The capsid protein of Grapevine rupestris stem pitting-associated virus contains a typical nuclear localization signal and targets to the nucleus

Virus Research 153 (2010) 212–217

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

The capsid protein of Grapevine rupestris stem pitting-associated virus contains a typical nuclear localization signal and targets to the nucleus Baozhong Meng ∗ , Caihong Li Department of Molecular and Cellular Biology, College of Biological Science, University of Guelph, 50 Stone Road East, Guelph, Ontario, Canada N1G 2W1

a r t i c l e

i n f o

Article history: Received 28 May 2010 Received in revised form 3 August 2010 Accepted 3 August 2010 Available online 11 August 2010 Keywords: Foveavirus Betaflexiviridae Nuclear targeting Subcellular localization Bi-molecular fluorescence complementation Fluorescent proteins Protoplasts Electroporation

a b s t r a c t Grapevine rupestris stem pitting-associated virus (GRSPaV) is a positive strand, ssRNA virus of the genus Foveavirus (family Betaflexiviridae; order Tymovirales). GRSPaV is distributed in table and wine grapes worldwide and comprises a large family of sequence variants. As a newly discovered virus, mechanisms of virus replication and movement of GRSPaV have not been elucidated. We recently revealed the subcellular localization of the proteins encoded by the triple gene block of GRSPaV (Rebelo et al., 2008). However, the subcellular localization and interaction of its capsid protein (CP) have not been explored. We report here that GRSPaV CP contains a nuclear localization signal “KRKR” near its N-terminus, which is conserved among all five strains whose genomes are completely sequenced. Similar sequences were also detected in the CP of two other viruses of the same family: African oil palm ringspot virus and Cherry green ring mottle virus. Using fluorescent protein tagging, we demonstrate that the CP targets to the nucleus in tobacco protoplasts. Mutation to this nuclear localization signal abolished the nuclear localization. Using bi-molecular fluorescence complementation, we show that the capsid protein of GRSPaV engages in homologous interaction. To our knowledge, this is the first report on the nuclear localization of a CP encoded by a RNA plant virus. Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved.

Grapevine rupestris stem pitting-associated virus (GRSPaV) is a member of the genus Foveavirus (family Betaflexiviridae, order Tymovirales) (ICTV Taxonomy 2009; Martelli et al., 2007) and belongs to the alphavirus-like superfamily of RNA viruses (Koonin and Dolja, 1993; Strauss and Strauss, 1994). GRSPaV has a positivestrand ssRNA genome of 8725 nucleotides (nt) with five open reading frames (ORFs, Fig. 1A) (Meng et al. 1998; Zhang et al., 1998). ORF1 encodes a putative polypeptide of 244 kDa that contains domains indicative of methyl-transferase (MTR), helicase (HEL), papain-like cysteine protease (PRO) and RNA-dependent RNA polymerase (POL) (Meng and Gonsalves, 2007). In addition, a domain with sequence homology to ovarian tumor gene (OTU) that is involved in oocyte morphogenesis in Drosophila is present in the replicase polyproteins of GRSPaV and other members of the genera Foveavirus and Carlavirus (Makarova et al., 2000; Martelli et al., 2007). ORFs2–4 constitute the triple gene block (TGB) and encode three polypeptides of 24, 13 and 8 kDa, respectively. ORF5 encodes the capsid protein (CP) (Minafra et al., 2000; Meng et al., 2003; Petrovic et al., 2003). Evidently, GRSPaV represents a group of distinct viruses for which mechanisms for viral replication may be substantially different from other RNA viruses.

∗ Corresponding author. Tel.: +1 519 824 4120x53876; fax: +1 519 837 1802. E-mail address: [email protected] (B. Meng).

Based on the widespread distribution among different grapevines, the presence of diverse sequence variants, and the lack of symptoms upon infection, it is hypothesized that GRSPaV may have been an ancient virus that has co-existed with grapevine for a long period of time (Meng and Gonsalves, 2007). However, the origin of GRSPaV is unknown. Sequence analysis results suggest that the 5 region of the GRSPaV genome encompassing ORF1 and ORF2 seems to be more closely related to the corresponding region in Potato virus M (PVM, genus Carlavirus, family Betaflexiviridae), whereas the region encoding ORF4 and ORF5 are more closely related to their counterparts in Potato virus X (PVX, genus Potexvirus, family Alphaflexiviridae) (Meng and Gonsalves, 2007). Interestingly, the 3 non-coding region of GRSPaV appears to be more closely related to that of PVM (Meng et al., 1998). Based on similar genome structure and sequence relatedness, we also predict that GRSPaV may resemble members of the Carlavirus genus in genome replication while its cell-to-cell movement may be more comparable to members of the genus Potexvirus. The molecular and cellular aspects of the life cycle of GRSPaV and other members of the family Betaflexiviridae remain virtually unknown. Using fluorescent protein tagging technology and fluorescence microscopy, we have recently investigated the subcellular localization of the TGB proteins encoded by GRSPaV in tobacco BY-2 cells and protoplasts (Rebelo et al., 2008). These studies demonstrate that TGBp1 is localized both in the cytoplasm and

0168-1702/$ – see front matter. Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2010.08.003

B. Meng, C. Li / Virus Research 153 (2010) 212–217

213

Fig. 1. Genome structure of Grapevine rupestris stem pitting-associated virus (GRSPaV) and protein expression constructs. A. Genome structure of GRSPaV. The RNA genome contains five open reading frames (ORFs). ORF1 encodes a replicase polyprotein of 2161 aa with signature domains indicative of a member of the Alphavirus-like superfamily of RNA viruses. ORFs 2-4 constitute the “Triple Gene Block” (TGB) shared among several genera of plant viruses, which encode three polypeptides designated TGBp1, TGBp2 and TGBp3. ORF5 encodes the capsid protein (CP). B. Schematic representation of protein expression constructs used in this study. All constructs were made based on pRTL2GFP and contain the 35S promoter of Cauliflower mosaic virus (CaMV) (wide arrows), the translation enhancer from Tobacco etch virus (TE) and the CaMV 35S termination signal (35ST). Restriction sites used to make these constructs are given above each construct. GFP: green fluorescent protein; mRFP: monomeric red fluorescent protein containing a Q to T mutation at aa position 66 to enhance fluorescence (Rebelo et al., 2008). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

in the nucleus. TGBp1 also forms distinctive punctate bodies as expected for an ATPase/helicase protein. TGBp2 contains two transmembrane domains and is associated with the ER and ER-derived structures, presumably vesicles. TGBp3 contains a single transmembrane domain at its N-terminus and is distributed uniformly along the ER network (Rebelo et al., 2008). Based on the model developed for PVX (Morozov and Solovyev, 2003; Verchot-Lubicz et al., 2007) and similarity in overall sequence, and particularly in the conserved motifs, we conclude that TGB proteins of GRSPaV would also be involved in the intercellular translocation of the viral genomes. The subcellular localization pattern of the replicase polyprotein and the CP has not been investigated. Capsid protein is essential for all the RNA viruses that have an extracellular stage during their life cycle. Naturally, a major function of CPs is to encapsidate, and hence to protect, viral genomes during virus transport within an infected plant and spread among individual plants in the field. It is becoming evident that viral CPs, and perhaps viral proteins in general, are multi-functional in nature (Callaway et al., 2001). These functions include facilitating

the translocation of newly formed virions between plant cells as well as long-distance transport along the vascular tissue, genome activation as observed in the genera Alfamovirus and Ilarvirus, vector transmission and suppression of RNA silencing (Callaway et al., 2001; Voinnet, 2005; and references therein). The objective of this study is to unravel the subcellular localization of GRSPaV CP as a first step in the elucidation of its functions. Using WoLFPSORT (Horton et al., 2007), we detected a putative nuclear localization signal (NLS) “KRKR” at aa positions 47–50 in the CP sequences of all five strains of GRSPaV whose genome sequences are available (Fig. 2). However, such NLS sequences were not found in other members of the genus Foveavirus (Apple stem pitting virus, Apricot latent virus and Peach chlorotic mottle virus). Interestingly, similar sequences were detected in the CP of African oil palm ringspot virus (AOPRV) (“RRRR” at aa positions 44–47) and of Cherry green ring mottle virus (CGRMV) (“RRKR” at aa positions 54–57) (data not shown). AOPRV and CGRMV are members of the family Betaflexiviridae but have not been assigned to a genus (ICTV Taxonomy 2009). Similar sequences were not detected in other

214

B. Meng, C. Li / Virus Research 153 (2010) 212–217

Fig. 2. Alignment of the capsid protein sequences from five GRSPaV strains whose complete genome sequences are available [GRSPaV-1: AF057136; GRSPaV-SG1: AY881626; GRSPaV-BS: AY881627; GRSPaV-SY: AY368590; and GRSPaV-PN: AY368172), Apple stem pitting virus (ASPV) and Potato virus X (PVX). To achieve better alignment, only the C-terminal portion of the ASPV CP starting at aa position 156 was included. A putative nuclear localization signal 47 KRKR50 (boxed) was conserved among the CPs from all five strains of GRSPaV.

members of Betaflexiviridae or members of Alphaflexiviridae, including PVX (Fig. 2 and data not shown). To determine if this putative NLS in GRSPaV CP is functional, its cDNA sequence was amplified with PCR using primers CPfNcoI and CPrNcoI (Table 1), digested with NcoI, and ligated into pRTL2-GFP (Restrepo et al., 1990) and pRTL2-mRFP (Rebelo et al., 2008), resulting in constructs pCP:GFP and pCP:mRFP respectively (Fig. 1B). These constructs were electroporated into tobacco Bright Yellow-2 (BY-2) protoplasts following the methods as described by Rebelo et al. (2008). Expression of these constructs was observed by fluorescence microscopy at different time points after electroporation. pRTL2-GFP and pRTL2-mRFP were used as positive controls. At 4 h, the non-fused GFP was first observed in some of the protoplasts. Fluorescence due to CP:GFP or CP:mRFP was first detected in the nucleus at 9.5 h post-electroporation. The number of cells expressing the CP fusions increased as a function of time and reached a peak at 20 h post-electroporation. Representative images of protoplasts expressing CP:GFP are shown in Fig. 3(C–F) while those

of protoplasts expressing CP:mRFP were shown in Fig. 4(A and B). Compared with the uniform distribution of GFP fluorescence in the cytoplasm and nucleus of protoplast expressing non-fused GFP (Fig. 3(A and B)) or mRFP, protoplasts expressing CP:GFP or CP:mRFP had fluorescence only in the nucleoplasm (compare Fig. 3D with B). Furthermore, fluorescence due to the CP fusions was excluded from the nucleolus (Figs. 3D, F and 4B). Bright field images are included to depict the contour of the protoplasts. Interestingly, the majority of protoplasts expressing CP fusions (17 of 20) had two nuclei that fluoresced green. The same trend was observed in three independent experiments. This was likely due to active cell divisions that occur in these protoplasts. The molecular mass of both CP:GFP and CP:mRFP is about 55 kDa, which is below the cutoff value (60 kDa) for proteins that could move into the nucleus through simple diffusion and not by active targeting. To rule out the possibility that the nuclear localization of both CP fusions was due to diffusion, we made another construct in which the DNA sequence for GUS was PCR amplified

B. Meng, C. Li / Virus Research 153 (2010) 212–217

215

Fig. 3. Nuclear localization of CP:GFP in BY-2 protoplasts. A & B: images of bright field and green channel of a protoplast expressing pRTL2-GFP respectively. Note the diffuse distribution of GFP in the nucleus and the cytosol; C-F: images of bright field and green channel of a protoplast expressing CP:GFP respectively; G & H: images of bright field and green channel of a protoplast expressing CP:GUS: GFP. I & J: bright field and green fluorescence images of a second protoplast expressing CP:GUS:GFP. Note the presence of two nuclei both are fluorescent. K & L: images of a protoplast expressing CP:GFP (with the nuclear localization signal replaced with four alanine residues. All images were obtained at 20 hours post electroporation. N: nucleus. Bars = 20 ␮m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

using primers GusFNcoI and GusXbR (Table 1). After digestion with NcoI and XbaI, PCR product was inserted between those for CP and GFP, creating the construct pCP:GUS:GFP (Fig. 1B). This construct was electroporated into protoplasts followed by fluorescence microscopy. As a result, green fluorescence due to CP:GUS:GFP remained to be present exclusively in the nucleus and not in the cytoplasm (Fig. 3H and J), confirming that the nuclear localization of CP was not a result of diffusion but rather due to specific nuclear targeting. Compiling these data, we conclude that GRSPaV CP contained a bona fide NLS which targets the CP to the nucleus. To directly test the function of the putative NLS identified above, we replaced “KRKR” with four alanine residues through overlap PCR using two pairs of primers (CPfNcoI & CPdelNLSR and CPdelNLSF & CPrNcoI) (Table 1), resulting in construct pCPNLS:GFP (Fig. 1B).

DNA sequencing of the mutant construct confirmed successful replacement of the nuclear localization signal “KRKR”. As expected, protoplasts expressing pCPNLS:GFP produced green fluorescence in both the nucleus and the cytoplasm, indistinguishable from the distribution pattern of the non-fused GFP (Fig. 3L). Collectively, these results demonstrated that the CP actively targets to the nucleus and that the sequence “KRKR” is responsible for its nuclear targeting. As described earlier, a common function of a viral CP is to form a capsid shell that encases the viral genome. A prerequisite of this process is the homologous interaction among subunits of CP. Thus, we expect the CP subunits of GRSPaV transiently expressed in plant cells would also interact among themselves. To this end, we employed the newly developed bi-molecular fluorescence com-

216

B. Meng, C. Li / Virus Research 153 (2010) 212–217

Fig. 4. Self-interaction of GRSPaV CP as demonstrated by bi-molecular fluorescence complementation. A & B: Bright field and fluorescent images of a BY-2 protoplast electroporated with pCP:mRFP at 20 hrs post transfection. C to F: bright field and fluorescent images of two protoplasts electroporated with a mixture of plasmids pCP-mRFP-N2 and pCP-mRFP-C3, which contains the CP sequence fused to the N-terminal (pCP-mRFP-N2) or the C-terminal portion (pCP-mRFP-C3) of the mRFP gene. Bars = 20 ␮m.

plementation (BiFC) technology (Walter et al., 2004; Bracha-Drori et al., 2004) using an enhanced mRFP (Jach et al., 2006). The CP sequence was fused separately to those corresponding to the Nand the C-terminal portions of mRFP. Briefly, the 5 region (nts 1–504) of mRFP was PCR amplified using pRTL2-mRFP as template with primers Bmc-RFP-N and Xb-RFP-N, while the 3 region (nts 505–678) was amplified with primers Bmc-RFP-C and XbRFP-C (Table 1). The resulting PCR products were digested with BamHI and XbaI and cloned into pRTL2 cut with the same enzymes. This resulted in the intermediate constructs pRTL2-mRFP-N and pRTL2-mRFP-C. Subsequently, the CP sequence was PCR amplified using pCP:mRFP as template and with primers CPfNco and CPBamR (Table 1). After digestion with NcoI and BamHI, the PCR product was ligated separately into pRTL2-mRFP-N and pRTL2-mRFP-C. The resulting constructs, pCP-mRFP-N2 and pCP-mRFP-C3, were electroporated into protoplasts. Microscopic observation revealed successful reconstitution of the red fluorescence in the nuclei of protoplasts (Fig. 4D and F), confirming that the CP interact among

Table 1 Primers used for the construction of plant expression vectors used in this study. Note that recognition sites for restriction enzymes and mutated sequences are underlined and the spacer sequence encoding myc italicized. Primers

Primer sequences

CPfNcoI CPrNcoI Bmc-RFP-N

AAACCATGGCAAGTCAAATTGGGAAAC AAACCATGGTTTCATGTGTAACATTTGAAAAG TTTTGGATCCGAGCAAAAGTTGATTTCTGAGGAGG ATGCCTCCTCCGA TTTTTCTAGATTACTTCAGCTTCAGCCTC TTTTGGATCCGAGCAAAAGTTGATTTCTGAGGAGG ATGACGGCGGCCACTACG TTTTTCTAGATTAGGCGCCGGTGGAGT GCCGCCGCCGCCGTTATAGAGAATGCACTTTC GGCGGCGGCGGCGGCAAGAATGCCACTGAG AAAGGATCCTTCATGTGTAACATTTGAAAAG AAAACCATGGTCCGTCCTGTAGAAACC AAAATCTAGATTGTTTGCCTCCCTGCTG

Xb-RFP-N Bmc-RFP-C Xb-RFP-C CPdelNLSF CPdelNLSR CPBamR GusFNcoI GusXbR

themselves within the nuclei of electroporated protoplasts. As controls, protoplasts co-expressing constructs containing either the N-terminal half or the C-terminal half of mRFP showed no red fluorescence at all. This demonstrates the usefulness of BiFC using split mRFP for studying interaction of viral proteins in plant cells. Nuclear localization has been reported for proteins encoded by a limited number of animal and plant RNA viruses, including Encephalomyocarditis (Aminev et al., 2003), Porcine reproductive and respiratory syndrome virus (Rowland and Yoo, 2003), Tobacco etch virus (Restrepo et al., 1990), Turnip crinkle virus (Cohen et al., 2000) and Cucumber mosaic virus (CMV) 2b protein (Lucy et al., 2000; Wang et al., 2004). The only plant RNA virus whose CP was detected in the nucleus was CMV. Using immuno gold labeling, Lin et al. (1996) reported the detection of CMV CP in the nucleus of infected cucumber plants. However, CMV CP does not contain NLS and thus its nuclear localization was likely not due to active targeting. The biological function of this nuclear localization with regard to the life cycle of GRSPaV remains unknown. The nuclear targeting of the CP may exert regulation of cellular activities such as transcription or DNA replication, rendering cellular conditions more favorable for GRSPaV infection. It is worth noting that GRSPaV CP has considerable sequence similarity with two cellular proteins (Meng, unpublished data). The first was the ␣ subunit of guanine nucleotide-binding protein from the fungus Laccaria bicolor (Basidiomycota), which forms mycorrhizal symbiosis with a wide range of temperate trees (Martin et al., 2008). Interestingly, a putative NLS sequence, “KRKRK”, was located at aa positions 206-210 in this protein. G proteins are known to be involved in signal transduction across a wide range of organisms (Karp, 2010). The second is a hypothetical protein from grapevine (cv. Pinot noir). This grapevine protein belongs to the MuDR family of transposases likely involved in transposition of mutator transposable elements (Velasco et al., 2007). Alternatively, excess amounts of CP are sequestered in the nucleus of the infected cell, thus restricting its functions as was reported for the suppressor protein P19 of Tomato bushy stunt virus (Canto et al., 2006). It has been reported that the suppressor of RNA

B. Meng, C. Li / Virus Research 153 (2010) 212–217

silencing, 2b, encoded by CMV is localized to the nucleus (Lucy et al., 2000). It is tempting to suggest that GRSPaV CP may be involved in RNA silencing suppression. To our knowledge, this is the first report of a RNA plant virus for which the CP actively targets to the nucleus. It is important to point out that these findings were obtained from transient expression. It would be prudent to test if similar localization would occur under the context of viral infection. Acknowledgements This research was supported by NSERC Discovery Grant (400163) awarded to B. Meng. We thank K. Mann for reviewing the manuscript and for comments. References Aminev, A.G., Amineva, S.P., Palmenberg, A.C., 2003. Encephalomyocarditis virual protein 2A localizes to nucleoli and inhibits cap-dependent mRNA translation. Virus Research 95, 45–57. Bracha-Drori, K., Shichrur, K., Katz, A., Oliva, M., Angelovici, R., Yalovsky, S., Ohad, N., 2004. Detection of protein-protein interactions in plants using bimolecular fluorescence complementation. Plant J. 40, 419–427. Callaway, A., Giesman-Cookmeyer, D., Gillock, E.T., Sit, T.L., Lommel, S.A., 2001. The multifunctional capsid proteins of plant RNA viruses. Annu. Rev. Phytopathol. 39, 419–460. Canto, T., Uhrig, J.F., Swanson, M., Wright, K.M., MacFarlane, S.A., 2006. Translocation of Tomato bushy stunt virus P19 protein into the nucleus by ALY proteins compromises its silencing suppressor activity. Journal of Virology 80, 9064–9072. Cohen, Y., Qu, F., Gisel, A., Morris, T.J., Zambryski, P.C., 2000. Nuclear localization of turnip crinkle virus movement protein p8. Virology 273, 276–285. Horton, P., Park, K.J., Obayashi, T., Fujita, N., Harada, H., Adams-Collier, C.J., Nakai, K., 2007. WoLF PSORT: protein localization predictor. Nucleic Acid Research, 1–3 (open access article). Jach, G., Pesch, M., Richter, K., Frings, S., Uhrig, J.F., 2006. An improved mRFP1 adds red to bimolecular fluorescence complementation. Nature Methods 3, 597–600. Karp, G., 2010. Cell and molecular biology: concepts and experiments., 6th Edition. John Wley and Sons, Inc. Hoboken, New Jersey. Koonin, E.V., Dolja, V.V., 1993. Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Crit. Rev. in Biochem. and Mol. Biol 28, 375–430. Lin, N.-S., Hsieh, C.-E., Hue, Y.-H., 1996. Capsid protein of cucumber mosaic virus accumulates in the nuclei and at the periphery of the nucleoli in infected cells. Arch. Virology 141, 727–732. Lucy, A.P., Guo, H.-S., Li, W.-X., Ding, S.-W., 2000. Suppression of post-transcriptional gene silencing by a plant viral protein localized in the nucleus. The EMBO J. 19, 1672–1680.

217

Makarova, K.S., Aravind, L., Koonin, E.V., 2000. A novel superfamily of predicted cysteine proteases from eukaryotes, viruses and Chlamydia pneumoniae. Trends Biochem. Sci. 25, 50–52. Martelli, G.P., Adams, M.J., Kreuze, J.F., Dolja, V.V., 2007. Family Flexiviridae: a case study in virion and genome plasticity. Annu. Rev. Phytopathol. 45, 73– 100. Martin, F., Aerts, A., Ahren, D., and others, 2008. The genome of Laccaria bicolor provides insights into mycorrhizal symbiosis. Nature 452, 88–92. Meng, B., Pang, S., Forsline, P., McFerson, R., Gonsalves, D., 1998. Nucleotide sequence and genome structure of Grapevine rupestris stem pitting associated virus-1 reveal similarities to apple stem pitting virus. J. Gen. Virol. 79, 2059–2069. Meng, B., Credi, R., Petrovic, N., Tomazic, I., Gonsalves, D., 2003. Antiserum of recombinant virus coat protein detects Rupestris stem pitting associated virus in grapevines. Plant Disease 87, 515–522. Meng, B., Gonsalves, D., 2007. Grapevine rupestris stem pitting-associated virus: A decade of research and future perspectives. Plant Viruses 1, 52–62. Minafra, A., Casati, P., Elicio, V., Rowhani, A., Saldarelli, P., Savino, V., Martelli, G.P., 2000. Serological detection of grapevine rupestris stem pitting-associated virus (GRSPaV) by a polyclonal antiserum to recombinant virus coat protein. Vitis 39, 115–118. Morozov, S.Y., Solovyev, A.G., 2003. Triple gene block: modular design of a multifunctional machine for plant virus movement. J. Gen. Virol. 84, 1351–1366. Petrovic, N., Meng, B., Ravnikar, M., Mavric, I., Gonsalves, D., 2003. First detection of Rupestris stem pitting associated virus particles by antibody to a recombinant coat protein. Plant Disease 87, 510–514. Rebelo, A.R., Niewiadomski, S., Prosser, S.W., Krell, P., Meng, B., 2008. Subcellular localization of the triple gene block proteins encoded by a Foveavirus infecting grapevines. Virus Research 138, 57–69. Restrepo, M.A., Freed, D.D., Carrington, J.C., 1990. Nuclear transport of plant potyviral proteins. The Plant Cell 2, 987–998. Rowland, R.R.R., Yoo, D., 2003. Nucleolar-cytoplasmic shuttling of PRRSV nucleocapsid protein: a simple case of molecular mimicry or the complex regulation by nuclear import, nucleolar localization and nuclear export signal sequence. Virus Research 95, 23–33. Strauss, J.H., Strauss, E.G., 1994. The Alphaviruses: gene expression, replication, and evolution. Microbiology Reviews 58, 491–562. Velasco, R., et al., 2007. A high quality draft consensus sequence of the genome of a heterozygous grapevine variety. Plos One 2, E1326. Verchot-Lubicz, J., Ye, C.M., Bamunusinghe, D., 2007. Molecular biology of potexvirus: recent advances. J. Gen. Virol. 88, 1643–1655. Voinnet, O., 2005. Induction and suppression of RNA silencing: insights from viral infections. Nature Review Genetics 6, 206–220. Walter, M., Chaban, C., Schutze, K., Batistic, O., Weckermann, K., Nake, C., Blazevic, D., Grefen, C., Schumacher, K., Oecking, C., Harter, K., Kudla, J., 2004. Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant J. 40, 428–438. Wang, Y., Tzfire, T., Gaba, V., Citovsky, V., Palukaitis, P., Gal-On, A., 2004. Functional analysis of the Cucumber mosaic virus 2b protein: pathogenicity and nuclear localization. J. Gen. Virol. 85, 3135–3147. Zhang, Y.-P., Uyemoto, J.K., Golino, D.A., Rowhani, A., 1998. Nucleotide sequence and RT-PCR detection of a virus associated with grapevine rupestris stem-pitting disease. Phytopathology 88, 1231–1237.