncan, M. Ahmadian, K. Jaworski, E. Sarkadi-Nagy, H.S. Sul, Regulation of lipolysis in adipocytes., Annu. Rev. Nutr. 27 (2007) 79–101. doi:10.1146/annurev.nutr.27.061406.093734. [40] J.M. Ntambi, Y. Kim, Adipocyte Differentiation and Gene Expression, J. Nutr. 130 (2000) 3122–3126.
RI
PT
[41] M.S. Strable, J.M. Ntambi, Genetic control of de novo lipogenesis: role in dietinduced obesity, Crit. Rev. Biochem. Mol. Biol. 45 (2010) 199–214. doi:10.3109/10409231003667500.Genetic.
SC
[42] M. Ho, S. Foxall, M. Higginbottom, D.M. Donofrio, J. Liao, P.J. Richardson, Y.P. Maneuf, Leptin-mediated inhibition of the insulin-stimulated increase in fatty acid uptake in differentiated 3T3-L1 adipocytes, Metabolism. 55 (2006) 8– 12. doi:10.1016/j.metabol.2005.06.013.
MA
NU
[43] C. Buettner, E.D. Muse, A. Cheng, L. Chen, A. Pocai, K. Su, B. Cheng, X. Li, J. Harvey-, G.J. Schwartz, G. Kunos, L. Rossetti, Leptin controls adipose tissue lipogenesis via central, STAT3– independent mechanisms, Nat. Med. 14 (2009) 667–675. doi:10.1038/nm1775.Leptin.
D
[44] N.J. Poritsanos, T.M. Mizuno, M.E. Lautatzis, M. Vrontakis, Chronic increase of circulating galanin levels induces obesity and marked alterations in lipid metabolism similar to metabolic syndrome, Int. J. Obes. 33 (2009) 1381–1389. doi:10.1038/ijo.2009.187.
PT E
[45] B. Baranowska, E. Wasilewska-Dziubinska, M. Radzikowska, a Plonowski, K. Roguski, Neuropeptide Y, galanin, and leptin release in obese women and in women with anorexia nervosa, Metabolism. 46 (1997) 1384–1389. doi:10.1016/S0026-0495(97)90136-0.
AC
CE
[46] L. Guo, M. Shi, L. Zhang, G. Li, L. Zhang, H. Shao, P. Fang, Y. Ma, J. Li, Q. Shi, Y. Sui, Galanin antagonist increases insulin resistance by reducing glucose transporter 4 effect in adipocytes of rats, Gen. Comp. Endocrinol. 173 (2011) 159–163. doi:10.1016/j.ygcen.2011.05.011. [47] A. Reyes-alcaraz, Y. Lee, G.H. Son, N.H. Kim, D. Kim, Development of Spexinbased Human Galanin Receptor Type II- Specific Agonists with Increased Stability in Serum and Anxiolytic Effect in Mice, Sci. Rep. 6 (2016) 1–10. doi:10.1038/srep21453.
ACCEPTED MANUSCRIPT Figure legends Fig.1 mRNA expression of galanin receptors (GALR2 and GALR3) in 3T3-L1 preadipocytes, 3T3-L1 adipocytes, isolated mouse adipocytes, mouse fat tissue, human adipocytes and human visceral fat tissue (A). Western blot detection of
PT
galanin receptors (GALR2 and GALR3) in 3T3-L1 preadipocytes, 3T3-L1
RI
adipocytes, isolated mouse adipocytes, mouse fat tissue, human adipocytes and
SC
human visceral fat tissue (B). mRNA expression of SPX in 3T3-L1 preadipocytes, 3T3-L1 adipocytes, isolated mouse adipocytes, mouse fat tissue, human adipocytes
NU
and human fat tissue (C). Immunofluorescence detection of SPX in 3T3-L1 preadipocytes, adipocytes and human fat tissue. Lipid droplets in mature 3T3-L1
MA
adipocytes stained using BODIPY (D). Fig.2
D
Effect of SPX on cell proliferation (A) and cell viability (B). Results are shown as
PT E
percentage of control group (set to 100%). Fetal calf serum (FCS) was used as positive control. Results are shown as mean ± standard error of mean (SEM) derived
Fig.3
CE
from n-8 replicates. The experiment was repeated at least four times.
AC
Effect of SPX (1.0–1000 nM) on triacylglycerol accumulation. Quantification of intracellular triacylglycerol content in cells incubated with or without SPX for 3 (A), 7 (B), 10 (C), 14 (D) days. Representative images (ORO staining) of 3T3-L1 cells incubated with or without SPX (1.0-1000nM) on the day 10 (middle panel). Effects of SPX on proadipogenic genes mRNA expression in 3T3-L1 cells: PPARγ (E), CEBPα (F), CEBPβ (G) and FABP4 (G). Results are shown as mean ± standard error of mean (SEM) derived from n=8 replicates. The experiment was repeated at
ACCEPTED MANUSCRIPT least four times. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus corresponding control using One Way ANOVA followed by the Dunnett post hoc test. Fig.4 Determination of
lipolysis in 3T3-L1 adipocytes (A,B) and isolated human
PT
adipocytes (D,F) exposed to SPX (1.0-1000nM) for 120 and 360 min. Isoproterenol
RI
was used as a positive control. Results are shown as percentage of basal lipolysis
SC
(set to 100%). Effect of SPX on HSL phosphorylation at S563 and S660 in 3T3-L1 cells (C) and in isolated human adipocytes atS552 and S650 (G). The images show
NU
representative (not the best) results of Western blot analysis of pHSL and total HSL. Results are shown as mean ± standard error of mean (SEM) derived from n=8
MA
replicates. The experiment was repeated at least four times. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus corresponding control
D
using One Way ANOVA followed by the Dunnett post hoc test.
PT E
Fig. 5
Effect of SPX on basal and insulin-stimulated lipogenesis measured as incorporation
CE
of C14 glucose into lipids in 3T3-L1 adipocytes (A). Effect of SPX on basal and insulin-stimulated 2-deoxy-D-[-1-3H]glucose uptake into the 3T3-L1 adipocytes
AC
(B). Negative control: cytochalasin B (cytB, 100 µM). mRNA expression of Fasn after SPX exposition (E). Insulin:positive control. Effect of SPX on basal lipogenesis measured as incorporation of C14 glucose into lipids in isolated human adipocytes. Insulin: positive control(C). Effect of SPX on basal and insulinstimulated 2-deoxy-D-[-1-3H]glucose uptake in isolated human adipocytes (D). Results (A-D) are shown as percentage of basal lipolysis (set to 100%). mRNA expression of FASN after SPX treatment of isolated human adipocytes (F). Western
ACCEPTED MANUSCRIPT blot analysis of FAS protein expression normalized to β-actin in 3T3-L1 adipocytes (G). Results are shown as mean ± standard error of mean (SEM) derived from n=8 replicates. The experiment was repeated at least four times. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus corresponding control using One Way ANOVA followed by the Dunnett post hoc test or unpaired
PT
Student’s t test (two-tailed distribution).
RI
Fig. 6
SC
Effects of GALR2/3 and GALRs antagonists on spexin induced lipolysis in 3T3-L1 adipocytes. Cells were pre-incubated 30 min with or without GALR2 antagonist
NU
M871 (Fig.6 a, b), GALR3 antagonist SNAP37889 (Fig. 6 c, d), GALR2 and 3 antagonist together (Fig. 6 e, f) and non-selective GALR 1, 2 and 3 antagonist M40
MA
(Fig. 6 g, h) and then 100 nM of SPX was added into the incubation medium. Effect of SPX was detected after 120 and 360 min of incubation. Different controls for
D
each antagonists were forced by different solvents for antagonists. Results are
PT E
shown as mean ± standard error of mean (SEM) derived from n=8 replicates. Statistically significant differences are represented as *P<0.05 and **P<0.01 versus
AC
CE
corresponding control using unpaired Student’s t test (two-tailed distribution).
ACCEPTED MANUSCRIPT Table.1 Sequence of PCR primers and product size
Left primer (5’˃3’)
Right primer (5’˃3’)
Product Size
Spexin (Mouse)
tccttctcctggtgctgtct
tctgggtttcgtctttctgg
187
SPEXIN (Human)
tgacaagatgtccctgtgga
aggttgttgctgccagactt
184
GalR2 (Mouse)
cttaaaggcgccccatgt
cactagcgagtcacactgttcc
72
GALR2 (Human)
atggacatctgcaccttcgt
gtaggtcaggccgagaacc
63
GalR3 (Mouse)
cggccgtctcagtggata
cggccgtctcagtggata
131
GALR3 (Human)
tttacgctggctgctgtctc
cggtgccgtagtagctgag
160
Pparγ (Mouse)
ccacagactcggcactcaat
ccaagaataccaaagtgcgat
132
C/ebpα (Mouse)
aaacaacgcaacgtggaga
gcggtcattgtcactggtc
60
C/ebpβ (Mouse)
aagatgcgcaacctggag
cagggtgctgagctctcg
105
Fabp4 (Mouse)
aagagaaaacgagatggtgacaa
cttgtggaagtcacgccttt
65
FASN (Human)
catcggctccaccaagtc
gctatggaagtgcaggttgg
121
Fasn (Mouse)
ccaaatccaacatgggaca
tgctccagggataacagca
76
Gapd (Mouse)
atggtgaaggtcggtgtga
aatctccactttgccactgc
84
cgctctctgctcctcctgtt
catggtgtctgagcgatgt
81
AC
RI
SC
NU
MA
D
PT E
CE
GAPD (Human)
PT
Gene
ACCEPTED MANUSCRIPT Highlights Spexin is expressed in murine 3T3-L1 adipocytes and isolated human adipocytes
Spexin inhibits adipogenesis
Spexin stimulates lipolysis in human and murine 3T3-L1 adipocytes
Spexin inhibits lipogenesis and glucose uptake in human and murine 3T3-L1
PT
adipocytes
RI
Spexin effect on adipocytes metabolism is mediated via GALR2 and GALR3
CE
PT E
D
MA
NU
SC
receptors
AC
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6