- Email: [email protected]
The function and properties of the transcriptional regulator COS1 in Magnaporthe oryzae
f u n g a l b i o l o g y 1 1 7 ( 2 0 1 3 ) 2 3 9 e2 4 9
journal homepage: www.elsevier.com/locate/funbio
The function and properties of the transcriptional regulator COS1 in Magnaporthe oryzae Xiaoyu LIa,b, Xiuxiu HANb, Zhiqiang LIUb, Chaozu HEa,b,* a
State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China Hainan Key Laboratory for Sustainable Utilization of Tropical Bioresources, Hainan University, Haikou 570228, China
b
article info
abstract
Article history:
The conidiophore stalk-less1 (COS1) gene encodes a novel transcription factor in Magna-
Received 9 August 2012
porthe oryzae, and mutation of COS1 (M2942) resulted in developmental failure of conidio-
Received in revised form
phores. COS1 putatively encodes a 491-amino-acid protein, which contains four multiple
22 December 2012
adjacent C2H2-type zinc-finger domains. The motifs are homologous to the zinc-finger pro-
Accepted 27 January 2013
tein Azf1 of Saccharomyces cerevisiae. Here, we report that the differences of expression pro-
Available online 27 February 2013
file between M2942 and the wild-type isolate Y34 by RNA-Sequence. DNA sequence
Corresponding Editor:
analysis of promoter regions of those of COS1-dependent genes showed enrichment in
Steven Harris
the DNA sequence AAAAGAAA (A4GA3), the putative COS1-binding motif. Gel shift experiments showed that COS1 binds to DNA elements with A4GA3 motif. These suggest that
Keywords: COS1
many of the COS1-dependent transcripts may be regulated directly by COS1 binding. ª 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
C2H2 zinc-finger protein Gel shift assay Magnaporthe oryzae RNA-Sequence
Introduction Magnaporthe oryzae is an ascomycete fungus and the causal agent of rice blast, the most destructive disease of rice worldwide. Rice blast has also served as an important model for studying molecular plantepathogen interactions because of its economic significance and genetic tractability of the host and pathogen. The availability of the genome sequences of both rice and the fungus has provided a new platform to understand molecular pathogenesis at the genome level (Valent 1990; Dean et al. 2005; Ebbole 2007). Like most fungal pathogens, conidia (asexual spores) of M. oryzae play a central role in the disease cycle. Understanding the molecular mechanisms involved in conidiation and appressorium development is a prerequisite to provide novel strategies for disease management.
The molecular mechanisms of conidiation have been characterized in Aspergillus nidulans and Neurospora crassa (Springer & Yanofsky 1989; Adams et al. 1998). In A. nidulans, wetA, brlA, and abaA have been proposed to define a central regulatory pathway that acts in concert with other genes to control conidiation-specific gene expression and determine the order of gene activation during conidiophore development and spore maturation. Mutations in any of these three genes block asexual sporulation at a specific stage in conidiophore morphogenesis. Many developmental regulator-encoding genes, including ‘fluffy’ genes such as fluG, flbE, flbD, flbB, flbC, and flbA, have been characterized in this pathway (Adams et al. 1998). In N. crassa, many conidium-specific genes have also been reported (Springer & Yanofsky 1989), such as con2, fld, con3, and fl (Springer & Yanofsky 1989). Mutations
* Corresponding author. State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China. E-mail address: [email protected] (C. He). 1878-6146/$ e see front matter ª 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.funbio.2013.01.010
240
of con2 and fld block the formation of minor constriction budding, and con3 and fl are related to the formation of minor constriction budding. A comparative genome-wide analysis revealed that a variety of transcription factors (TFs) are abundantly present in metazoans, including fungi (Colot et al. 2006). M. oryzae appears to possess over 400 TF genes, but only a few have been characterized. ACR1 causes a hypermorphic conidiation phenotype where indeterminate growth of the conidial tip cell results in the production of head-to-tail arrays of spores, and mutants of ACR1 are nonpathogenic and fail to undergo infection-related morphogenesis. ACR1 might be a stagespecific negative regulator of conidiation that is required to establish a sympodial pattern of spore formation (Lau & Hamer 1998). Con7 encodes a C2H2 zinc-finger TF required for the transcription of several genes which participate in disease-related morphogenesis in Magnaporthe grisea. These include the pathogenicity factor-encoding gene PTH11 and several other genes which like PTH11 are predicted to encode G proteincoupled receptors. Microarray analysis also revealed several Con7pdependent genes which may encode factors determining cell wall structure or function (Odenbach et al. 2007). Homoeobox TFs MoHOX1eMoHOX8 were identified from the M. oryzae genome. MoHOX2 is essential for conidiogenesis, but not for appressorium-related pathogenic development. MoHOX7 is a key regulator, essential for appressorium development on both hyphal tips and conidial germ tubes (Kim et al. 2009). The gene Mosfl1 encodes a heat shock TF. Deletion of Mosfl1 resulted in less conidiation but has a normal growth rate (Li et al. 2011). MoAP1 shows several conserved domains including a bZIP DNA-binding domain. MoAP1 is necessary for aerial hyphal growth but not mycelial radial growth, and disruption of MoAP1 resulted in abnormal conidium morphology and reduction in conidia formation (Guo et al. 2011). The other bZIP transcriptional factor Moatf1, which is homologous to ATF/ CREB from yeasts to mammals plays an important role in response to oxidative stress conditions and is required for full virulence of M. oryzae (Guo et al. 2010). RNA-Sequence (RNA-Seq) is a recently developed highthroughput sequencing method that uses deep-sequencing technologies to produce millions of short cDNA reads. The resulting reads are either aligned to a reference genome or reference transcripts, or assembled de novo without the genomic sequence to produce a genome-scale transcription profile that consists of both the transcriptional structure and/or level of expression for each gene (Mortazavi et al. 2008). RNA-Seq is a powerful tool for transcriptome analysis and enables a gene expression profiling assay even at the single-cell level (Tang et al. 2009). Sequencing of RNA has been recognized as an efficient method for gene discovery and the gold standard for annotation of both coding and noncoding genes (Adams et al. 1991; Haas et al. 2002). In a previous study, we characterized a novel zinc-finger protein-encoding gene, conidiophore stalk-less1 (COS1). Mutation of COS1 (M2942) resulted in developmental failure of conidiophores. COS1 putatively encodes a 491-amino-acid protein with four multiple adjacent C2H2-type zinc-finger domains (Zhou et al. 2009). In this study, we report that the differences of expression profile between M2942 and the wild-type Y34 by RNA-Seq. The putative binding sites were searched in the promoter regions of COS1-dependent genes, and gel shift
X. Li et al.
experiments showed that COS1 bound to DNA elements with the sequence AAAAGAAA (A4GA3).
Materials and methods Strain and RNA isolation A Chinese field strain of Magnaporthe oryzae Y34 was used in this study as the wild type. The strain is a gift from J. Li of the Yunnan Academy of Agricultural Science, China. Other strains used in this study are derivates from strain Y34. Except for cultures with specific requirements, all strains were cultured on oatmeal agar plates at 28 C for several days. For conidiation, strain blocks were maintained on oatmeal agar plates at 28 C for 7 d in the dark followed by 3 d of continuous illumination under light. For total RNA isolation, aerial mycelia were harvested from plates with a triangular scraper. Total RNA was isolated from aerial mycelia as previously described (Zhou et al. 2009) and RNA integrity confirmed using a 2100 Bioanalyzer (Agilent Technologies).
Synthesis of cDNA and sequencing After extracting the total RNA from the samples, the mRNA was enriched by using the oligo(dT) magnetic beads and mRNA was enriched just by removing rRNAs from the total RNA. Adding the fragmentation buffer, the mRNA was interrupted to short fragments (about 200 bp), then the firststrand cDNA was synthesized by random hexamer-primer using the mRNA fragments as templates. Buffer, dNTPs, RNase H, and DNA polymerase I were added to synthesize the second strand. The double strand cDNA was purified with QiaQuick PCR extraction kit and washed with EB buffer for end repair and single nucleotide A (adenine) addition. Finally, sequencing adaptors were ligated to the fragments. The required fragments were purified by agarose gel electrophoresis and enriched by PCR amplification. The library products were ready for sequencing analysis via Illumina HiSeq 2000.
RNA-Seq data analysis Total RNAs were isolated from M2942 and Y34, the mRNA was selectively enriched through rRNA depletion. These samples were fragmented and used to obtain cDNA libraries that were sequenced. The original image data is transferred into sequence data by base calling, which is defined as raw reads. To get the clean reads, removing the dirty raw reads is needed before data analysis. Clean reads were mapped to reference sequences using SOAPaligner/soap2 (Li et al. 2009) allowing for 1 and 2 nt mismatches. To identify the genes regulated by COS1, the libraries were initially compared by pairs; for this, the number of reads for each coding region was determined, the number of total reads was normalized by using RPKM (Mortazavi et al. 2008) method (Reads Per kb per Million reads) between these libraries and the log2ratio of RPKM between M2942 and Y34 was calculated. The genes that showed an absolute value of log2ratio 1 and FDR (False Discovery Rate) 0.001 were considered potential candidates.
The function and properties of COS1 in M. oryzae
Quantitative RT-PCR For quantitative real-time RT-PCR (qRT-PCR), 5 mg of total RNA were reverse transcribed into first-strand cDNA using the oligo(dT) primer and M-MLV Reverse Transcriptase (Invitrogen). qRT-PCR reactions were performed following previously established procedures (Kim et al. 2005). Primers used in this study were designed by using Primer Premier (version 5.0) and commercially synthesized (Invitrogen Co., Beijing, China). The b-tubulin gene was included as a control. The ABI 7500 RealTime PCR system was used for PCRs that consisted of 1 min at 95 C (1 cycle) followed by 5 s at 95 C, 15 s at 56 C, and 15 s at 72 C (40 cycles). Each qRT-PCR mixture (final volume 20 ml) contained 10 ml of Power SYBRH Green PCR Master Mix (Applied Biosystems), 0.8 ml of forward and reverse primers (10 mM
A
241
concentrations for each), and 2 ml of cDNA template. To compare the relative abundance of target gene transcripts, the average threshold cycle (Ct) was normalized to that of b-tubulin (MGG_00604.6) for each of the treated samples as 2DCt, where DCt ¼ (Ct, target gene Ct, b-tubulin). Fold changes during fungal development and infectious growth in liquid CM were calculated as 2DDCt, where DDCt ¼ (Ct, target gene Ct, b-tubulin) (Ct, WT Ct, b-tubulin) (Choi et al. 2009). qRT-PCR was performed with three independent pools of tissues in two sets of experimental replicates.
Bioinformatics analysis The full sequence of COS1 was downloaded from the Magnaporthe oryzae online database (www.broadinstitute.org/ annotation/genome/magnaporthe_oryzae). COS1 orthology sequences from different organisms were obtained from GenBank (www.ncbi.nlm.nih.gov/BLAST) using the BLAST algorithm. Sequence alignments were performed using the Clustal_W program, and the phylogenetic tree was constructed using the Mega3.0 Beta program with neighbourjoining method. To predict putative COS1-binding sites, Azf1 in Saccharomyces cerevisiae binding motif sequences (A4GA3) were used to search in the 800 bp-upstream sequences set of the downregulated genes using Regulatory Sequence Analysis Tools (RSAT, http://rsat.scmbb.ulb.ac.be/rsat/), and no mismatch was allowed (Slattery et al. 2006).
B
Fig 1 e Fold change of selected genes determined by qRTPCR. (A) Six upregulated genes and six downregulated genes were randomly selected and validated. a, MGG_00574.6, galactan 1,3-beta-galactosidase (log2ratio (M2942/Y34) 2.4); b, MGG_04244.6, proline oxidase PrnD (2.1); c, MGG_05364.6, endoglucanase-4 (2); d, MGG_08046.6, bilirubin oxidase (2.0); e, MGG_07697.6, superoxide dismutase (1.9); f, MGG_04234.6, hexose transporter protein (1.6); g, MGG_03299.6, inorganic phosphate transporter PHO84 (L4.6); h, MGG_06751.6, conserved hypothetical protein (L3.1); i, MGG_09014.6, conserved hypothetical protein (L2.3); j, MGG_02252.6, 4HN reductase (L2.2); k, MGG_08458.6, chitinase 1 precursor (L1.8); l, MGG_04890.6, plasma membrane calcium-transporting ATPase 4 (L1.3). (B) Correlation between the expression ratios of selected genes determined by qRT-PCR and RNA-Seq.
Fig 2 e Functional grouping of genes up- or downregulated in M2942. The genes were divided into 21 groups according to their putative functions. In every group, the number of genes, the percentage of the gene to this GO category in the whole genome, and the P-value were also listed in the figure as: number (%, P-value). The GO terms with P-value £ 0.05 were defined as significantly enriched GO terms.
242
Plasmid construction and expression of recombinant COS1 protein To construct a recombinant expression vector containing COS1 gene, the primers for amplification of the gene encoding
X. Li et al.
COS1 were designed according to the sequence of the gene COS1. The forward primer was: CGCGGATCCATGAGCAC TATGCAACCT (contained a BamHI cleavage site, underlined) and the reverse primer was: CCGGAATTCTTAGTGACGTT GACCAGC (contained a EcoRI cleavage site, underlined). The
Fig 3 e Functional domain comparisons of COS1 in different organisms. (A) Alignment of the conserved domain of COS1 from M. oryzae with those from other organisms was performed using the Clustal_W program. Identical amino-acid residues were highlighted with dark grey background, close similar amino-acid residues were shaded with light grey, and distant similar amino acids were not shaded. (B) A phylogenetic tree of COS1, generated by the PHYLIP 3.56 program, based on alignment of the full sequences of C2H2 TF from fungus and yeasts. The sequences were from organisms as follows: Verticillium dahliae VdLs.17, Saccharomyces cerevisiae S288c, Aspergillus niger CBS 513.88, Aspergillus flavus NRRL 3357, Aspergillus fumigatus Af293, Neosartorya fischeri NRRL 181, Penicillium chrysogenum Wisconsin 54-1255, Pichia pastoris GS115, Neurospora crassa, Magnaporthe oryzae 70-15.
Fig 4 e Putative downregulated genes affected by COS1. The downregulated genes affected by COS1 were determined as described in Materials and methods and are grouped by functional categories based on GO. Each group was examined for enrichment of promoter sequences by use of RSAT (http://rsat.scmbb.ulb.ac.be/rsat/). Each gene is accompanied by a representation of its promoter (up to 800 bp upstream, with each tick marking 100 bp). Rectangles represent the positions of A4GA3 elements.
244
X. Li et al.
Fig 4 e (Continued)
PCR products were digested with BamHI and EcoRI, and ligated into pET-32a(þ) digested with the same enzymes, and transformed into Escherichia coli BL21 (DE3) and transformants were selected on the LB plate containing 30 mg ml1 of ampicillin. In order to improve expression of the soluble recombinant protein, after IPTG (final concentration 1.0 mmol l1) was added for induction, the cultures were grown at 20 C overnight.
Purification of recombinant COS1 protein The cells in the induced culture were harvested and washed. Then, the cell pellets were submitted to ultrasonication using
an Ultrasonic Homogenizer (400 W model, amp, Sonics & Materials Inc., USA) at maximum output in ice. After disruption by ultrasonication and removal of cell debris by centrifugation at 14 006g and 4 C for 20 min, the supernatant (cell-free extract) obtained was applied onto a Ni-NTA spin column (Ni Sepharose 6 Fast Flow purchased from GE Healthcare Company). The purification of recombinant COS1 protein was carried out according to the protocols offered by the manufacturer (GE Healthcare Company). The eluted 6 His-tagged fusion protein was assayed by SDS-PAGE. To confirm the recombinant protein expression as a His-tagged fusion protein, western blot analysis was carried out using monoclonal mouse-anti-His-Tag antibody (TIANGEN, China) as the primary antibody and goat anti-mouse IgG
The function and properties of COS1 in M. oryzae
245
Fig 4 e (Continued)
antibody conjugated with horseradish peroxidase (HRP) (TIANGEN, China) as the secondary antibody.
Gel shift assays To determine whether the identified A4GA3 motifs provide a binding site for COS1, we selected a 25 bp doublestranded DNA fragment (50 -AAAAAAAGAAAAAAAAAAAG AAAAA-30 ) from the MGG_03813.6 promoter containing a pair of A4GA3 motifs as a gel shift probe. MGG_03813.6 expression is downregulated (13.1) by COS1, and the promoter of MGG_03813.6 contains A4GA3 sequences. The probe was synthesized by invitrogen (Shanghai, China) and labelled by biotin. The purified 6 His-tagged fusion COS1 protein and the labelled probe were incubated for 30 min at room temperature in EMSA buffer, and the reaction mix was loaded into the individual lanes of a 6 % native polyacrylamide gel. The probe was detected using chemiluminescence. The
monoclonal mouse-anti-His-Tag antibody (TIANGEN, China) was used. The unlabelled fragment used as a competitor and the unlabelled fragment containing the A4GA3 motif mutation (50 -AAAAACATAAAAAAAAACATAAAAA-30 ) was used as a mutant competitor.
Results Transcriptional profiling of Magnaporthe oryzae by highthroughput RNA sequencing To identify genes influenced by COS1 in M. oryzae, we first search for genes that were differentially expressed in M2942. A total of 5 929 051 and 6 252 355 reads were obtained for each library (‘M2942’ and ‘Y34’, respectively). Of these, 5 356 636 (M2942) and 5 673 638 (Y34) reads mapped to multiple targets in the genome and 5 204 390 (M2942) and 5 492 494
246
(Y34) mapped uniquely. The clean reads account for 98.88 % (M2942) and 98.85 % (Y34) of raw reads, respectively. To identify the genes that are upregulated or downregulated in M2942, we normalized the number of reads for each pair of libraries, and the number of reads for each gene was compared. The genes that reproducibly showed a log2ratio larger than 1 or below 1 and an FDR of 0.001 or less were screened. Four hundred and forty two genes passed the criterions. From these, 88 genes were upregulated and 354 were downregulate in M2942. The information of up- and downregulated genes was listed in Table S1. To validate the induction of some of the genes identified by RNA-Seq, we carried out qRT-PCR experiments. Six upregulated genes and six downregulated genes were randomly selected and validated. The results showed that most gene (except MGG_03299.6) expression pattern were consistent with that in the RNA-Seq data, despite the discrepancy of the fold change in qRT-PCR than in RNA-Seq data (Fig 1A). Moreover, the fold change detected for each gene was similar to the ratio of induction and repression observed by RNASeq (Fig 1B). We then carried out GO (Gene Ontology) function prediction and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis. Based on sequence homology, 442 genes were categorized into different functional groups, belonging to three main GO ontologies: molecular function, cellular component, and biological process. Of these, 21 groups according to their putative functions were shown in Fig 2. We noted that a high percentage of genes from categories of ‘ion binding’, ‘oxidoreductase activity’, ‘hydrolase activity’, ‘cellular metabolic process’, ‘transport’, and ‘membrane’. To identify active biological pathways, the 442 genes were mapped to the reference canonical pathways in KEGG. The KEGG database contains systematic analysis of inner-cell metabolic pathways and functions of gene products, which aid in studying the complex biological behaviours of genes. In total, 442 genes were assigned to 102 KEGG pathways. The pathways with most representation were ‘metabolic pathways’ (70 members), ‘biosynthesis of secondary metabolites’ (28), ‘gamma-Hexachlorocyclohexane degradation’ (22), ‘Naphthalene and anthracene degradation’ (21), ‘Limonene and pinene degradation’ (20), ‘Stilbenoid, diarylheptanoid and gingerol biosynthesis’ (14), ‘Glycerophospholipid metabolism’ (12).
X. Li et al.
COS1 recognizes the A4GA3 motif upstream of its target genes We examined the upstream regions of the genes that are downregulated by COS1 to determine whether these genes have A4GA3 motif sequences in common. As shown in Fig 4, the A4GA3 motif was found in the upstream of many genes form different GO categories, such as ‘transport’, ‘lipid metabolic process’, ‘carbohydrate metabolic process’, ‘protein metabolic process’, ‘cellular amino acid metabolic process’, ‘nucleic acid metabolic process’, ‘nucleotide binding’, ‘metal ion binding’, ‘oxidoreductase activity’, etc. In these groups, this motif was found in ‘transport’ and ‘metal ion binding’ at frequencies much higher than others. To determine whether the identified A4GA3 motifs provide a binding site for COS1, we obtained the purified recombinant COS1 protein. The COS1 gene was fused to the pET-32a(þ) vector and expressed in Escherichia coli BL21 (DE3) (Fig 5A). Then the recombinant COS1 protein was purified by affinity chromatography using a Ni-NTA column. SDS-PAGE analysis showed that there was only one single protein band from the finally concentrated elute with a molecular mass about 72 kDa (Fig 5B), and western blotting demonstrate that the specific band was indeed the His-tagged fusion protein of COS1 (Fig 5C). We selected a region from MGG_03813.6 promoter containing a pair of A4GA3 motifs as a gel shift probe. Recombinant COS1 protein and the probes formed a proteineDNA complex (Fig 6). This complex was seriously affected by unlabelled probe (competitor), while the unlabelled mutant competitor did not affect the formation of the DNAeprotein complex. In the supershift assay, the molecular mass of DNAeprotein complex became larger than before because of the antibody binding to recombinant COS1 protein. Our experiments indicate that COS1 can directly bind the A4GA3 motifs, suggesting that COS1 may regulate gene expression by DNA binding.
COS1 is homologous to Azf1 of Saccharomyces cerevisiae The gene COS1 putatively encodes a 491-amino-acid protein, which is identical to ABB89847 in GenBank. Sequence analysis indicated that COS1 contains four adjacent C2H2-type zincfinger domains from position 187 to 300 (Fig 3A). The motifs are homologous to the zinc-finger protein Azf1 in S. cerevisiae (Stein et al. 1998). Except in the motif regions, COS1 does not show any significant homology with other known proteins, suggesting that it is a novel zinc-finger protein. The phylogenetic tree based on the full sequence comparison of C2H2 TF from fungus and yeasts revealed that the COS1 sequence is most similar to sequences from Neurospora crassa (CAC18195), S. cerevisiae (NP_014756), and Verticillium dahliae (EGY18118) (Fig 3B), with the similarities of 51 %, 53 %, 53 % respectively.
Fig 5 e Expression of COS1 in E. coli BL21 and western blot analysis. (A) M, Marker; 1, the cell-free extract from the induced transformants carrying pET-32a(D); 2, the cell-free extract from the transformants carrying pET-32a(D) fused COS1. (B) M, Marker; 1, the unpurified cell-free extract; 2, the purified recombinant COS1 protein. (C) Western blotting analysis of the purified recombinant COS1 protein.
The function and properties of COS1 in M. oryzae
Fig 6 e EMSAshowing in vitro binding of COS1 to the probe with A4GA3 motifs. His-tag recombinant COS1 protein purified from E. coli BL21 (DE3) and the 25 bp biotin-labelled double-stranded DNA fragment containing a pair of A4GA3 motifs were used in the protein-binding assay. The unlabelled fragment used as a competitor and the unlabelled fragment containing the A4GA3 motif mutation was used as a mutant competitor.
Discussion In this study, we utilized the transcription analysis by the RNA-Seq approach to identify genes whose expression is regulated by COS1. Since COS1 may be a transcriptional regulator, and it is essential for conidiophore development, we speculate that COS1 acts as a TF that modulates the expression of some conidiation-related genes, and their expression levels in RNASeq database were summarized in Table 1. The expression of the genes CON7, ACR1, MoSTUA, MoAPS1, MoAPS2, MoFLBA, MoFLBC, MoFLBD, MoFLUG were not significantly changed,
247
which were excluded with an absolute value of log2ratio < 1 and FDR > 0.001. These results indicate that these genes may not be direct targets of COS1. In our RNA-Seq database, 65 % of the genes downregulated severely (log2ratio (M2942/ Y34) < 4.0) were hypothetical or predicted protein implying that COS1 may involve in a new regulatory pathway. As shown in Table 1, the expression of gene MoCON6 (MGG_02246.6) was obviously downregulated (4.3). The conidiation-specific gene con-6 of Neurospora crassa is preferentially expressed during the formation of asexual spores, though inactivation of con-6 by the repeat-induced point mutation process had no demonstrable effect on formation or germination of conidia (White & Yanofsky 1993). A deletion mutant of MoCON6 has generated, and no obvious difference with the phenotype of the wild-type Y34 was observed (unpublished). The RSAT prediction showed that MoCON6 had no A4GA3 motif in its upstream sequence, suggesting that MoCON6 might not be regulated by COS1 directly. In previous study, the mutant M2942 was markedly deficient in melanin (Zhou et al. 2009). Melanin plays an important role in pathogenicity for many phytopathogenic fungi (Howard & Ferrari 1989). It may also contribute to spore development. Targeted disruption of a gene BRM2 encoding trihydroxynaphthalene reductase (3HNR) from Alternaria alternata had shown that this gene was required for conidial development (Kawamura et al. 1999). In Magnaporthe oryzae, melanin biosynthesis proceeds through a pentaketide route, joining acetate units to make tetrahydroxynaphthalene (4HN) (Bell & Wheeler 1986). The 4HN is then transformed into dihydroxynaphthalene (2HN) through a succession of two reduction and two dehydration steps. In the reduction steps, the 4HNR catalyses the reduction of 4HN to scytalone and 3HNR converts 3HN to vermelone (Fig 7) (Bhadauria et al. 2010). The RNA-Seq data shown that the gene (MGG_02252.6) encoding 4HNR was downregulated (2.2) by COS1, and another gene Cmr1 (Mgg_07 215.6) was also downregulated (1.2). It has been reported that Cmr1p positively regulated the transcription of 3HNR and SCD during mycelial melanisation (Tsuji et al. 2000). This might be the reason why M2942 produced less melanin than wild-type Y34. In the yeasts and fungus, mitogen-activated protein kinase (MAPK) signalling pathways are involved in the regulation of various cellular responses, including mating, filamentation,
Table 1 e RNA-Seq data for conidiation-related genes in M. oryzae. Gene CON7 ACR1 MoSTUA MoAPS1 MoAPS2 MoFLBA MoFLBC MoFLBD MoFLUG MoCON6 MoCON8
Locus number
Description, mutant phenotype
Log2ratio
Reference
MGG_05287.6 MGG_09847.6 MGG_00692.6 MGG_09869.6 MGG_08463.6 MGG_14517.5 MGG_04699.6 MGG_06898.6 MGG_02538.6 MGG_02246.6 MGG_00513.6
C2H2 zinc-finger TF, abnormal conidia Hypothetical protein with a glutamine-rich domain, acropetal conidia APSES TF, severe reduction in conidial production APSES TF, reduction in conidial production APSES TF, reduction in conidial production Putative regulator of G protein signalling, orthologue to flbA in A. nidulans C2H2 zinc-finger TF, orthologue to flbC in A. nidulans MYB TF, orthologue to flbD in A. nidulans Putative glutamine synthetase, orthologue to fluG in A. nidulans Hypothetical protein, orthologue to con-6 in N. crassa Hypothetical protein, orthologue to con-8 in N. crassa
0.1 0.4 0.4 0.1 0.1 0.1 0.3 0.6 0.3 4.3 1.2
Odenbach et al. (2007) Lau & Hamer (1998) Unpublished data Unpublished data Unpublished data Wieser et al. (1994) Wieser et al. (1994) Wieser et al. (1994) Lee & Adams (1994) Madi et al. (1994) Madi et al. (1994)
248
X. Li et al.
Fig 7 e Fungal melanin biosynthetic pathway (Bhadauria et al. 2010).
cell integrity, the response to high osmolarity, and ascospore formation. The FUS3 and KSS1 kinases are important components of the mating-pheromone response pathway and filamentation-invasion pathway (Gustin et al. 1998). In our results, the gene PMK1 (MGG_09865.6, homologous to the FUS3/ KSS1) was downregulated (1.6), which was the most significant change in MAPK signalling pathways. However, it has been reported that the PMK1 mutants of M. oryzae fail to form appressoria and fail to grow infectiously in rice plants with no defect in vegetative growth and asexual reproduction (Xu & Hamer 1996). There has been no evidence that PMK1 had some relation with conidiophore development, so COS1 regulating conidiophore development may not be through the MAPK signalling pathway. Compared with the wild type, the mutant grew normally on CM supplemented with 1 M sorbitol as an osmotic stress, under high temperature stress at 34 C, and with peroxide as an oxidative stress (Zhou et al. 2009). RNA-Seq data showed that COS1 had not obvious effects on the signal pathways that regulate cell integrity and the response to high osmolarity, and this was consistent with the M2942’s responses to environmental stresses. Transcriptional regulation is a major mechanism by which alterations in the expression of specific subsets of genes determine development and differentiation in cells. TFs play important roles in fungal development and pathogenicity as regulators in biological networks. The functional analysis of TFs provides new insights into a controlling network that governs fungal development and pathogenicity. The gene pro1 of the chestnut blight fungus Cryphonectria parasitica encodes a Zn(II)2Cys6 binuclear cluster DNA-binding protein and it is required for female fertility, asexual spore development, and stable maintenance of hypovirus infection (Masloff et al. 1999). RosA in the filamentous fungus Aspergillus nidulans have characterized the putative Zn(II)2Cys6 TF, which can repress sexual development upon integration of several environmental signals (Vienken et al. 2005). The protein encoded by COM1 has a putative helix-loop-helix structure that is characteristic of many TFs, and is required for normal conidium morphology and full virulence in M. oryzae (Yang et al. 2010). MgCRZ1, from M. oryzae, which contained two conserved C2H2-type zinc-finger motifs, and it is required for growth and development and is a crucial virulence determinant in this model phytopathogen (Zhang et al. 2009). MST12 contains two tandem C2/H2eZnþ2 finger domains near the C-terminus (residues 566e611) that are conserved only in STE12
homologues from filamentous fungi. MST12 regulates infectious growth but not appressorium formation in the rice blast fungus M. oryzae (Park et al. 2002). Though more and more TFs have been characterized, there is little research on the binding sites of TFs from M. oryzae. In this study, we confirmed that the binding site of C2H2 zinc-finger protein COS1 was A4GA3, which is the first report in M. oryzae. In conclusion, we identified genes influenced by COS1 in M. oryzae, and RNA-Seq database showed that 88 genes were upregulated and 354 were downregulate in M2942. COS1 encoding a C2H2 zinc-finger protein is homologous to Azf1 of Saccharomyces cerevisiae, and binding motif sequences (A4GA3) were used to search in the promoter sequences of the downregulated genes using RSAT. Gel shift experiments indicated that COS1 bound to A4GA3 motifs. The roles of COS1 in conidiophore development will be further studied.
Acknowledgement This work was supported by the National Natural Science Foundation of China (grant No. 31260418).
Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.funbio.2013.01.010.
references
Adams MD, Kelley JM, Gocayne JD, Dubnick M, Polymeropoulos MH, Xiao H, Merril CR, Wu A, Olde B, Moreno RF, Kerlavage AR, McCombie WR, Venter JC, 1991. Complementary DNA sequencing: expressed sequence tags and human genome project. Science 252: 1651e1656. Adams TH, Wieser JK, Yu JH, 1998. Asexual sporulation in Aspergillus nidulans. Microbiology and Molecular Biology Reviews 62: 35e54. Bell AA, Wheeler MH, 1986. Biosynthesis and function of fungal melanin. Annual Review of Phytopathology 24: 411e451. Bhadauria V, Wang LX, Peng YL, 2010. Proteomic changes associated with deletion of the Magnaporthe oryzae conidial morphology-regulating gene COM1. Biology Direct 5: 61.
The function and properties of COS1 in M. oryzae
Choi J, Kim Y, Kim S, Park J, Lee YH, 2009. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae. Fungal Genetics and Biology 46: 243e254. Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L, Weiss RL, Borkovich KA, Dunlap JC, 2006. A high throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proceedings of the National Academy of Sciences of the United States of America 103: 10352e10357. Dean RA, Talbot NJ, Ebbole DJ, Farman ML, Mitchell TK, Orbach MJ, et al., 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434: 980e986. Ebbole DJ, 2007. Magnaporthe as a model for understanding hostpathogen interactions. Annual Review of Phytopathology 45: 437e456. Guo M, Chen Y, Du Y, Dong YH, Guo W, Zhai S, Zhang HF, Dong SM, Zhang ZG, Wang YC, Wang P, Zheng XB, 2011. The bZIP transcription factor MoAP1 mediates the oxidative stress response and is critical for pathogenicity of the rice blast fungus Magnaporthe oryzae. PLoS Pathogens 7: e1001302. Guo M, Guo W, Chen Y, Dong SM, Zhang X, Zhang HF, Song WW, Wang W, Wang Q, Lv RL, Zhang ZG, Wang YC, Zheng XB, 2010. The basic leucine zipper transcription factor Moatf1 mediates oxidative stress responses and is necessary for full virulence of the rice blast fungus Magnaporthe oryzae. Molecular PlantMicrobe Interactions 23: 1053e1068. Gustin MC, Albertyn J, Alexander M, Davenport K, 1998. MAP kinase pathways in the yeast Saccharomyces cerevisiae. Microbiology and Molecular Biology Reviews 62: 1264e1300. Haas BJ, Volfovsky N, Town CD, Troukhan M, Alexandrov N, Feldmann KA, Flavell RB, White O, Salzberg SL, 2002. Full length messenger RNA sequences greatly improve genome annotation. Genome Biology 3 RESEARCH0029. Howard RJ, Ferrari MA, 1989. Role of melanin in appressorium formation. Experimental Mycology 13: 403e418. Kawamura C, Tsujimoto T, Tsuge T, 1999. Targeted disruption of a melanin biosynthesis gene affects conidial development and UV tolerance in the Japanese pear pathotype of Alternaria alternata. Molecular Plant-Microbe Interactions 12: 59e63. Kim S, Ahn IP, Rho HS, Lee YH, 2005. MHP1, a Magnaporthe grisea hydrophobin gene, is required for fungal development and plant colonization. Molecular Microbiology 57: 1224e1237. Kim S, Park SY, Kim KS, Rho HS, Chi MH, Choi J, Park JS, Kong S, Park J, Goh J, Lee YH, 2009. Homeobox transcription factors are required for conidiation and appressorium development in the rice blast fungus Magnaporthe oryzae. PLoS Genetics 5: e1000757. Lau GW, Hamer JE, 1998. Acropetal: a genetic locus required for conidiophore architecture and pathogenicity in the rice blast fungus. Fungal Genetics and Biology 24: 228e239. Lee BN, Adams TH, 1994. The Aspergillus nidulans fluG gene is required for production of an extracellular developmental signal and is related to prokaryotic glutamine synthetase I. Genes & Development 8: 641e651. Li GT, Zhou XY, Kong LG, Wang YL, Zhang HF, Zhu H, Mitchell TK, Dean RA, Xu JR, 2011. MoSfl1 is important for virulence and heat tolerance in Magnaporthe oryzae. PLoS ONE 6: e19951. Li R, Yu C, Li Y, Lam TW, Yiu SM, Kristiansen K, Wang J, 2009. SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics 25: 1966e1967. Madi L, Ebbole DJ, White BT, Yanofsky C, 1994. Mutants of Neurospora crassa that alter gene expression and conidia development. Proceedings of the National Academy of Sciences of the United States of America 91: 6226e6230.
249
€ ggeler S, Ku € ck U, 1999. The pro1(þ) gene from Sordaria Masloff S, Po macrospora encodes a C6 zinc finger transcription factor required for fruiting body development. Genetics 152: 191e199. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B, 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods 5: 621e628. Odenbach D, Breth B, Thines E, Weber RWS, Anke H, Foster AJ, 2007. The transcription factor Con7p is a central regulator of infection-related morphogenesis in the rice blast fungus Magnaporthe grisea. Molecular Microbiology 64: 293e307. Park G, Xue CY, Zheng L, Lam S, Xu JR, 2002. MST12 regulates infectious growth but not appressorium formation in the rice blast fungus Magnaporthe grisea. Molecular Plant-Microbe Interactions 15: 183e192. Slattery MG, Liko D, Heideman W, 2006. The function and properties of the Azf1 transcriptional regulator change with growth conditions in Saccharomyces cerevisiae. Eukaryotic Cell 5: 313e320. Springer ML, Yanofsky CA, 1989. Morphological and genetic analysis of conidiophore development in Neurospora crassa. Genes & Development 3: 559e571. Stein T, Kricke J, Becher D, Lisowsky T, 1998. Azf1p is a nuclearlocalized zinc-finger protein that is preferentially expressed under nonfermentative growth conditions in Saccharomyces cerevisiae. Current Genetics 4: 287e296. Tang F, Barbacioru C, Wang Y, Nordman E, Lee C, Xu N, Wang X, Bodeau J, Tuch BB, Siddiqui A, Lao K, Surani MA, 2009. mRNASeq whole-transcriptome analysis of a single cell. Nature Methods 6: 377e382. Tsuji G, Kenmochi Y, Takano Y, Sweigard J, Farrall L, Furusawa I, Horino O, Kubo Y, 2000. Novel fungal transcriptional activators, Cmr1p of Colletotrichum lagenarium and Pig1p of Magnaporthe grisea, contain Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in a developmentally specific manner. Molecular Microbiology 38: 940e954. Valent B, 1990. Rice blast as a model system for plant pathology. Phytopathology 80: 33e36. Vienken K, Scherer M, Fischer R, 2005. The Zn(II)2Cys6 putative Aspergillus nidulans transcription factor repressor of sexual development inhibits sexual development under low-carbon conditions and in submersed culture. Genetics 169: 619e630. White BT, Yanofsky C, 1993. Structural characterization and expression analysis of the Neurospora conidiation gene con-6. Developmental Biology 160: 254e264. Wieser J, Lee BN, Fondon JW, Adams TH, 1994. Genetic requirements for initiating asexual development in Aspergillus nidulans. Current Genetics 27: 62e69. Yang J, Zhao XY, Sun J, Kang ZS, Ding SL, Xu JR, Peng YL, 2010. A novel protein Com1 is required for normal conidium morphology and full virulence in Magnaporthe oryzae. Molecular Plant-Microbe Interactions 23: 112e123. Xu JR, Hamer JE, 1996. MAP kinase and cAMP signaling regulate infection structure formation and pathogenic growth in the rice blast fungus Magnaporthe grisea. Genes & Development 10: 2696e2706. Zhang HF, Zhao Q, Liu KY, Zhang ZG, Wang YC, Zheng XB, 2009. MgCRZ1, a transcription factor of Magnaporthe grisea, controls growth, development and is involved in full virulence. FEMS Microbiology Letters 293: 160e169. Zhou ZZ, Li GH, Lin CH, He CZ, 2009. Conidiophore Stalk-less1 encodes a putative zinc-finger protein involved in the early stage of conidiation and mycelial infection in Magnaporthe oryzae. Molecular Plant-Microbe Interactions 22: 402e410.
journal homepage: www.elsevier.com/locate/funbio
The function and properties of the transcriptional regulator COS1 in Magnaporthe oryzae Xiaoyu LIa,b, Xiuxiu HANb, Zhiqiang LIUb, Chaozu HEa,b,* a
State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China Hainan Key Laboratory for Sustainable Utilization of Tropical Bioresources, Hainan University, Haikou 570228, China
b
article info
abstract
Article history:
The conidiophore stalk-less1 (COS1) gene encodes a novel transcription factor in Magna-
Received 9 August 2012
porthe oryzae, and mutation of COS1 (M2942) resulted in developmental failure of conidio-
Received in revised form
phores. COS1 putatively encodes a 491-amino-acid protein, which contains four multiple
22 December 2012
adjacent C2H2-type zinc-finger domains. The motifs are homologous to the zinc-finger pro-
Accepted 27 January 2013
tein Azf1 of Saccharomyces cerevisiae. Here, we report that the differences of expression pro-
Available online 27 February 2013
file between M2942 and the wild-type isolate Y34 by RNA-Sequence. DNA sequence
Corresponding Editor:
analysis of promoter regions of those of COS1-dependent genes showed enrichment in
Steven Harris
the DNA sequence AAAAGAAA (A4GA3), the putative COS1-binding motif. Gel shift experiments showed that COS1 binds to DNA elements with A4GA3 motif. These suggest that
Keywords: COS1
many of the COS1-dependent transcripts may be regulated directly by COS1 binding. ª 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
C2H2 zinc-finger protein Gel shift assay Magnaporthe oryzae RNA-Sequence
Introduction Magnaporthe oryzae is an ascomycete fungus and the causal agent of rice blast, the most destructive disease of rice worldwide. Rice blast has also served as an important model for studying molecular plantepathogen interactions because of its economic significance and genetic tractability of the host and pathogen. The availability of the genome sequences of both rice and the fungus has provided a new platform to understand molecular pathogenesis at the genome level (Valent 1990; Dean et al. 2005; Ebbole 2007). Like most fungal pathogens, conidia (asexual spores) of M. oryzae play a central role in the disease cycle. Understanding the molecular mechanisms involved in conidiation and appressorium development is a prerequisite to provide novel strategies for disease management.
The molecular mechanisms of conidiation have been characterized in Aspergillus nidulans and Neurospora crassa (Springer & Yanofsky 1989; Adams et al. 1998). In A. nidulans, wetA, brlA, and abaA have been proposed to define a central regulatory pathway that acts in concert with other genes to control conidiation-specific gene expression and determine the order of gene activation during conidiophore development and spore maturation. Mutations in any of these three genes block asexual sporulation at a specific stage in conidiophore morphogenesis. Many developmental regulator-encoding genes, including ‘fluffy’ genes such as fluG, flbE, flbD, flbB, flbC, and flbA, have been characterized in this pathway (Adams et al. 1998). In N. crassa, many conidium-specific genes have also been reported (Springer & Yanofsky 1989), such as con2, fld, con3, and fl (Springer & Yanofsky 1989). Mutations
* Corresponding author. State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China. E-mail address: [email protected] (C. He). 1878-6146/$ e see front matter ª 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.funbio.2013.01.010
240
of con2 and fld block the formation of minor constriction budding, and con3 and fl are related to the formation of minor constriction budding. A comparative genome-wide analysis revealed that a variety of transcription factors (TFs) are abundantly present in metazoans, including fungi (Colot et al. 2006). M. oryzae appears to possess over 400 TF genes, but only a few have been characterized. ACR1 causes a hypermorphic conidiation phenotype where indeterminate growth of the conidial tip cell results in the production of head-to-tail arrays of spores, and mutants of ACR1 are nonpathogenic and fail to undergo infection-related morphogenesis. ACR1 might be a stagespecific negative regulator of conidiation that is required to establish a sympodial pattern of spore formation (Lau & Hamer 1998). Con7 encodes a C2H2 zinc-finger TF required for the transcription of several genes which participate in disease-related morphogenesis in Magnaporthe grisea. These include the pathogenicity factor-encoding gene PTH11 and several other genes which like PTH11 are predicted to encode G proteincoupled receptors. Microarray analysis also revealed several Con7pdependent genes which may encode factors determining cell wall structure or function (Odenbach et al. 2007). Homoeobox TFs MoHOX1eMoHOX8 were identified from the M. oryzae genome. MoHOX2 is essential for conidiogenesis, but not for appressorium-related pathogenic development. MoHOX7 is a key regulator, essential for appressorium development on both hyphal tips and conidial germ tubes (Kim et al. 2009). The gene Mosfl1 encodes a heat shock TF. Deletion of Mosfl1 resulted in less conidiation but has a normal growth rate (Li et al. 2011). MoAP1 shows several conserved domains including a bZIP DNA-binding domain. MoAP1 is necessary for aerial hyphal growth but not mycelial radial growth, and disruption of MoAP1 resulted in abnormal conidium morphology and reduction in conidia formation (Guo et al. 2011). The other bZIP transcriptional factor Moatf1, which is homologous to ATF/ CREB from yeasts to mammals plays an important role in response to oxidative stress conditions and is required for full virulence of M. oryzae (Guo et al. 2010). RNA-Sequence (RNA-Seq) is a recently developed highthroughput sequencing method that uses deep-sequencing technologies to produce millions of short cDNA reads. The resulting reads are either aligned to a reference genome or reference transcripts, or assembled de novo without the genomic sequence to produce a genome-scale transcription profile that consists of both the transcriptional structure and/or level of expression for each gene (Mortazavi et al. 2008). RNA-Seq is a powerful tool for transcriptome analysis and enables a gene expression profiling assay even at the single-cell level (Tang et al. 2009). Sequencing of RNA has been recognized as an efficient method for gene discovery and the gold standard for annotation of both coding and noncoding genes (Adams et al. 1991; Haas et al. 2002). In a previous study, we characterized a novel zinc-finger protein-encoding gene, conidiophore stalk-less1 (COS1). Mutation of COS1 (M2942) resulted in developmental failure of conidiophores. COS1 putatively encodes a 491-amino-acid protein with four multiple adjacent C2H2-type zinc-finger domains (Zhou et al. 2009). In this study, we report that the differences of expression profile between M2942 and the wild-type Y34 by RNA-Seq. The putative binding sites were searched in the promoter regions of COS1-dependent genes, and gel shift
X. Li et al.
experiments showed that COS1 bound to DNA elements with the sequence AAAAGAAA (A4GA3).
Materials and methods Strain and RNA isolation A Chinese field strain of Magnaporthe oryzae Y34 was used in this study as the wild type. The strain is a gift from J. Li of the Yunnan Academy of Agricultural Science, China. Other strains used in this study are derivates from strain Y34. Except for cultures with specific requirements, all strains were cultured on oatmeal agar plates at 28 C for several days. For conidiation, strain blocks were maintained on oatmeal agar plates at 28 C for 7 d in the dark followed by 3 d of continuous illumination under light. For total RNA isolation, aerial mycelia were harvested from plates with a triangular scraper. Total RNA was isolated from aerial mycelia as previously described (Zhou et al. 2009) and RNA integrity confirmed using a 2100 Bioanalyzer (Agilent Technologies).
Synthesis of cDNA and sequencing After extracting the total RNA from the samples, the mRNA was enriched by using the oligo(dT) magnetic beads and mRNA was enriched just by removing rRNAs from the total RNA. Adding the fragmentation buffer, the mRNA was interrupted to short fragments (about 200 bp), then the firststrand cDNA was synthesized by random hexamer-primer using the mRNA fragments as templates. Buffer, dNTPs, RNase H, and DNA polymerase I were added to synthesize the second strand. The double strand cDNA was purified with QiaQuick PCR extraction kit and washed with EB buffer for end repair and single nucleotide A (adenine) addition. Finally, sequencing adaptors were ligated to the fragments. The required fragments were purified by agarose gel electrophoresis and enriched by PCR amplification. The library products were ready for sequencing analysis via Illumina HiSeq 2000.
RNA-Seq data analysis Total RNAs were isolated from M2942 and Y34, the mRNA was selectively enriched through rRNA depletion. These samples were fragmented and used to obtain cDNA libraries that were sequenced. The original image data is transferred into sequence data by base calling, which is defined as raw reads. To get the clean reads, removing the dirty raw reads is needed before data analysis. Clean reads were mapped to reference sequences using SOAPaligner/soap2 (Li et al. 2009) allowing for 1 and 2 nt mismatches. To identify the genes regulated by COS1, the libraries were initially compared by pairs; for this, the number of reads for each coding region was determined, the number of total reads was normalized by using RPKM (Mortazavi et al. 2008) method (Reads Per kb per Million reads) between these libraries and the log2ratio of RPKM between M2942 and Y34 was calculated. The genes that showed an absolute value of log2ratio 1 and FDR (False Discovery Rate) 0.001 were considered potential candidates.
The function and properties of COS1 in M. oryzae
Quantitative RT-PCR For quantitative real-time RT-PCR (qRT-PCR), 5 mg of total RNA were reverse transcribed into first-strand cDNA using the oligo(dT) primer and M-MLV Reverse Transcriptase (Invitrogen). qRT-PCR reactions were performed following previously established procedures (Kim et al. 2005). Primers used in this study were designed by using Primer Premier (version 5.0) and commercially synthesized (Invitrogen Co., Beijing, China). The b-tubulin gene was included as a control. The ABI 7500 RealTime PCR system was used for PCRs that consisted of 1 min at 95 C (1 cycle) followed by 5 s at 95 C, 15 s at 56 C, and 15 s at 72 C (40 cycles). Each qRT-PCR mixture (final volume 20 ml) contained 10 ml of Power SYBRH Green PCR Master Mix (Applied Biosystems), 0.8 ml of forward and reverse primers (10 mM
A
241
concentrations for each), and 2 ml of cDNA template. To compare the relative abundance of target gene transcripts, the average threshold cycle (Ct) was normalized to that of b-tubulin (MGG_00604.6) for each of the treated samples as 2DCt, where DCt ¼ (Ct, target gene Ct, b-tubulin). Fold changes during fungal development and infectious growth in liquid CM were calculated as 2DDCt, where DDCt ¼ (Ct, target gene Ct, b-tubulin) (Ct, WT Ct, b-tubulin) (Choi et al. 2009). qRT-PCR was performed with three independent pools of tissues in two sets of experimental replicates.
Bioinformatics analysis The full sequence of COS1 was downloaded from the Magnaporthe oryzae online database (www.broadinstitute.org/ annotation/genome/magnaporthe_oryzae). COS1 orthology sequences from different organisms were obtained from GenBank (www.ncbi.nlm.nih.gov/BLAST) using the BLAST algorithm. Sequence alignments were performed using the Clustal_W program, and the phylogenetic tree was constructed using the Mega3.0 Beta program with neighbourjoining method. To predict putative COS1-binding sites, Azf1 in Saccharomyces cerevisiae binding motif sequences (A4GA3) were used to search in the 800 bp-upstream sequences set of the downregulated genes using Regulatory Sequence Analysis Tools (RSAT, http://rsat.scmbb.ulb.ac.be/rsat/), and no mismatch was allowed (Slattery et al. 2006).
B
Fig 1 e Fold change of selected genes determined by qRTPCR. (A) Six upregulated genes and six downregulated genes were randomly selected and validated. a, MGG_00574.6, galactan 1,3-beta-galactosidase (log2ratio (M2942/Y34) 2.4); b, MGG_04244.6, proline oxidase PrnD (2.1); c, MGG_05364.6, endoglucanase-4 (2); d, MGG_08046.6, bilirubin oxidase (2.0); e, MGG_07697.6, superoxide dismutase (1.9); f, MGG_04234.6, hexose transporter protein (1.6); g, MGG_03299.6, inorganic phosphate transporter PHO84 (L4.6); h, MGG_06751.6, conserved hypothetical protein (L3.1); i, MGG_09014.6, conserved hypothetical protein (L2.3); j, MGG_02252.6, 4HN reductase (L2.2); k, MGG_08458.6, chitinase 1 precursor (L1.8); l, MGG_04890.6, plasma membrane calcium-transporting ATPase 4 (L1.3). (B) Correlation between the expression ratios of selected genes determined by qRT-PCR and RNA-Seq.
Fig 2 e Functional grouping of genes up- or downregulated in M2942. The genes were divided into 21 groups according to their putative functions. In every group, the number of genes, the percentage of the gene to this GO category in the whole genome, and the P-value were also listed in the figure as: number (%, P-value). The GO terms with P-value £ 0.05 were defined as significantly enriched GO terms.
242
Plasmid construction and expression of recombinant COS1 protein To construct a recombinant expression vector containing COS1 gene, the primers for amplification of the gene encoding
X. Li et al.
COS1 were designed according to the sequence of the gene COS1. The forward primer was: CGCGGATCCATGAGCAC TATGCAACCT (contained a BamHI cleavage site, underlined) and the reverse primer was: CCGGAATTCTTAGTGACGTT GACCAGC (contained a EcoRI cleavage site, underlined). The
Fig 3 e Functional domain comparisons of COS1 in different organisms. (A) Alignment of the conserved domain of COS1 from M. oryzae with those from other organisms was performed using the Clustal_W program. Identical amino-acid residues were highlighted with dark grey background, close similar amino-acid residues were shaded with light grey, and distant similar amino acids were not shaded. (B) A phylogenetic tree of COS1, generated by the PHYLIP 3.56 program, based on alignment of the full sequences of C2H2 TF from fungus and yeasts. The sequences were from organisms as follows: Verticillium dahliae VdLs.17, Saccharomyces cerevisiae S288c, Aspergillus niger CBS 513.88, Aspergillus flavus NRRL 3357, Aspergillus fumigatus Af293, Neosartorya fischeri NRRL 181, Penicillium chrysogenum Wisconsin 54-1255, Pichia pastoris GS115, Neurospora crassa, Magnaporthe oryzae 70-15.
Fig 4 e Putative downregulated genes affected by COS1. The downregulated genes affected by COS1 were determined as described in Materials and methods and are grouped by functional categories based on GO. Each group was examined for enrichment of promoter sequences by use of RSAT (http://rsat.scmbb.ulb.ac.be/rsat/). Each gene is accompanied by a representation of its promoter (up to 800 bp upstream, with each tick marking 100 bp). Rectangles represent the positions of A4GA3 elements.
244
X. Li et al.
Fig 4 e (Continued)
PCR products were digested with BamHI and EcoRI, and ligated into pET-32a(þ) digested with the same enzymes, and transformed into Escherichia coli BL21 (DE3) and transformants were selected on the LB plate containing 30 mg ml1 of ampicillin. In order to improve expression of the soluble recombinant protein, after IPTG (final concentration 1.0 mmol l1) was added for induction, the cultures were grown at 20 C overnight.
Purification of recombinant COS1 protein The cells in the induced culture were harvested and washed. Then, the cell pellets were submitted to ultrasonication using
an Ultrasonic Homogenizer (400 W model, amp, Sonics & Materials Inc., USA) at maximum output in ice. After disruption by ultrasonication and removal of cell debris by centrifugation at 14 006g and 4 C for 20 min, the supernatant (cell-free extract) obtained was applied onto a Ni-NTA spin column (Ni Sepharose 6 Fast Flow purchased from GE Healthcare Company). The purification of recombinant COS1 protein was carried out according to the protocols offered by the manufacturer (GE Healthcare Company). The eluted 6 His-tagged fusion protein was assayed by SDS-PAGE. To confirm the recombinant protein expression as a His-tagged fusion protein, western blot analysis was carried out using monoclonal mouse-anti-His-Tag antibody (TIANGEN, China) as the primary antibody and goat anti-mouse IgG
The function and properties of COS1 in M. oryzae
245
Fig 4 e (Continued)
antibody conjugated with horseradish peroxidase (HRP) (TIANGEN, China) as the secondary antibody.
Gel shift assays To determine whether the identified A4GA3 motifs provide a binding site for COS1, we selected a 25 bp doublestranded DNA fragment (50 -AAAAAAAGAAAAAAAAAAAG AAAAA-30 ) from the MGG_03813.6 promoter containing a pair of A4GA3 motifs as a gel shift probe. MGG_03813.6 expression is downregulated (13.1) by COS1, and the promoter of MGG_03813.6 contains A4GA3 sequences. The probe was synthesized by invitrogen (Shanghai, China) and labelled by biotin. The purified 6 His-tagged fusion COS1 protein and the labelled probe were incubated for 30 min at room temperature in EMSA buffer, and the reaction mix was loaded into the individual lanes of a 6 % native polyacrylamide gel. The probe was detected using chemiluminescence. The
monoclonal mouse-anti-His-Tag antibody (TIANGEN, China) was used. The unlabelled fragment used as a competitor and the unlabelled fragment containing the A4GA3 motif mutation (50 -AAAAACATAAAAAAAAACATAAAAA-30 ) was used as a mutant competitor.
Results Transcriptional profiling of Magnaporthe oryzae by highthroughput RNA sequencing To identify genes influenced by COS1 in M. oryzae, we first search for genes that were differentially expressed in M2942. A total of 5 929 051 and 6 252 355 reads were obtained for each library (‘M2942’ and ‘Y34’, respectively). Of these, 5 356 636 (M2942) and 5 673 638 (Y34) reads mapped to multiple targets in the genome and 5 204 390 (M2942) and 5 492 494
246
(Y34) mapped uniquely. The clean reads account for 98.88 % (M2942) and 98.85 % (Y34) of raw reads, respectively. To identify the genes that are upregulated or downregulated in M2942, we normalized the number of reads for each pair of libraries, and the number of reads for each gene was compared. The genes that reproducibly showed a log2ratio larger than 1 or below 1 and an FDR of 0.001 or less were screened. Four hundred and forty two genes passed the criterions. From these, 88 genes were upregulated and 354 were downregulate in M2942. The information of up- and downregulated genes was listed in Table S1. To validate the induction of some of the genes identified by RNA-Seq, we carried out qRT-PCR experiments. Six upregulated genes and six downregulated genes were randomly selected and validated. The results showed that most gene (except MGG_03299.6) expression pattern were consistent with that in the RNA-Seq data, despite the discrepancy of the fold change in qRT-PCR than in RNA-Seq data (Fig 1A). Moreover, the fold change detected for each gene was similar to the ratio of induction and repression observed by RNASeq (Fig 1B). We then carried out GO (Gene Ontology) function prediction and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis. Based on sequence homology, 442 genes were categorized into different functional groups, belonging to three main GO ontologies: molecular function, cellular component, and biological process. Of these, 21 groups according to their putative functions were shown in Fig 2. We noted that a high percentage of genes from categories of ‘ion binding’, ‘oxidoreductase activity’, ‘hydrolase activity’, ‘cellular metabolic process’, ‘transport’, and ‘membrane’. To identify active biological pathways, the 442 genes were mapped to the reference canonical pathways in KEGG. The KEGG database contains systematic analysis of inner-cell metabolic pathways and functions of gene products, which aid in studying the complex biological behaviours of genes. In total, 442 genes were assigned to 102 KEGG pathways. The pathways with most representation were ‘metabolic pathways’ (70 members), ‘biosynthesis of secondary metabolites’ (28), ‘gamma-Hexachlorocyclohexane degradation’ (22), ‘Naphthalene and anthracene degradation’ (21), ‘Limonene and pinene degradation’ (20), ‘Stilbenoid, diarylheptanoid and gingerol biosynthesis’ (14), ‘Glycerophospholipid metabolism’ (12).
X. Li et al.
COS1 recognizes the A4GA3 motif upstream of its target genes We examined the upstream regions of the genes that are downregulated by COS1 to determine whether these genes have A4GA3 motif sequences in common. As shown in Fig 4, the A4GA3 motif was found in the upstream of many genes form different GO categories, such as ‘transport’, ‘lipid metabolic process’, ‘carbohydrate metabolic process’, ‘protein metabolic process’, ‘cellular amino acid metabolic process’, ‘nucleic acid metabolic process’, ‘nucleotide binding’, ‘metal ion binding’, ‘oxidoreductase activity’, etc. In these groups, this motif was found in ‘transport’ and ‘metal ion binding’ at frequencies much higher than others. To determine whether the identified A4GA3 motifs provide a binding site for COS1, we obtained the purified recombinant COS1 protein. The COS1 gene was fused to the pET-32a(þ) vector and expressed in Escherichia coli BL21 (DE3) (Fig 5A). Then the recombinant COS1 protein was purified by affinity chromatography using a Ni-NTA column. SDS-PAGE analysis showed that there was only one single protein band from the finally concentrated elute with a molecular mass about 72 kDa (Fig 5B), and western blotting demonstrate that the specific band was indeed the His-tagged fusion protein of COS1 (Fig 5C). We selected a region from MGG_03813.6 promoter containing a pair of A4GA3 motifs as a gel shift probe. Recombinant COS1 protein and the probes formed a proteineDNA complex (Fig 6). This complex was seriously affected by unlabelled probe (competitor), while the unlabelled mutant competitor did not affect the formation of the DNAeprotein complex. In the supershift assay, the molecular mass of DNAeprotein complex became larger than before because of the antibody binding to recombinant COS1 protein. Our experiments indicate that COS1 can directly bind the A4GA3 motifs, suggesting that COS1 may regulate gene expression by DNA binding.
COS1 is homologous to Azf1 of Saccharomyces cerevisiae The gene COS1 putatively encodes a 491-amino-acid protein, which is identical to ABB89847 in GenBank. Sequence analysis indicated that COS1 contains four adjacent C2H2-type zincfinger domains from position 187 to 300 (Fig 3A). The motifs are homologous to the zinc-finger protein Azf1 in S. cerevisiae (Stein et al. 1998). Except in the motif regions, COS1 does not show any significant homology with other known proteins, suggesting that it is a novel zinc-finger protein. The phylogenetic tree based on the full sequence comparison of C2H2 TF from fungus and yeasts revealed that the COS1 sequence is most similar to sequences from Neurospora crassa (CAC18195), S. cerevisiae (NP_014756), and Verticillium dahliae (EGY18118) (Fig 3B), with the similarities of 51 %, 53 %, 53 % respectively.
Fig 5 e Expression of COS1 in E. coli BL21 and western blot analysis. (A) M, Marker; 1, the cell-free extract from the induced transformants carrying pET-32a(D); 2, the cell-free extract from the transformants carrying pET-32a(D) fused COS1. (B) M, Marker; 1, the unpurified cell-free extract; 2, the purified recombinant COS1 protein. (C) Western blotting analysis of the purified recombinant COS1 protein.
The function and properties of COS1 in M. oryzae
Fig 6 e EMSAshowing in vitro binding of COS1 to the probe with A4GA3 motifs. His-tag recombinant COS1 protein purified from E. coli BL21 (DE3) and the 25 bp biotin-labelled double-stranded DNA fragment containing a pair of A4GA3 motifs were used in the protein-binding assay. The unlabelled fragment used as a competitor and the unlabelled fragment containing the A4GA3 motif mutation was used as a mutant competitor.
Discussion In this study, we utilized the transcription analysis by the RNA-Seq approach to identify genes whose expression is regulated by COS1. Since COS1 may be a transcriptional regulator, and it is essential for conidiophore development, we speculate that COS1 acts as a TF that modulates the expression of some conidiation-related genes, and their expression levels in RNASeq database were summarized in Table 1. The expression of the genes CON7, ACR1, MoSTUA, MoAPS1, MoAPS2, MoFLBA, MoFLBC, MoFLBD, MoFLUG were not significantly changed,
247
which were excluded with an absolute value of log2ratio < 1 and FDR > 0.001. These results indicate that these genes may not be direct targets of COS1. In our RNA-Seq database, 65 % of the genes downregulated severely (log2ratio (M2942/ Y34) < 4.0) were hypothetical or predicted protein implying that COS1 may involve in a new regulatory pathway. As shown in Table 1, the expression of gene MoCON6 (MGG_02246.6) was obviously downregulated (4.3). The conidiation-specific gene con-6 of Neurospora crassa is preferentially expressed during the formation of asexual spores, though inactivation of con-6 by the repeat-induced point mutation process had no demonstrable effect on formation or germination of conidia (White & Yanofsky 1993). A deletion mutant of MoCON6 has generated, and no obvious difference with the phenotype of the wild-type Y34 was observed (unpublished). The RSAT prediction showed that MoCON6 had no A4GA3 motif in its upstream sequence, suggesting that MoCON6 might not be regulated by COS1 directly. In previous study, the mutant M2942 was markedly deficient in melanin (Zhou et al. 2009). Melanin plays an important role in pathogenicity for many phytopathogenic fungi (Howard & Ferrari 1989). It may also contribute to spore development. Targeted disruption of a gene BRM2 encoding trihydroxynaphthalene reductase (3HNR) from Alternaria alternata had shown that this gene was required for conidial development (Kawamura et al. 1999). In Magnaporthe oryzae, melanin biosynthesis proceeds through a pentaketide route, joining acetate units to make tetrahydroxynaphthalene (4HN) (Bell & Wheeler 1986). The 4HN is then transformed into dihydroxynaphthalene (2HN) through a succession of two reduction and two dehydration steps. In the reduction steps, the 4HNR catalyses the reduction of 4HN to scytalone and 3HNR converts 3HN to vermelone (Fig 7) (Bhadauria et al. 2010). The RNA-Seq data shown that the gene (MGG_02252.6) encoding 4HNR was downregulated (2.2) by COS1, and another gene Cmr1 (Mgg_07 215.6) was also downregulated (1.2). It has been reported that Cmr1p positively regulated the transcription of 3HNR and SCD during mycelial melanisation (Tsuji et al. 2000). This might be the reason why M2942 produced less melanin than wild-type Y34. In the yeasts and fungus, mitogen-activated protein kinase (MAPK) signalling pathways are involved in the regulation of various cellular responses, including mating, filamentation,
Table 1 e RNA-Seq data for conidiation-related genes in M. oryzae. Gene CON7 ACR1 MoSTUA MoAPS1 MoAPS2 MoFLBA MoFLBC MoFLBD MoFLUG MoCON6 MoCON8
Locus number
Description, mutant phenotype
Log2ratio
Reference
MGG_05287.6 MGG_09847.6 MGG_00692.6 MGG_09869.6 MGG_08463.6 MGG_14517.5 MGG_04699.6 MGG_06898.6 MGG_02538.6 MGG_02246.6 MGG_00513.6
C2H2 zinc-finger TF, abnormal conidia Hypothetical protein with a glutamine-rich domain, acropetal conidia APSES TF, severe reduction in conidial production APSES TF, reduction in conidial production APSES TF, reduction in conidial production Putative regulator of G protein signalling, orthologue to flbA in A. nidulans C2H2 zinc-finger TF, orthologue to flbC in A. nidulans MYB TF, orthologue to flbD in A. nidulans Putative glutamine synthetase, orthologue to fluG in A. nidulans Hypothetical protein, orthologue to con-6 in N. crassa Hypothetical protein, orthologue to con-8 in N. crassa
0.1 0.4 0.4 0.1 0.1 0.1 0.3 0.6 0.3 4.3 1.2
Odenbach et al. (2007) Lau & Hamer (1998) Unpublished data Unpublished data Unpublished data Wieser et al. (1994) Wieser et al. (1994) Wieser et al. (1994) Lee & Adams (1994) Madi et al. (1994) Madi et al. (1994)
248
X. Li et al.
Fig 7 e Fungal melanin biosynthetic pathway (Bhadauria et al. 2010).
cell integrity, the response to high osmolarity, and ascospore formation. The FUS3 and KSS1 kinases are important components of the mating-pheromone response pathway and filamentation-invasion pathway (Gustin et al. 1998). In our results, the gene PMK1 (MGG_09865.6, homologous to the FUS3/ KSS1) was downregulated (1.6), which was the most significant change in MAPK signalling pathways. However, it has been reported that the PMK1 mutants of M. oryzae fail to form appressoria and fail to grow infectiously in rice plants with no defect in vegetative growth and asexual reproduction (Xu & Hamer 1996). There has been no evidence that PMK1 had some relation with conidiophore development, so COS1 regulating conidiophore development may not be through the MAPK signalling pathway. Compared with the wild type, the mutant grew normally on CM supplemented with 1 M sorbitol as an osmotic stress, under high temperature stress at 34 C, and with peroxide as an oxidative stress (Zhou et al. 2009). RNA-Seq data showed that COS1 had not obvious effects on the signal pathways that regulate cell integrity and the response to high osmolarity, and this was consistent with the M2942’s responses to environmental stresses. Transcriptional regulation is a major mechanism by which alterations in the expression of specific subsets of genes determine development and differentiation in cells. TFs play important roles in fungal development and pathogenicity as regulators in biological networks. The functional analysis of TFs provides new insights into a controlling network that governs fungal development and pathogenicity. The gene pro1 of the chestnut blight fungus Cryphonectria parasitica encodes a Zn(II)2Cys6 binuclear cluster DNA-binding protein and it is required for female fertility, asexual spore development, and stable maintenance of hypovirus infection (Masloff et al. 1999). RosA in the filamentous fungus Aspergillus nidulans have characterized the putative Zn(II)2Cys6 TF, which can repress sexual development upon integration of several environmental signals (Vienken et al. 2005). The protein encoded by COM1 has a putative helix-loop-helix structure that is characteristic of many TFs, and is required for normal conidium morphology and full virulence in M. oryzae (Yang et al. 2010). MgCRZ1, from M. oryzae, which contained two conserved C2H2-type zinc-finger motifs, and it is required for growth and development and is a crucial virulence determinant in this model phytopathogen (Zhang et al. 2009). MST12 contains two tandem C2/H2eZnþ2 finger domains near the C-terminus (residues 566e611) that are conserved only in STE12
homologues from filamentous fungi. MST12 regulates infectious growth but not appressorium formation in the rice blast fungus M. oryzae (Park et al. 2002). Though more and more TFs have been characterized, there is little research on the binding sites of TFs from M. oryzae. In this study, we confirmed that the binding site of C2H2 zinc-finger protein COS1 was A4GA3, which is the first report in M. oryzae. In conclusion, we identified genes influenced by COS1 in M. oryzae, and RNA-Seq database showed that 88 genes were upregulated and 354 were downregulate in M2942. COS1 encoding a C2H2 zinc-finger protein is homologous to Azf1 of Saccharomyces cerevisiae, and binding motif sequences (A4GA3) were used to search in the promoter sequences of the downregulated genes using RSAT. Gel shift experiments indicated that COS1 bound to A4GA3 motifs. The roles of COS1 in conidiophore development will be further studied.
Acknowledgement This work was supported by the National Natural Science Foundation of China (grant No. 31260418).
Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.funbio.2013.01.010.
references
Adams MD, Kelley JM, Gocayne JD, Dubnick M, Polymeropoulos MH, Xiao H, Merril CR, Wu A, Olde B, Moreno RF, Kerlavage AR, McCombie WR, Venter JC, 1991. Complementary DNA sequencing: expressed sequence tags and human genome project. Science 252: 1651e1656. Adams TH, Wieser JK, Yu JH, 1998. Asexual sporulation in Aspergillus nidulans. Microbiology and Molecular Biology Reviews 62: 35e54. Bell AA, Wheeler MH, 1986. Biosynthesis and function of fungal melanin. Annual Review of Phytopathology 24: 411e451. Bhadauria V, Wang LX, Peng YL, 2010. Proteomic changes associated with deletion of the Magnaporthe oryzae conidial morphology-regulating gene COM1. Biology Direct 5: 61.
The function and properties of COS1 in M. oryzae
Choi J, Kim Y, Kim S, Park J, Lee YH, 2009. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae. Fungal Genetics and Biology 46: 243e254. Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L, Weiss RL, Borkovich KA, Dunlap JC, 2006. A high throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proceedings of the National Academy of Sciences of the United States of America 103: 10352e10357. Dean RA, Talbot NJ, Ebbole DJ, Farman ML, Mitchell TK, Orbach MJ, et al., 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434: 980e986. Ebbole DJ, 2007. Magnaporthe as a model for understanding hostpathogen interactions. Annual Review of Phytopathology 45: 437e456. Guo M, Chen Y, Du Y, Dong YH, Guo W, Zhai S, Zhang HF, Dong SM, Zhang ZG, Wang YC, Wang P, Zheng XB, 2011. The bZIP transcription factor MoAP1 mediates the oxidative stress response and is critical for pathogenicity of the rice blast fungus Magnaporthe oryzae. PLoS Pathogens 7: e1001302. Guo M, Guo W, Chen Y, Dong SM, Zhang X, Zhang HF, Song WW, Wang W, Wang Q, Lv RL, Zhang ZG, Wang YC, Zheng XB, 2010. The basic leucine zipper transcription factor Moatf1 mediates oxidative stress responses and is necessary for full virulence of the rice blast fungus Magnaporthe oryzae. Molecular PlantMicrobe Interactions 23: 1053e1068. Gustin MC, Albertyn J, Alexander M, Davenport K, 1998. MAP kinase pathways in the yeast Saccharomyces cerevisiae. Microbiology and Molecular Biology Reviews 62: 1264e1300. Haas BJ, Volfovsky N, Town CD, Troukhan M, Alexandrov N, Feldmann KA, Flavell RB, White O, Salzberg SL, 2002. Full length messenger RNA sequences greatly improve genome annotation. Genome Biology 3 RESEARCH0029. Howard RJ, Ferrari MA, 1989. Role of melanin in appressorium formation. Experimental Mycology 13: 403e418. Kawamura C, Tsujimoto T, Tsuge T, 1999. Targeted disruption of a melanin biosynthesis gene affects conidial development and UV tolerance in the Japanese pear pathotype of Alternaria alternata. Molecular Plant-Microbe Interactions 12: 59e63. Kim S, Ahn IP, Rho HS, Lee YH, 2005. MHP1, a Magnaporthe grisea hydrophobin gene, is required for fungal development and plant colonization. Molecular Microbiology 57: 1224e1237. Kim S, Park SY, Kim KS, Rho HS, Chi MH, Choi J, Park JS, Kong S, Park J, Goh J, Lee YH, 2009. Homeobox transcription factors are required for conidiation and appressorium development in the rice blast fungus Magnaporthe oryzae. PLoS Genetics 5: e1000757. Lau GW, Hamer JE, 1998. Acropetal: a genetic locus required for conidiophore architecture and pathogenicity in the rice blast fungus. Fungal Genetics and Biology 24: 228e239. Lee BN, Adams TH, 1994. The Aspergillus nidulans fluG gene is required for production of an extracellular developmental signal and is related to prokaryotic glutamine synthetase I. Genes & Development 8: 641e651. Li GT, Zhou XY, Kong LG, Wang YL, Zhang HF, Zhu H, Mitchell TK, Dean RA, Xu JR, 2011. MoSfl1 is important for virulence and heat tolerance in Magnaporthe oryzae. PLoS ONE 6: e19951. Li R, Yu C, Li Y, Lam TW, Yiu SM, Kristiansen K, Wang J, 2009. SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics 25: 1966e1967. Madi L, Ebbole DJ, White BT, Yanofsky C, 1994. Mutants of Neurospora crassa that alter gene expression and conidia development. Proceedings of the National Academy of Sciences of the United States of America 91: 6226e6230.
249
€ ggeler S, Ku € ck U, 1999. The pro1(þ) gene from Sordaria Masloff S, Po macrospora encodes a C6 zinc finger transcription factor required for fruiting body development. Genetics 152: 191e199. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B, 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods 5: 621e628. Odenbach D, Breth B, Thines E, Weber RWS, Anke H, Foster AJ, 2007. The transcription factor Con7p is a central regulator of infection-related morphogenesis in the rice blast fungus Magnaporthe grisea. Molecular Microbiology 64: 293e307. Park G, Xue CY, Zheng L, Lam S, Xu JR, 2002. MST12 regulates infectious growth but not appressorium formation in the rice blast fungus Magnaporthe grisea. Molecular Plant-Microbe Interactions 15: 183e192. Slattery MG, Liko D, Heideman W, 2006. The function and properties of the Azf1 transcriptional regulator change with growth conditions in Saccharomyces cerevisiae. Eukaryotic Cell 5: 313e320. Springer ML, Yanofsky CA, 1989. Morphological and genetic analysis of conidiophore development in Neurospora crassa. Genes & Development 3: 559e571. Stein T, Kricke J, Becher D, Lisowsky T, 1998. Azf1p is a nuclearlocalized zinc-finger protein that is preferentially expressed under nonfermentative growth conditions in Saccharomyces cerevisiae. Current Genetics 4: 287e296. Tang F, Barbacioru C, Wang Y, Nordman E, Lee C, Xu N, Wang X, Bodeau J, Tuch BB, Siddiqui A, Lao K, Surani MA, 2009. mRNASeq whole-transcriptome analysis of a single cell. Nature Methods 6: 377e382. Tsuji G, Kenmochi Y, Takano Y, Sweigard J, Farrall L, Furusawa I, Horino O, Kubo Y, 2000. Novel fungal transcriptional activators, Cmr1p of Colletotrichum lagenarium and Pig1p of Magnaporthe grisea, contain Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in a developmentally specific manner. Molecular Microbiology 38: 940e954. Valent B, 1990. Rice blast as a model system for plant pathology. Phytopathology 80: 33e36. Vienken K, Scherer M, Fischer R, 2005. The Zn(II)2Cys6 putative Aspergillus nidulans transcription factor repressor of sexual development inhibits sexual development under low-carbon conditions and in submersed culture. Genetics 169: 619e630. White BT, Yanofsky C, 1993. Structural characterization and expression analysis of the Neurospora conidiation gene con-6. Developmental Biology 160: 254e264. Wieser J, Lee BN, Fondon JW, Adams TH, 1994. Genetic requirements for initiating asexual development in Aspergillus nidulans. Current Genetics 27: 62e69. Yang J, Zhao XY, Sun J, Kang ZS, Ding SL, Xu JR, Peng YL, 2010. A novel protein Com1 is required for normal conidium morphology and full virulence in Magnaporthe oryzae. Molecular Plant-Microbe Interactions 23: 112e123. Xu JR, Hamer JE, 1996. MAP kinase and cAMP signaling regulate infection structure formation and pathogenic growth in the rice blast fungus Magnaporthe grisea. Genes & Development 10: 2696e2706. Zhang HF, Zhao Q, Liu KY, Zhang ZG, Wang YC, Zheng XB, 2009. MgCRZ1, a transcription factor of Magnaporthe grisea, controls growth, development and is involved in full virulence. FEMS Microbiology Letters 293: 160e169. Zhou ZZ, Li GH, Lin CH, He CZ, 2009. Conidiophore Stalk-less1 encodes a putative zinc-finger protein involved in the early stage of conidiation and mycelial infection in Magnaporthe oryzae. Molecular Plant-Microbe Interactions 22: 402e410.