The association between promoter polymorphism of the interleukin-10 gene and Alzheimer's disease

Neurobiology of Aging 26 (2005) 1005–1010

The association between promoter polymorphism of the interleukin10 gene and Alzheimer’s disease Suk Ling Maa,b , Nelson Leung Sang Tanga , Linda Chiu Wa Lamb,∗ , Helen Fung Kum Chiub,c a

Department of Chemical Pathology, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong, China b Department of Psychiatry, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong, China c Jockey Club Centre for Positive Ageing, Hong Kong, China Received 29 October 2003; received in revised form 11 August 2004; accepted 31 August 2004

Abstract The importance of the role of inflammation has been suggested in the pathogenesis of Alzheimer’s disease (AD). Interleukin-10 (IL-10) is an anti-inflammatory cytokine that may modulate the progression of the disease through the inhibition of the action of pro-inflammatory cytokines. In this study, three polymorphisms in the regulatory region of the IL-10 gene (−1082, −819 and −592) in 95 Chinese AD patients and 117 age-matched healthy Chinese subjects were investigated. We found that among the Chinese population, the A and C alleles at the −592 position are strongly linked to the T and C alleles at the –819 position, respectively. A strong association with AD was found for these two IL-10 polymorphisms, which are in complete linkage disequilibrium (−592C and −819C), and the odds ratio of AD is 4.03 (95% CI 1.23–13.23; p = 0.011). The functional significance of the IL-10 genotype was further supported by the significant association between plasma IL-10 concentrations and genotypes that were found in an independent sample of 160 healthy male volunteers. No interaction effect between the ApoE and IL-10 genotypes is found. Therefore, we concluded that the functional polymorphisms of the IL-10 gene act as a risk factor for AD. © 2004 Elsevier Inc. All rights reserved. Keywords: Alzheimer’s disease; IL-10; Polymorphism; Inflammation

1. Introduction Alzheimer’s disease (AD) is the most prevalent form of dementia, and is characterized by ␤-amyloid deposition, neurofibrillary tangles, and neuronal cell death. Although mutations of ␤-amyloid precursor protein and the presenilin-1 and presenilin-2 genes have been associated with the familial form of AD, the cause of the more common sporadic form is still unknown. The observation of the reactive astrocytes and activated microglia cells that are associated with senile plaques in the brains of AD sufferers has suggested a role for inflammatory mechanisms in the pathogenesis of AD. Previ∗

Corresponding author. Tel.: +852 26076040; fax: +852 26671255. E-mail address: [email protected] (L.C.W. Lam).

0197-4580/$ – see front matter © 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.neurobiolaging.2004.08.010

ous studies have reported associations between the genotypes of pro-inflammatory cytokines such as IL-1␤ [20,21] and TNF␣ [14,16] with AD. The hypothesis about the role of inflammatory mechanisms is also supported by the observation of a decreased incidence of AD in patients who receive long-term non-steroidal anti-inflammatory drugs (NSAIDs) [17]. As IL-10 is an anti-inflammatory cytokine, subjects with a weak expression of the IL-10 gene are likely to be more prone to AD. Polymorphisms in the promoter region of IL10 were suggested as a risk factor for AD in an Italian population [12], but this association was not replicated in two other studies that were carried out on Italian and German populations [6,24]. Furthermore, the genotype distribution of IL-10 polymorphisms has been found to be different in Caucasians and Asians [3,19,23]. In this study, we investi-

1006

S.L. Ma et al. / Neurobiology of Aging 26 (2005) 1005–1010

gated the association between three IL-10 polymorphisms in the promoter region (−1082, −819 and −592) and the risk of developing AD. The relationship between the IL10 genotypes and plasma IL-10 concentration was further evaluated to determine the effect of different alleles on IL10 concentrations, and to identify the functional alleles of the gene.

2. Methods 2.1. Subjects 2.1.1. Genetic association study on IL-10 genotypes and AD Ninety-five Chinese subjects (78% were women and the mean age at study = 77.6 years, S.D. = 5.8; range = 61–90) with NINCDS-ADRDA diagnosis for probable and possible AD were recruited from the Academic Psychogeriatric Unit of the Department of Psychiatry at the Prince of Wales Hospital in Hong Kong. One hundred and seventeen elderly Chinese control subjects (75% were women and the mean age at study = 73, S.D. = 6.8; range = 60–89) were recruited from local elderly social centers for comparison. All of the control subjects were evaluated by the Chinese versions of the MiniMental State Examination [4] and the Mattis Dementia Rating Scale [2], and were evaluated by specialist psychiatrists to ensure that they were cognitively intact before recruitment. Both the AD and non-demented control subjects originated from provinces of Southern China. 2.1.2. Correlation between plasma IL-10 concentration and IL-10 promoter genotypes in healthy volunteers An independent sample of 160 healthy Chinese male volunteers was recruited for an analysis of the association between the IL-10 genotype and plasma IL-10 concentration. All of the volunteers completed questionnaires to exclude subjects with any acute or chronic illnesses. Informed consent was obtained, and the project was approved by the Ethical Committee of the Chinese University of Hong Kong.

2.2. Genotyping of IL-10 polymorphisms Genomic DNA was extracted from peripheral blood samples with a DNA extraction kit according to the manufacturer’s instructions (Roche, USA). Mismatched PCR-RFLP was used to genotype the polymorphic sites at IL-10−1082 (A/G), IL-10−819 (T/C), and IL-10−592 (A/C) (Table 1). A polymerase chain reaction (PCR) was performed in 25 ␮l reactions comprising 0.25 ␮M of each primer pair, 2 mM of MgCl2 , 0.6 units of Ampli Taq Gold Polymerase (Applied Biosystems), and PCR buffer (10 mM of Tris–HCl, pH 8.3; 50 mM of KCl). The reaction mixture was initially heated at 96 ◦ C for 15 min to activate the polymerase, and DNA amplification was achieved by 35 cycles at 96 ◦ C for 30 s, annealing for 45 s (at the temperature listed in Table 1) and at 72 ◦ C for 45 s. The final elongation step was performed at 72 ◦ C for 7 min. For restriction enzyme digestion, 7 ␮l of the PCR product was digested by 5 units of the required enzyme in the presence of the accompanying buffer in a final volume of 14 ␮l and incubated overnight at the temperature at which activity of the enzyme is optimal. The polymorphism was visualized by separating the DNA in a 4% agarose gel that was stained with ethidium bromide. The two polymorphisms IL-10−819 and IL-10−1082 were located very close to each other (only 264 bp apart), and the same primer pairs, but different types of restriction enzymes, were used to genotype these two sites. The mismatched position on the forward primer created a cutting site for BslI for the allele −1082G, and the mismatched position on the reverse primer created a cutting site for SspI for −819T (Fig. 1). To validate the genotyping results, the genotyping experiments were repeated and direct sequencing performed in 10% of the samples. The apolipoprotein E (ApoE) genotyping was performed as has been previously described [30]. 2.3. Enzyme-linked immunosorbent assay (ELISA) for IL-10 and C-reactive protein (CRP) The standard ELISA protocol was carried out according to the manufacturer’s instructions. In brief, each well of

Table 1 Primer sequences and enzymes for the analysis of IL-10−1082, IL-10−819, and IL-10−592 IL-10 polymorphism

Primer sequence 5 –3

PCR size (bp)

Annealing Tm (◦ C)

Enzyme

Size after enzyme digestion (bp)

−1082

IL-10−1082F GACAACACTACTAAGGCTcCTTT-GGGAa IL-10−1082R GTGAGCAAACTGAGGCACAGAaAT

315

58

BslI

A: 37 + 278

−819

Same as IL-10−1082

315

−592

IL-10−592F TGCAGACTACTCTTACCCACTTCC IL-10−592R AATAATTGGGTCCCCCCAAC

314

G: 25 + 37 + 253

50

SspI

C: 315 T: 24 + 291

RsaI

C: 314 A: 134 + 180

a The primers in lower case letters denote the mismatched position that is required for subsequent restriction digestion for the differentiation of the polymorphisms.

S.L. Ma et al. / Neurobiology of Aging 26 (2005) 1005–1010

1007

Fig. 1. Gel picture showing the RFLP pattern of IL-10−1082 and IL-10−819 polymorphism. RFLP pattern of IL-10−1082 and IL-10−819 were shown. Lanes 1, 2 and 6 correspond to GG, GA and AA of IL-10−1082, respectively. Lanes 7, 8 and 9 correspond to TT, CC and CT of IL-10−819, respectively.

the ELISA plates (CLB, Amsterdam, the Netherlands) was coated with anti-human IL-10 monoclonal antibody in phosphate buffered saline (PBS), and left to incubate overnight at 4 ◦ C. IL-10 was captured by the antibody, and any nonbound material was removed by washing. A biotinylated monoclonal antibody to IL-10 was added, and any excess was removed by washing. Finally, horseradish peroxidase conjugated streptavidin was added to bind the biotinylated side of the IL-10 sandwich to develop a colored product. The CRP level in the samples was measured with a CRP ELISA kit (IBL, Hamburg) using a similar protocol to the ELISA protocol, and subjects with a raised CRP were excluded from the study. 2.4. Statistical analysis Statistical analysis of genotype distribution and allele frequencies was performed by a chi-square test (SPSS for Windows 11.0). The odds ratio and confident intervals were also calculated using a logistic regression model after controlling for age and gender. The differences in plasma IL-10 concentration were analyzed using a Mann–Whitney test (SPSS for Windows 11.0).

3. Results No significant deviation of genotype frequencies from the Hardy–Weinberg equilibrium was noted in either the case or control groups. Similar to a previous study in a Chinese population [19], there was complete linkage disequilibrium (LD) at position −819 and position −592 of the IL-10 gene promoter, and therefore the genotype results were identical

for these two polymorphisms. The genotype distribution of IL-10−592 and IL-10−819 in the AD group differed significantly from that in the control group (p = 0.011) (Table 2). The odds ratio for IL-10−592 C carriers (CC or CA genotypes) versus non-carriers (AA genotypes) in the AD group was 4.03 (95% CI 1.23–13.23) compared with the control group. The homozygote CC subjects had the highest risk, with an odds ratio of 4.70 (95% CI 1.39–15.85). As expected, the same observation was found for IL-10−819C. However, the genotypic distribution in the AD group did not differ significantly from that of the control group for the IL-10−1082 polymorphism, which is further upstream. The IL-10 level, as measured by ELISA, showed a significantly higher IL-10 production in the IL-10−819 T carrier compared with the subjects that were homozygous for the C allele (p = 0.04) (Table 3). Haplotypes were determined by the EH program [29], and four haplotypes were identified, which matches the results previously reported in other studies in Chinese populations [19]. The haplotype −1082A/−819C/−592C was significantly overexpressed in the AD group, and was associated with a 1.98-fold (95% CI 1.23–3.19) increase in the risk of AD. ApoE polymorphism was also determined in this study to investigate the gene–gene interaction. The ␧3/␧4 genotypes were more frequent in the AD group (24.2%) compared with the control group (15.4%) (Table 2). In addition, the ␧4 allele was over-represented in the AD group (15.3%) compared with the control group (9.4%). This result is also consistent with other studies in Chinese populations [15]. We further investigated for any interaction between the ApoE alleles and the IL-10 polymorphisms regarding the risk of AD. Logistic regression analysis, with the model adjusted for age, gender, and ApoE ␧4 status, showed that there was no significant dif-

1008

S.L. Ma et al. / Neurobiology of Aging 26 (2005) 1005–1010

Table 2 Frequency distribution of IL-10−592, IL-10−819, IL-10−1082, and ApoE genotypes and alleles in the control population and the population with Alzheimer’s disease Control

Alzheimer’s disease

IL-10−592 genotype CC 5 (4.2%) 13 (13.7%) CA 43 (36.8%) 42 (44.2%) AA 69 (59.0%) 40 (42.1%) IL-10−819 genotype CC 5 (4.2%) 13 (13.7%) CT 43 (36.8%) 42 (44.2%) TT 69 (59.0%) 40 (42.1%) IL-10−1082 genotype GG 5 (4.3%) 3 (3.2%) GA 6 (5.1%) 8 (8.4%) AA 106 (90.6%) 84 (88.4%) ApoE genotype 22 2 (1.7%) 23 20 (17.1%) 24 4 (3.4%) 33 73 (62.4%) 34 18 (15.4%) 44 –

χ2 (p-value)a

Odds ratiob

95% CI

0.011

4.03

1.23–13.23

0.011

4.03

1.23–13.23

0.588

–

–

0.025

0.48 0.22–1.05 Reference 1.62 0.86–3.06

– 9 (9.5%) 2 (2.1%) 59 (62.1%) 23 (24.2%) 2 (2.1%)

ApoE allele 2 28 (12.0%) 11 (5.8%) 3 184 (78.6%) 150 (78.9%) 4 22 (9.4%) 29 (15.3%)

CI: confidence interval. a Chi-square analysis with Yate’s correction, d.f. = 2. b The odds ratios of the homozygous and heterozygous carriers of the minor alleles were determined together by logistic regression analysis against the homozygotes of the common alleles, with age and gender controlled as covariants. Table 3 Comparison of IL-10 concentration in plasma between IL-10−819 CC homozygotes and IL-10−819 T carriers IL-10 (pg/ml)

−819 CCa (n = 22)

−819 CT/TTb (n = 119)

Median Mean ± S.E.c 25th percentile 75th percentile

0.46 0.95 ± 0.30 NDd 1.24

0.95 2.41 ± 0.36 0.19 2.57

SE: standard error of mean. a −819 CC: homozygous C on −819. b −819 CT/TT: carrier of at least one T allele on −819. c ND is below the detection limit.

ference in the distribution of IL-10 alleles between ApoE ␧4 carriers and non-carriers (p = 0.975).

4. Discussion The observation of deranged cytokine profiles in subjects with AD has led to extensive studies on the role of inflammatory reactions in the pathogenesis of AD [1,18]. Polymorphisms in the promoter regions or the untranslated region of the pro-inflammatory genes (IL-1 [7,13], IL-6 [26] and

TNF␣ [14,16]) have been reported as being potential candidate genes for AD. Although inflammation is not likely to be the sole etiology of AD, deranged immune responses can be an important contributing factor in its pathogenesis or in the progression of the disease. However, anti-inflammatory mediators may play a protective role in counteracting progressive neuronal degeneration. Therefore, any imbalance in the production of these cytokines may lead to disease progression and a more severe outcome. IL-10 is an anti-inflammatory cytokine that inhibits the production of pro-inflammatory cytokines such as IL-6 and TNF␣. In IL-10 gene-deficient mice, an overproduction of inflammatory cytokines and the development of chronic inflammatory diseases have been noted [10]. Furthermore, IL10 has been reported to have an anti-inflammatory role in the brain [27], and reduced production of IL-10 has been found in some AD patients [5,22]. Inflammatory cytokines are associated with the pathology of AD by eliciting an intense inflammatory reaction in the brain. However, the antiinflammatory cytokine IL-10 may reduce inflammation in brain by suppressing the expression and production of inflammatory cytokines and their receptors. An imbalance of pro-inflammatory cytokines and anti-inflammatory cytokines may therefore be an important phenomenon in AD. This hypothesis is supported by a recent study that shows that the production of IL-1␤ relative to IL-10 was 7–10-fold higher in AD patients than in control subjects [22]. In addition, the results of an in vivo study suggest that IL-10 inhibits A␤ and lipopolysaccharide-induced cytokine production in the hippocampus and cortex [28]. Functional polymorphisms have been reported in IL-10, which determine the expression and circulating concentration of IL-10 [29]. Given the important immunoregulatory role of IL-10, IL-10 gene polymorphisms may be a predisposing gene for AD. Recently, Lio et al. [12] reported that IL-10 polymorphism is associated with AD, but this association was not confirmed in two other studies [6,24]. With these contrasting results, we conducted this study to clarify the role of this anti-inflammatory cytokine in the pathology of AD. In our study, polymorphism in the 5 flanking region of the IL-10 gene (−1082, −819 and −592) were investigated. These polymorphisms have been previously associated with differential IL-10 production [8,31], and IL-10−1082G is associated with higher IL-10 production in Caucasians [31]. However, we found that polymorphism at −1082 did not affect the level of IL-10, but −819T did account for a higher level of IL-10. Our results from independent healthy volunteers show significantly higher levels of the IL-10−819 T carriers, compared with the homozygous carriers of the IL10−819 C allele (p = 0.04) (Table 3). Conversely, the reduced expression of IL-10 is associated with the −819C and −592C alleles, which makes them high-risk alleles for AD. Polymorphisms at −819 and −592 of the IL-10 gene were in strong LD, and only four out of eight possible haplotypes (−1082A/−819T/−592A, −1082G/−819T/−592A,

S.L. Ma et al. / Neurobiology of Aging 26 (2005) 1005–1010 Table 4 Comparison of allele frequencies of three IL-10 polymorphic sites in different populations Alleles

Asians [19] (%)

Our study (%)

IL-10−1082 A 71 G 29

Italians [3] (%)

94 6

93 7

IL-10−819 T C

31 69

67 33

77 23

IL-10−592 A C

31 69

67 33

77 23

−1082G/−819C/−592C, and −1082A/−819C/−592C) were observed in the Chinese population in the study. We identified the haplotype −1082A/−819C/−592C as a high-risk haplotype for the development of AD. This may be predominantly caused by the low IL-10-producing alleles −819C and −592C. The −1082A/−819C/−592C haplotype carrier may have a lower IL-10 production rate to counterbalance other inflammatory cytokines, which thus results in a higher risk of AD. The association between IL-10 production and the IL10−819/IL-10−592 genotypes was identified at the baseline physiological levels of plasma IL-10 (0.65–2.77 pg/ml). This level of IL-10 is well below the level that is needed to suppress immune responses to stressful stimuli such as severe head trauma [9]. Other anti-inflammatory activities, however, are exerted at this physiological level of IL-10, such as the inhibition of c-Jun N-terminal kinase (JNK) and p38 activities that contribute to the modulation of inflammatory responses in the brain. The inflammatory hypothesis in the pathogenesis of AD is also demonstrated in another inflammatory cytokine, IL-1, which is age-associated and increases microglial activation. IL-1 expression may contribute to an increased risk of AD because it favors neuritic plaque formation in susceptible patients [25]. Individuals with “low” IL-10 genotypes that are associated with a reduced production of IL-10 are therefore predisposed to AD, as the production of pro-inflammatory cytokine is not modulated. The results we present here provide further support for the possible role on the effectiveness of non-steroidal anti-inflammatory drugs in slowing the progression of cognitive impairment [17], and enhanced IL-10 expression may be a promising target for therapeutic intervention to delay the progression of AD. There is a marked ethnic difference in the distribution of genotypes and haplotypes. Table 4 compares the allelic frequencies of the three polymorphic sites that were previously studied in Italian and Asian populations. The common alleles at positions −819 and −592 were opposite in Italians and Asians, the common allele at −819 being C in Italians and T in Asians. In addition, the prevalence of the G allele at IL-10−1082 was much lower in Asians. The ethnic differences between populations may account for the different

1009

associations with the disease and potential benefits of treatment. Comparing our results with those of other published papers on the association of IL-10 polymorphisms and the risk of AD [6,12,24], only Lio et al. have reported positive results for this association. Uncontrolled confounding factors and gene–gene interaction may account for the discrepancies between the studies. Some polymorphisms only exist in certain populations [11], and others may present at different allelic frequencies. This results in an apparent masking effect for the association between genetic polymorphism and disease. Although a study that was performed in a German population failed to replicate the previous findings, a trend was observed of a decreased frequency of the allele that is responsible for high IL-10 production in the AD group [6], which provided further support for the role of IL-10 polymorphism in modulating the risk of AD. Scassellati et al. also failed to replicate the association between AD and IL-10, but their results supported the hypothesis for the possible role of the IL-10 gene in the etiology of AD [24]. Comparing these studies, it is found that only Lio et al. reported a complete LD at −819 and −592 of the IL-10 gene, as we reported in a Chinese population and, therefore, ethnic difference may also account for the differences in the findings of these studies [12]. The present study establishes the significance of IL-10 polymorphism as a risk factor for AD. We also identify the difference in the genotypic determination of circulating IL10 concentration in Chinese and Caucasian populations. This illustrates the importance of replicating genetic association studies in different ethnic groups, through which the relationship between polymorphism and the risk of disease can be better defined. In conclusion, our results add to the accumulating evidence that IL-10 polymorphism is an important modulator of the risk of AD. Acknowledgements This work is supported by a grant from the Earmarked Research Grants Scheme of the Hong Kong Research Grants Council (CUHK 4082/00M) and an RGC Research Grant Direct Allocation grant from the Chinese University of Hong Kong (CRE-2003.1.072).

References [1] Akiyama H, Barger S, Barnum S, Bradt B, Bauer J, Cole GM, et al. Inflammation and Alzheimer’s disease. Neurobiol Aging 2000;21:383–421. [2] Chan AS, Choi MK, Salmon DP. The effects of age, education, and gender on the Mattis Dementia Rating Scale performance of elderly Chinese and American individuals. J Gerontol B Psychol Sci Soc Sci 2001;56:356–63. [3] Chiavetto LB, Boin F, Zanardini R, Popoli M, Michelato A, Bignotti S, et al. Association between promoter polymorphic haplotypes of interleukin-10 gene and schizophrenia. Biol Psychiatry 2002;51:480–4.

1010

S.L. Ma et al. / Neurobiology of Aging 26 (2005) 1005–1010

[4] Chiu HFK, Lee HC, Chung WS, Kwong PK. Reliability and validity of the Cantonese version of the Mini-Mental State Examination—a preliminary study. J Hong Kong Coll Psychiatrists 1994;4:25–8. [5] De Luigi A, Fragiacomo C, Lucca U, Quadri P, Tettamanti M, Grazia De Simoni M. Inflammatory markers in Alzheimer’s disease and multi-infarct dementia. Mech Ageing Dev 2001;122:1985–95. [6] Depboylu C, Du Y, Muller U, Kurz A, Zimmer R, Riemenschneider M, et al. Lack of association of interleukin-10 promoter region polymorphisms with Alzheimer’s disease. Neurosci Lett 2003;342:132–4. [7] Du Y, Dodel RC, Eastwood BJ, Bales KR, Gao F, Lohmuller F, et al. Association of an interleukin 1 alpha polymorphism with Alzheimer’s disease. Neurology 2000;55:480–3. [8] Eskdale J, Gallagher G, Verweij CL, Keijsers V, Westendrop RG, Huizinga TW. Interleukin 10 secretion in relation to human IL-10 locus haplotypes. Proc Natl Acad Sci USA 1998;95:9465–70. [9] Hensler T, Sauerland S, Riess P, Hess S, Helling HJ, Andermahr J, et al. The effect of additional brain injury on systemic interleukin (IL)10 and IL-13 levels in trauma patients. Inflamm Res 2000;49:524–8. [10] Lang R, Rutschman RL, Greaves DR, Murray PJ. Autocrine deactivation of macrophages in transgenic mice constitutively overexpressing IL-10 under control of the human CD68 promoter. J Immunol 2002;168:3402–11. [11] Lei SF, Deng FY, Liu XH, Huang QR, Qin Y, Zhou Q, et al. Polymorphisms of four bone mineral density candidate genes in Chinese populations and comparison with other populations of different ethnicity. J Bone Miner Metab 2003;21:34–42. [12] Lio D, Licastro F, Scola L, Chiappelli M, Grimaldi LM, Crivello A, et al. Interleukin-10 promoter polymorphism in sporadic Alzheimer’s disease. Genes Immun 2003;4:234–8. [13] Ma SL, Tang NL, Lam LC, Chiu HF. Lack of association of the interleukin-1beta gene polymorphism with Alzheimer’s disease in a Chinese population. Dement Geriatr Cogn Disord 2003;16:265–8. [14] Ma SL, Tang NL, Lam LC, Chiu HF. Association between tumor necrosis factor-alpha promoter polymorphism and Alzheimer’s disease. Neurology 2004;62:307–9. [15] Mak YT, Chiu H, Woo J, Kay R, Chan YS, Hui E, et al. E genotype and Alzheimer’s disease in Hong Kong elderly Chinese. Neurology 1996;46:146–9. [16] McCusker SM, Curran MD, Dynan KB, McCullagh CD, Urquhart DD, Middleton D, et al. Association between polymorphism in regulatory region of gene encoding tumour necrosis factor alpha and risk of Alzheimer’s disease and vascular dementia: a case-control study. Lancet 2001;357:436–9. [17] McGeer EG, McGeer PL. The importance of inflammatory mechanisms in Alzheimer’s disease. Exp Gerontol 1998;33:371–8.

[18] McGeer PL, McGeer EG. Polymorphisms in inflammatory genes and the risk of Alzheimer’s disease. Arch Neurol 2001;58: 1790–2. [19] Mok CC, Lanchbury JS, Chan DW, Lau CS. Interleukin-10 promoter polymorphisms in Southern Chinese patients with systemic lupus erythematosus. Arthritis Rheum 1998;41:1090–5. [20] Mrak RE, Griffin WS. Interleukin-1, neuroinflammation, and Alzheimer’s disease. Neurobiol Aging 2001;22:903–8. [21] Nicoll JA, Mrak RE, Graham DI, Stewart J, Wilcock G, MacGowan S, et al. Association of interleukin-1 gene polymorphisms with Alzheimer’s disease. Ann Neurol 2000;47:365–8. [22] Remarque EJ, Bollen EL, Weverling-Rijnsburger AW, Laterveer JC, Blauw GJ, Westendorp RG. Patients with Alzheimer’s disease display a pro-inflammatory phenotype. Exp Gerontol 2001;36: 171–6. [23] Roh JW, Kim MH, Seo SS, Kim SH, Kim JW, Park NH, et al. Interleukin-10 promoter polymorphisms and cervical cancer risk in Korean women. Cancer Lett 2002;184:57–63. [24] Scassellati C, Zanardini R, Squitti R, Bocchio-Chiavetto L, Bonvicini C, Binetti G, et al. Promoter haplotypes of interleukin-10 gene and sporadic Alzheimer’s disease. Neurosci Lett 2004;356:119–22. [25] Sheng JG, Mrak RE, Griffin WS. Enlarged and phagocytic, but not primed, interleukin-1 alpha-immunoreactive microglia increase with age in normal human brain. Acta Neuropathol (Berl) 1998;95:229–34. [26] Shibata N, Ohnuma T, Takahashi T, Baba H, Ishizuka T, Ohtsuka M, et al. Effect of IL-6 polymorphism on risk of Alzheimer’s disease: genotype-phenotype association study in Japanese cases. Am J Med Genet 2002;114:436–9. [27] Strle K, Zhou JH, Shen WH, Broussard SR, Johnson RW, Freund GG, et al. Interleukin-10 in the brain. Crit Rev Immunol 2001;21:427–49. [28] Szczepanik AM, Ringheim GE. IL-10 and glucocorticoids inhibit Abeta(1–42)- and lipopolysaccharide-induced pro-inflammatory cytokine and chemokine induction in the central nervous system. J Alzheimers Dis 2003;5:105–17. [29] Terwilliger JOJ. Handbook for human genetic linkage. Baltimore: John Hopkins University Press; 1994. [30] Tsukamoto K, Watanabe T, Matsushima T, Kinoshita M, Kato H, Hashimoto Y, et al. Determination by PCR-RFLP of apo E genotype in a Japanese population. J Lab Clin Med 1993;121: 598–602. [31] Turner DM, Williams DM, Sankaran D, Lazarus M, Sinnott PJ, Hutchinson IV. An investigation of polymorphism in the interleukin10 gene promoter. Eur J Immunogenet 1997;24:1–8.