The Met-genotype of the BDNF Val66Met polymorphism is associated with reduced Stroop interference in elderly

Neuropsychologia 50 (2012) 3554–3563

Contents lists available at SciVerse ScienceDirect

Neuropsychologia journal homepage: www.elsevier.com/locate/neuropsychologia

Research Report

The Met-genotype of the BDNF Val66Met polymorphism is associated with reduced Stroop interference in elderly Patrick D. Gajewski a,n, Jan G. Hengstler a, Klaus Golka a, Michael Falkenstein a, Christian Beste b a b

Leibniz Research Centre for Working Environment and Human Factors (IfADo), Dortmund, Germany Institute for Cognitive Neuroscience, Biopsychology, Ruhr-University Bochum, Bochum, Germany

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 May 2012 Received in revised form 14 September 2012 Accepted 25 September 2012 Available online 3 October 2012

Aging is accompanied by impairments of executive functions that rely on the functional integrity of fronto-striatal networks. This integrity is modulated by the release of neurotrophins like the brainderived-neurotrophic factor (BDNF). Here, we investigate effects of the functional BDNF Val66Met polymorphism on interference processing in 131 healthy elderly subjects using event-related potentials (ERPs). In a Stroop task, participants had to indicate the name or the colour of colour-words while colour was either compatible or incompatible with the name. We show that susceptibility to Stroopinterference is affected by the BDNF Val66Met polymorphism: the Met-allele carriers showed better performance and enhanced N450 in interference trials. Other processes necessary to prepare and allocate cognitive resources to a particular task were not affected by BDNF Val66Met polymorphism, underlining the specificity of the observed effects. The observed performance and ERP difference is possibly due to dopamine related effects of BDNF in fronto-striatal networks, where it putatively mediates a shift in the balance of the direct and indirect pathway involved in inhibitory functions. & 2012 Elsevier Ltd. All rights reserved.

Keywords: ERP BDNF polymorphism Stroop Interference Genetic imaging N450

1. Introduction Molecular genetic techniques are increasingly recognized as important tools to elucidate neurobiological determinants of human cognitive function (van Thriel et al., 2012). They may also prove useful to understand the large inter-individual differences in cognitive functions in aging (Harris & Deary, 2011; Hultsch & MacDonald, 2004; Lindenberger et al., 2008). Particularly, executive functions relying on the functional integrity of prefrontal networks are most affected in aging (MacDonald, Nyberg, & B¨ackman, 2006). This neuronal integrity is modulated by neurotrophins like the brainderived-neurotrophic factor (BDNF), which regulates survival, growth, maintenance and genesis of neurons (McAllister, Katz, & Lo, 1999; Pezawas et al., 2004). BDNF also regulates activitydependent changes in synaptic plasticity, such as long-term potentiation (LTP) in the hippocampus (Bekinschtein et al., 2008; Egan et al., 2003). A common single nucleotide polymorphism (SNP) in the human BDNF gene (Val66Met; rs6265) leads to a valine (Val)/ methionine (Met) substitution in the pro-domain of the encoded protein (Chen et al., 2004). The functional polymorphism alters the intracellular tracking and packaging of pro-BDNF, affecting the secretion of mature peptide (Egan et al., 2003). As compared to

n

Corresponding author. Tel.: þ49 231 1084 291; fax: þ 49 231 1084 308. E-mail address: [email protected] (P.D. Gajewski). URL: http://www.ifado.de (P.D. Gajewski).

0028-3932/$ - see front matter & 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.neuropsychologia.2012.09.042

the Met-allele, the Val-allele is associated with higher activity of the BDNF system (e.g., Rybakowski, 2008), which linearly relates to increased neural activity (Kafitz, Rose, Thoenen, & Konnerth, 1999). Association studies on the BDNF Val66Met polymorphism have revealed contradictory effects on cognitive functions, which may be also due to the variability of BDNF isoforms and the diversity of transcripts in different brain areas (Mandelman & Grigorenko, 2012). Specific memory functions are compromised in Met-allele carriers (episodic memory: Dempster et al., 2005; Egan et al., 2003; Li et al., 2010, declarative memory: Hariri et al., 2003) see also Miyajima et al., 2008 and Raz et al., 2009, but a number of studies found no association between BDNF and memory performance in different populations (Houlihan et al., 2009; Nacmias et al., 2004; Strauss et al., 2004; van Wingen et al., 2010; see also Mandelman & Grigorenko, 2012 and Payton, 2009, for an overview). While Mandelman and Grigorenko (2012) did also not detect a consistent association between BDNF and executive control processes, several recent studies showed that some executive functions are more efficient in Met-allele carriers (Beste, Baune, Domschke, Falkenstein, & Konrad, 2010a; Beste et al., 2010b) and particularly so in older subjects (Erickson et al., 2008; Foltynie et al., 2005; Gajewski, Hengstler, Golka, Falkenstein, & Beste, 2011; Harris et al., 2006; Matsushita et al., 2005; Ventriglia et al., 2002). In elderly individuals, the relevance of the BDNF Val66Met polymorphism as a modulator of cognitive functions is even more salient than in young subjects, since cognitive processes move away from their optimum (Lindenberger et al., 2008; Nagel

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

et al., 2008). Moreover, it has been shown that BDNF secretion is decreased in aging (Hayashi, Mistunaga, Ohira, & Shimizu, 2001; Pang & Lu, 2004). We aimed at providing a further test for the hypothesis that the Met allele of the BDNF Val66Met polymorphism is associated with enhanced executive control processes in healthy elderly. We do so by means of event-related potentials (ERPs) in a healthy elderly cohort using a computerised version of the Stroop paradigm. Processes related to interference control have repeatedly been shown to depend on anterior cingulate and dorsolateral prefrontal areas (Beste, Domschke, Falkenstein, & Konrad, 2010c; Beste, Baune, Domschke, Falkenstein, & Konrad, 2010e; Liotti, Woldorff, Perez, & Mayberg, 2000; West, 2003). These areas are part of fronto-striatal loops (Chudasama & Robbins, 2006; Foltynie et al., 2005) known to play a crucial role in executive functions like response inhibition and response selection (Beste et al., 2012; Gajewski, Stoerig, & Falkenstein, 2008; Gajewski et al., 2011; Mostovsky & Simmonds, 2008; Paus, 2001; Picard & Strick, 1996; Turken & Swick, 1999). Inhibitory processes have generally been suggested to be crucial for interference control ¨ (Friedman & Miyake, 2004; Kok, 1999; Zysset, Muller, Lohmann, & von Cramon, 2001) and also for processing of incompatible Stroop responses (i.e., when the dominant task dimension (word reading) has to be suppressed) (Cohen, Dunbar, & McClelland, 1990; Cohen & Servan-Schreiber, 1992; Stroop, 1935; West & Alain, 2000). Using ERPs it has been shown that incompatible Stroop stimuli evoke a centro-parietal negativity about 450 ms post-stimulus (Mager et al., 2007; Rebai, Bernard, & Lannou, 1997; West, 2003; West & Alain, 1999, 2000; West, Jakubek, Wymbs, Perry, & Moore, 2005), which is most likely generated by areas in the anterior cingulate cortex (ACC; Liotti et al., 2000; Markela-Lerenc et al., 2004) with a posterior shift for manual responses (Atkinson, Drysdale, & Fulham, 2003; Liotti et al., 2000; West, 2004) which suggests different sources within the ACC. The N450 reflects response, but not stimulus interference (Chen, Bailey, Tiernan, & West, 2011) and has consistently been associated with response conflict interference control induced by incompatible Stroop stimuli (Coderre, Conklin, & van Heuven, 2011; Liotti et al., 2000; West et al., 2005; West, 2004). Paralleling the increase of Stroop interference in elderly, this negativity has been shown to be attenuated in aging (Mager et al., 2007; West, 2004; West & Allain, 2000). This suggests that an attenuated negativity in incompatible trials is related to compromised interference control. If the Met genotype confers a benefit to its carriers in executive control processes, we expect Met-allele carriers to show weaker interference effects on a behavioural level, as compared to Val/ Val-allele carriers. This may be expressed in shorter reaction times (RTs), lower intra-individual variability of speed and lower error rates in Met-allele carriers, compared to Val/Val genotype carriers (cf. Gajewski et al., 2011; Getzmann et al. in press). On a neurophysiological level we expect that the central negativity, the N450, indicating successful interference control is attenuated in Val/Val genotype carriers, compared to Met-allele carriers. Moreover, in tasks imposing high demands on cognitive control the allocation of processing resources is essential (Freude & Ullsperger, 2000). These preparatory processes are reflected in the contingent negative variation (CNV; Falkenstein, Hoormann, Hohnsbein, & Kleinsorge, 2003; Walter, Cooper, Aldridge, McCallum, & Winter, 1964). As such, possible differences between elderly Met-allele and Val/Val genotype carriers in interference control may only be a side effect of more efficient preparatory processes that allocate processing resources to the task-relevant cognitive process. If this is the case, the CNV should be enhanced in elderly Met-allele carriers, compared to Val/Val genotype carriers, and particularly so in conditions with higher conflict.

3555

2. Materials and methods 2.1. Participants One hundred thirty one healthy volunteers aged from 65 to 88 (M¼ 70.5, SD¼4.5) participated in the study. 81 (61.8%) of them were female. Six participants of the Val/Val and five participants of the Val/Met group were left handed or ambidextrous. They had normal or corrected-to-normal vision. All participants received payment for their participation. The sample consisted of 79 subjects carrying the Val/Val genotype, 47 carrying the Val/Met genotype and five subjects carrying the Met/Met genotype group. The distribution of genotypes in the sample did not differ from Hardy-Weinberg equilibrium (p¼ .537), as determined using the program Finetti provided as an online source (http://ihg.gsf.de/cgi-bin/hw/ hwa1.pl; Wienker TF and Strom TM). As to the expected low frequency of the Met/ Met genotype, the Val/Met and Met/Met genotype were combined to one group (i.e., Val/Met–Met/Met genotype; Met-allele group). 58 participants of the Val/Val genotype (age M¼ 70.8, SD¼ 4.7; MMSE ¼ 28.3), were female (73.4%), and 23 of the combined Val/Met and Met/Met genotype group (age M ¼70.2, SD ¼4.3; MMSE ¼28.7), were female (44.2%, X2 ¼ 11.3, p o .001). The Chi-square test indicates that the factors genotype and gender are not independent in this sample. All participants were explained the scope of the study and gave written informed consent before any study protocol was commenced. 2.2. Neuropsychological testing The participants underwent extensive neuropsychological assessment to document the neuropsychological and psychiatric status. The neuropsychological tests and the questionnaires were administered in an extra session, one day before the ERPs test was conducted. The presented data are a part of training study with a pre and a post measure (only the pre measure is reported here). However, one test (TMT) and two questionnaires (NEO-FFI and CFQ, see below) were administered during the post measure after 12 participants (five of the Val/Val and seven of the Val/Met–Met/Met genotype) dropped out from the study. The battery comprised a number of tests and questionnaires, assessing the general cognitive status (Mini Mental State Examination (MMSE); Folstein, Folstein, & Mc Hugh, 1975), depressive disorder (Becks depression inventory; Beck, Ward, Mendelson, Mock, & Erbaugh, 1961) and the personality traits by NEO-FFI (‘‘Big Five’’ personality factors questionnaire; Costa & McCrae, 1992). The neuropsychological tests measured attentional endurance (d2; Brickenkamp, 1994), speed of processing and vigilance (Digit-symbol-test), short-term and working memory functions (Digit-span-test), both being subtests of the Wechsler adult intelligence scale (Wechsler, 1955). Interference was assessed by the classic Stroop colour-word test (Stroop, 1935), the verbal memory was assessed by the Verbal Learning and Memory Test (VLMT; Helmstaedter & Durwen, 1990). Divergent thinking was measured by the German version of the word-fluencytest (WFT; Aschenbrenner, Tucha, & Lange, 2001) and the crystalline intelligence was examined by the multiple choice word test (MWT-B; Lehrl, 1995). Visuospatial memory was assessed by the Rey–Osterrieth complex figure test (ROCF; Osterrieth, 1944), mental rotation by the mirrored figures, a subtest from the ¨ wilde test of intelligence (Jager & Althoff, 1994). Finally, the trail making test (TMT; Reitan, 1992) was administered to measure the psychomotor speed a task switching. The self-reported failures in perception, memory, and motor function were analyzed using the cognitive failures questionnaire (CFQ; Broadbent, Cooper, FitzGerald, & Parkes, 1982). 2.3. Genotyping Isolation of genomic DNA of leucocytes was performed according to standard procedures (Lehmann, Selinski, & Blaszkewicz, 2010). Analysis of the [A/G] substitution (rs6265) of BDNF on chromosome 11p14 and differentiation between the homozygous (A/A), homozygous (G/G) and the heterozygous (A/G) form of the sequence: CATCATTGGCTGACACTTTCGAACAC[A/G]TGATAGAAGAGCTGTTGGATGAGGA was detected via TaqMan Assay (e.g., Golka et al., 2009). Briefly, 5–8 ml of ¨ venous blood was taken into a 9 ml tube (Sarstedt, Numbrecht, Germany) from the cubital vein with EDTA as the anticoagulant and was frozen at  20 1C. DNA was isolated using a QIAamp DNA blood maxi kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol (Arand et al., 1996). DNA concentrations were determined using a NanoDrop ND-1000 UV/Vis-spectrophotometer (PEQLAB Biotechnologie GMBH, Erlangen, Germany). Genotyping was performed on an ABI7500 Sequence Detection System with the use of TaqMans assays (Applied Biosystems, Darmstadt, Germany). A final reaction volume of 15 ml was used per well of a 96-well plate. The reaction mix for amplification was prepared by mixing 7.5 ml TaqMans Universal PCR Master Mix (Applied Biosystems, Foster City, CA 94404, U.S.A.) and 0.75 ml Working Stock of SNP Genotyping Assay (Applied Biosystems, Foster City, CA 94404, U.S.A.) per sample. To this reaction mixture 1 ml DNA solution (with a total of 10 ng DNA) and 5.75 ml distilled water were added to achieve a final volume of 15 ml. Amplification was performed using a protocol with 40 cycles, 15 s at 92 1C (denature), 1 min at 60 1C (anneal/extend). An initial hold

3556

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

with 10 min at 95 1C was applied. Analysis of data was performed according to the manufacturer’s instructions (Applied Biosystems 7300/7500/7500, fast real-time PCR System Allelic Discrimination Getting Started Guide). 2.4. Stimuli and tasks We used a modified, computer based colour-word interference test (Stroop, 1935). Stimuli consisted of the words red, green, yellow and blue (German: rot, ¨ gelb, blau) in one of the four colours. In 50% of the stimuli, the colour of the grun, word corresponded to its meaning. The words consisting of letters (5–7 mm wide  10 mm high) were presented on a black computer screen. A diamond and a square (37 mm per side) served as a cue stimulus indicating the relevant task, which was presented in the middle of the screen. The diamond indicated the task ‘‘word reading’’, the square ‘‘colour naming’’. Responses consisted of pressing one of four buttons corresponding to each of the four colours, which were mounted in a response box. The button for responding to the colour red was placed at top left, green—bottom left, blue—bottom right and yellow top right. The buttons should be pressed with the index and middle fingers. The stimulus–response mapping of the tasks was overlapping, that is responses according to a particular colour word (i.e., red) in a word reading task was the same as for example in the word green presented in the red ink in the colour naming task. This assignment was the same for all participants. A trial started with the presentation of the cue stimulus. A cue stimulus was presented for 1000 ms and remained visible when the word (target) was presented. The cue and the word disappeared after a button press. A response had to be given within 2500 ms after word-onset. 500 ms after the response a feedback was displayed for 500 ms. In case of a correct response a plus sign, after a wrong response a minus sign was displayed. After a delay of 300 ms the next cue was shown. Thus, the response-cue interval (RCI) was 1300 ms and included the response–feedback delay and the feedback. There were two types of blocks: 1. In the first block the participant’s task was to respond according to the name of the colour word and to ignore the print colour of the word stimulus. In this block only diamond cues were displayed. 2. In the second block the task was to name the colour of the ink which the word was displayed in and to ignore its meaning. In this block only square cues were presented. Before each block, the participants performed a practice block with 16 trials, followed by the test blocks of 52 trials each. Each block consisted of 26 compatible (seven red–red, seven green–green, six blue–blue and six yellow–yellow colourword pairs) and 26 incompatible (2 trials for each combination unless 3 trials for blue–green and 3 for yellow–red pairs). The frequency of each response was also equal (25%). Before each block the participants were given a written instruction that explained the task. The instruction encouraged quick and accurate responses. 2.5. ERP recordings EEG was recorded continuously from 32 scalp electrodes according to the extended 10–20 system (Jasper, 1958) and mounted on an elastic cap. The montage included 8 midline sites and 12 sites on each hemisphere and two mastoid electrodes (M1 and M2). The EEG was re-referenced offline to linked mastoids. The ERPs were filtered digitally offline with a 17 Hz low and 0.05 Hz high pass filter. The horizontal and vertical EOG was recorded using a bipolar montage from electrodes at both eyes. Eye movement artifacts were corrected using the algorithm of Gratton, Coles and Donchin (1983). Electrode impedance was kept below 10 kO. The amplifier bandpass was 0.01–140 Hz. EEG and EOG were sampled continuously with a rate of 2048 Hz. Offline, the EEG was downsampled to 1000 Hz and cut in stimulus-locked epochs by using the software Vision Analyzer (Brain Products, Munich). Epochs in which the amplitude exceeded þ /  100 mV were rejected. 2.6. Data analysis The first trial of each test block, trials with responses faster than 100 ms or slower than 2500 ms, as well as error trials, were excluded from the RT analysis. Mean RTs, individual standard deviation of RTs as an index of intraindividual variability of speed (ISDs), and error rates were subjected to an ANOVA design including two within-subject factors ‘‘block’’ (word naming vs. colour naming) ‘‘compatibility’’ (compatible vs. incompatible) and the between-subject factor ‘‘BDNF-genotype’’ (Val/Val vs. combined Val/Met–Met/Met) group.1

1 As the chi-square test revealed an unequal distribution of gender in both genotypes we controlled the effect of gender by including this between-subject factor in the analyses. However, as no effects or interactions were found, this factor was excluded from the presentation of the results.

The ERP analysis was restricted to the midline electrodes (Fz, FCz, Cz, CPz and Pz) as the CNV, N450 and P3 are usually maximum at the midline. The negative or positive shifts were quantified as the mean amplitude in a particular time window. Cue-locked ERPs were analyzed between 0 and 1000 ms after cueonset. Target-locked ERPs were analyzed in a time window 0–1000 after targetonset. In the cue-locked data the terminal CNV was measured as the mean amplitude in the time range 900–1000 ms after cue-onset at Fz, FCz and Cz. In the targetlocked data the N450 (which overlapped the P3) was measured as the mean amplitude in the time range 300–600 ms after target onset at all electrodes. The cue-locked ERPs were measured relative to 100 ms pre-cue baseline. The targetlocked ERPs were measured relative to 100 ms pre-target baseline. The CNV was subjected to an ANOVA with repeated measures with the inner-subject factors ‘‘block’’ and the between subject factor ‘‘BDNF-genotype’’. Note, that information about compatibility was not evident in the preparation phase. Consequently, we collapsed the ERPs from compatible and incompatible trials for the CNV analysis. Post target ERPs were subjected to a two-way ANOVA with repeated measures with the inner-subject factors ‘‘block’’ and ‘‘compatibility’’ and the between subject factor ‘‘BDNF-genotype’’. Partial-eta2 (Z2) is reported as a measure of effect size. For each measure mean and standard error of the mean are provided (M7 S.E.M.). Significance level was set at p o.05. Post-hoc power calculations revealed that for the effects in the main behavioural and electrophysiological outcome measures the power was between 78% and 84%.

3. Results 3.1. Neuropsychological data The sample was examined using neuropsychological and psychiatric tests. The results of these tests are given in Table 1. The Val/Val vs. Val/Met–Met/Met subgroups did not significantly differ regarding a number of neuropsychological, psychiatric and personality parameters (Table 1). 3.2. Behavioural data Mean reaction times (RTs) and error rates (ERs) for compatible and incompatible trials in the word reading and colour naming block are presented in Fig. 1. Generally, for the analysis of response times, error trials (2.1% and 4.5%) and outliers with RTs shorter than 100 ms and longer than 2500 ms (0.7% and 3.0%) for word meaning and colour naming block, respectively were discarded. 3.2.1. Reaction times Regarding reaction times (RTs), the ANOVA revealed a main effect of ‘‘block’’ (F(1,129)¼199.5, po.0001, Z2 ¼.607), suggesting considerable longer RTs in the colour naming than word meaning block (1144720.4 vs. 916712.8 ms) and a main effect of ‘‘compatibility’’ (F(1,129)¼443.0, po.0001, Z2 ¼.774), indicating longer RTs in incompatible than compatible trials (1105715.8 vs. 955715.1 ms). The significant interaction ‘‘block’’  ‘‘compatibility’’ (F(1,129)¼188.7, po.0001, Z2 ¼.594) indicates a stronger compatibility effect (i.e., incompatible–compatible) in the colour naming than the word reading block (250715.8 vs. 5177.3 ms). Moreover, ‘‘block’’ was modulated by the between subject factor ‘‘BDNF-genotype’’ (F(1,129)¼8.4, po.005, Z2 ¼.061). This interaction was due to the higher difference between the word reading and colour naming block in the Val/Val group than in the Val/Met–Met/Met group (274726.0 vs. 1807 32.1 ms). In other words, this reflects longer RTs in the colour naming block in the Val/Val genotype, than Met-allele carriers both in compatible (po.005) and incompatible trials (po.005). The three way interaction ‘‘block’’  ‘‘compatibility’’  ‘‘BDNF-genotype’’ was not significant (Fo1). Finally, the BDNF-genotype subgroups differed regarding the general RT level (F(1,129)¼8.2, p o.005, Z2 ¼.060) which was higher in the Val/Val group than the in the combined Val/Met– Met/Met group (1073718.9 vs. 987723.3 ms).

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

3557

Table 1 Sample characteristic and results of the neuropsychological assessment for the Val/Val and Val/Met–Met/Met genotypes.

Number Age MMSE BDI NEO-FFIa Neuroticism Extraversion Openess to experience Agreeableness Conscientiousness d2 Total number of symbols (n) Number omitted symbols (n) Number confused symbols (n) Digit-symbol-test Total number of symbols (n) Number correct (n) Stroop Word reading (s) Colour naming (s) Interference list (s) Digit-span Forward (n) Backward (n) Word-fluency (n) MWT-B Number total (%) IQ VLMT Total score trials 1 to 5 (n) Delayed recognition (n) Rey-Figure (ROCF) Reproduction (n) Delayed recall (n) Mental rotation Total number (n) Number correct (n) TMTa TMT-A (s) TMT-B (s) CFQa Total score (n)

Val/Val

Val/Met–Met/Met

F (df)

p

n¼ 79 70.8 (4.7) 28.3 (1.9) 5.3 (4.0)

n ¼52 70.2 (4.3) 28.8 (1.4) 5.2 (4.4)

F(1,129)¼ 1.3 F(1,129)¼ 2.6 F(1,129)¼ 2.6

.255 .135 .936

1.4 2.1 2.1 2.3 2.6

1.5 2.0 2.1 2.1 2.6

F(1, 121) ¼0.7 F(1,121)¼ 1.2 F(1,121)¼ 0 F(1,121)¼ 1.8 F(1,121)¼ 0.1

.390 .267 .882 .172 .783

(0.6) (.05) (0.5) (0.6) (0.6)

(0.5) (0.5) (0.5) (0.6) (0.6)

380 (87.5) 21 (16.9) 4.8 (7.6)

408 (77.6) 21 (22.0) 5.2 (7.2)

F(1,129)¼ 3.3 F(1,129)¼ 0 F(1,129)¼ 0.1

.072 .867 .750

44.7 (10.7) 44.6 (11.0)

44.2 (9.7) 44.2 (9.7)

F(1,129)¼ 0.1 F(1,129)¼ 0.1

.780 .792

14.1 (2.3) 21.6 (3.6) 43.7 (8.3)

14.7 (3.8) 22.3 (6.0) 45.1 (14.1)

F(1,129)¼ 1.4 F(1,129)¼ 0.7 F(1,129)¼ 0.5

.237 .398 .476

3.5 (1.0) 2.7 (0.8) 31.0 (3.2)

4.2 (3.8) 3.0 (0.9) 31.5 (2.7)

F(1,129)¼ 2.3 F(1,129)¼ 3.0 F(1,129)¼ 0.4

.127 .082 .571

82.7 (19.8) 116.3 (12.1)

85.0 (17.3) 117.2 (11.7)

F(1,129)¼ 0.4 F(1,129)¼ 0.2

.504 .652

37.3 (9.9) 12.5 (2.2)

38.2 (8.4) 13.1 (1.8)

F(1,129)¼ 0.3 F(1,129)¼ 2.3

.599 .132

33.6 (2.9) 15.6 (5.6)

33.2 (3.2) 16.2 (5.8)

F(1,129)¼ 0.2 F(1,129)¼ 0.4

.669 .546

6.7 (2.8) 5.4 (2.8)

6.8 (3.2) 5.7 (3.2)

F(1,129)¼ 0 F(1,129)¼ 2

.814 .613

37.4 (11.8) 95.7 (33.3)

37.4 (12.8) 102.5 (46.7)

F(1,112)¼ 0 F(1,112)¼ 0.8

.978 .371

29.2 (11.1)

28 (10.6)

F(1,119)¼ 0.3

.537

(n) indicates the number of items, (s) the time to perform the task significance level was set at p o .05. Key: BDI: Beck depression inventory; CFQ: Cognitive failures questionnaire; VLMT: Verbal learning and memory test; d2: attentional endurance; MMSE: Mini Mental State Examinaion; MWT-B: test of crystallized intelligence; NEO-FFI, ‘‘Big Five’’ personality traits questionnaire; ROCF: Rey–Osterrieth complex figure test; TMT: Trail making test (see text for further information). a Reduced number of participants (Val/Val; n¼ 74, Val/Met–Met/Met n¼ 45) due to a drop-out from the study. See text for more information.

An analysis of the individual standard deviations (ISDs) of the mean RTs revealed a main effect of ‘‘block’’ (F(1,129)¼73.2, po.0001, Z2 ¼.362), suggesting higher variability in the colour naming than word reading block (33378.0 vs. 26877.6 ms). As expected the ISDs were also higher in incompatible than compatible trials, resulting in a main effect of ‘‘compatibility’’ (32176.8 vs. 27978.0 ms, F(1,129)¼52.9, po.0001, Z2 ¼.291). Moreover, ‘‘compatibility’’ varied as a function of ‘‘block’’ F(1,129)¼37.1, po.0001, Z2 ¼.223), suggesting a larger compatibility effect in the colour naming (77 ms) than word reading block (7 ms). No significant interactions with ‘‘BDNFgenotype’’ were found. However, the ISDs tended to differ between the BDNF-genotypes: the Val/Val group showed higher variability in RTs than the combined Val/Met–Met/Met group (31478.6 vs. 287710.7 ms; F(1,129)¼3.6, p¼.059, Z2 ¼ .027).

po.0001, Z2 ¼.122) and in incompatible, compared to compatible trials (5.170.6 vs. 1.670.2%; F(1,129)¼40.5, po.0001, Z2 ¼.239). ‘‘Block’’ was modulated by ‘‘compatibility’’ (F(1,129)¼62.0, po.0001, Z2 ¼.325), showing higher error rates in incompatible trials of the colour naming block than word reading block (8.371.0% vs. 1.970.4%). Importantly, ‘‘compatibility’’ varied as a function of ‘‘BDNF-genotype’’ regardless of block (F(1,129)¼5.0, po.05, Z2 ¼.037), indicating enhanced error rates in incompatible trials in the Val/Val genotype relative to Met-allele carriers (6.370.7% vs. 3.871.0%) and no differences between the groups in compatible trials (1.670.7% vs. 1.670.9%). It is evident from Fig. 1 bottom that this interaction is apparently due to higher error rates in the incompatible trials of the colour naming block, particularly in the Val/Val genotype carriers. 3.3. ERP data

3.2.2. Error rates Participants made more erroneous responses in colour naming than word reading block (4.570.4% vs. 2.170.5%; F(1,129)¼17.8,

Grand average cue- and target locked ERP-waveforms at FCz, Cz, CPz and Pz for the BDNF-genotype groups are presented in

3558

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

val/val

RTs [ms] 1600

word reading

val/met-met/met color naming

1400 1200 1000 800 600 400 200 compatible

incompatible val/val

Errors [%] 15

compatible

incompatible

val/met-met/met

word reading

color naming

10

5

compatible

incompatible

compatible

incompatible

Fig. 1. Mean reaction times (top) and error rates (bottom) with standard errors in word reading and colour naming block in compatible and incompatible trials for the BDNF Val/Val and Val/Met–Met/Met groups.

Figs. 2 and 3. The mean amplitudes of the N450 at Pz are plotted in Fig. 4 and the corresponding difference waves for incompatible– compatible trials for the genotypes are shown in Fig. 5. 3.3.1. Cue-locked In the preparation interval the effects of ‘‘block’’ and ‘‘BDNFgenotype’’ collapsed across compatible and incompatible trials were analysed (note, there was no information about compatibility in the preparation phase). Regarding the terminal CNV that develops continuously until target onset the ANOVA revealed a main effect of ‘‘block’’ (F(1,129)¼21.5, po.0001, Z2 ¼.143) that was due to more negative amplitude in the colour naming than the word reading block (3.470.3 vs.  2.070.2 mV) and an interaction ‘‘block’’  ‘‘electrode’’ (F(2,258)¼8.0, po.0001, Z2 ¼.059), indicating more pronounced CNV in the colour naming block particularly at fronto-central electrodes ( 3.170.4 vs.  3.570.3 vs. 3.67 0.3 mV) than in the word reading block ( 1.370.2 vs.  2.170.2 vs.  2.570.2 mV, for Fz, FCz and Cz, respectively). There was no effect or interaction of BDNF genotype (Fo1). 3.3.2. Target-locked As can be seen in Fig. 3, target stimuli evoked a prominent N2. After the decreasing edge of the N2, there is a negative going wave (N450) covering a time range of 300–600 ms. In the same time range a frontal (P3a) and a parietal positivity (P3b) are visible. Apparently the N450 overlaps with the P3s. We analysed the mean amplitude of the N450 at the midline electrodes in the time range 300–600 ms post target. The ANOVA revealed a main effect of electrode (F(4,516)¼9.1, p o.0001, Z2 ¼.066), which supports the claim of overlapping potentials: at Fz, CPz and Pz the amplitudes were more positive (4.670.3, 4.570.3 and 4.870.3 mV) than at FCz and Cz (3.6 70.3 and 3.670.3 mV). The main effect of ‘‘block’’ (F(1,129)¼6.1, p o.05, Z2 ¼.045) suggests more positive amplitude in the colour naming

than the word reading block (4.670.3 vs. 3.8 70.3 mV). This was particularly evident at fronto-central sites Fz (5.370.6 vs. 3.870.3 mV) and FCz (4.0 70.4 vs. 3.2 70.3 mV) corroborated by the interaction ‘‘block’’ x ‘‘electrode’’ (F(4,516)¼ 4.0, p o.005, Z2 ¼.030). Furthermore, incompatible trials produced generally more negative amplitudes than compatible trials (4.070.3 vs. 4.570.3 mV; F(1,129)¼10.1, p o.005, Z2 ¼ .072) and this pattern interacted with electrode (F(1,129)¼2.5, po.05, Z2 ¼ .019), suggesting most pronounced difference between incompatible and compatible trials at CPz (0.870.3 mV) and Pz (0.67 0.3 mV) and no or smaller difference at fronto-central electrodes (Fz: 0.3 7 0.3 mV; FCz: 0.5 70.3 mV; Cz: 0.5 70.3 mV). More important, the interaction ‘‘compatibility’’  ‘‘BDNF-genotype’’ (F(1,129)¼3.9, po.05, Z2 ¼.030) indicated larger difference between compatible and incompatible trials for the Met-allele carriers (4.770.4 vs. 3.970.4 mV), than for the Val/Val genotype carriers (4.370.3 vs. 4.170.3 mV). As the N450 in response to Stroop stimuli tends to shift to centro-parietal areas (Mager et al., 2007; West et al., 2005; Liotti et al., 2000), we aimed at corroborating this pattern restricting the ANOVA to the sites CPz and Pz (see Figs. 4 and 5). The ANOVA replicated the effect of ‘‘block’’ (F(1,129)¼5.8, po.05, Z2 ¼.043; 4.470.3 vs. 4.970.3 mV, for word reading and colour naming, respectively) and compatibility (F(1,129)¼22.4, po.0001, Z2 ¼.148), suggesting less positive amplitude in incompatible than compatible trials (4.370.3 vs. 5.170.3 mV). Finally, ‘‘compatibility’’ was again modulated by the ‘‘BDNF-genotype’’ (F(1,129)¼7.2, po.01, Z2 ¼.053), suggesting a non significant difference between compatible and incompatible trials in the Val/Val genotype carriers (5.0 70.4 vs. 4.770.4 mV; F(1,78)¼2.5, p ¼.11, Z2 ¼.031) and a substantial difference in Met-allele carriers (5.170.4 vs. 4.170.4 mV; F(1,51)¼21.4, po.0001, Z2 ¼.324). This corroborates the pattern observed at the complete midline.

4. Discussion We investigated the role of the functional BDNF Val66Met polymorphism for interference control in healthy old individuals. The behavioural data of the Stroop test shows a generally increased level of RTs, increased RTs in the interference prone block and a trend for higher intraindividual variability of speed in Val/Val genotype carriers, compared to Met-allele carriers. Moreover, error rates increased in Val/Val genotype carriers and hence performance was impaired in incompatible Stroop trials in Val/ Val genotype carriers, compared to Met-allele carriers. In sum, the behavioural data suggest lower general performance and lower interference control in particular in elderly Val/Val genotype, than Met-allele carriers. The neurophysiological data parallels this pattern of results. There was a negative going wave (N450) overlapping a frontal and parietal P3, which was susceptible to compatibility and BDNF-genotype. Most important, the difference between compatible and incompatible trials was substantial in Met-allele carriers (refer Figs. 4 and 5). In contrast, there was no difference between these conditions in the Val/Val genotype group. This lack of differentiation may underlie declines in behavioural performance in this genotype group. In addition to this interference-related negativity, there was a modulation of the CNV related to the recruitment of frontal areas to optimize performance (Falkenstein et al., 2003). The CNV was enhanced in the interference prone colour naming task, but in the same way for Val/Val and Met-allele carriers. This suggests that the enhanced Stroop task performance observed in Met-allele carriers is not a secondary effect due a better allocation of processing resources. Rather, the behavioural

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

val/val val/met-met/met

cue-locked ERPs word reading

[µV]

3559

color naming

[µV] -5

-5

FCz

FCz

CNV

CNV

0

0

5

5 0

500

1000 [ms]

0

500

1000 [ms]

500

1000

-5

-5

Cz

Cz

0

0

5

5 0

500

0

1000 -5

-5

CPz

CPz

0

0

5

5 0

500

1000

0

500

1000

500

1000

-5

-5

Pz

Pz

0

0

5

5 0 cue

500

1000

0 cue

Fig. 2. Grand average cue-locked ERPs for word reading (left) and colour naming block (right) at FCz, Cz, CPz and Pz for the BDNF Val/Val and Val/Met–Met/Met groups. The ERPs were collapsed over compatible and incompatible trials. The dashed vertical line at the time point 0 ms reflects the onset of the cue stimulus.

effects are primarily due to processes reflected by the centroparietal midline negativity, most likely reflecting interference processing (Liotti et al., 2000; Mager et al., 2007; Markela-Lerenc et al., 2004; Rebai et al., 1997; West, 2004; West & Alain, 1999, 2000).

However, what mechanisms may lead to the observed pattern of results? Compared to the Val allele, the Met allele is associated with a decreased activity-dependent, but not constitutive secretion of BDNF from neurons (Chen et al., 2004; Egan et al., 2003). This

3560

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

compatible val/val incompatible val/val compatible val/met-met/met incompatible val/met-met/met

target-locked ERPs word reading

[µV]

color naming

[µV] -3

-3

FCz

FCz 0

0

7

7 0

500

1000 [ms]

-3

0

500

1000 [ms]

-3

Cz

Cz 0

0

7

7 0

500

1000

-3

0

500

1000

-3

CPz

CPz 0

0

7

7 0

500

1000

0

500

1000

-3

-3

Pz

Pz 0

0

7

7 0 target

500

1000

0 target

500

1000

Fig. 3. Grand average target-locked ERPs for word reading (left) and colour naming block (right) at FCz, Cz, CPz and Pz in compatible and incompatible trials for the BDNF Val/Val and Val/Met–Met/Met groups. The dashed vertical line at the time point 0 ms reflects the onset of the target. The grey coloured field indicates the time window that was used for the analysis of the N450 component.

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

suggests that lower activity dependent BDNF secretion, as conferred by the Met-allele, is related to more efficient Stroop interference control. This adds to recent evidence, suggesting that functions of fronto-striatal circuits, are rendered more efficient in elderly BDNF Met-allele carriers (Erickson et al., 2008; Foltynie et al., 2005; Gajewski et al., 2011; Getzmann et al., in press, Harris et al., 2006; Matsushita et al., 2005; Ventriglia et al., 2002), as well as in healthy young subjects (Beste et al., 2010a). Several studies suggest that performance in the Stroop task requires inhibition of competing responses (Cohen et al., 1990; Friedman & Miyake, 2004; Kok, 1999; Mostovsky & Simmonds, 2008; Zysset et al., 2001), i.e., subjects have to suppress/inhibit word-reading response and to facilitate the colour naming response. For these inhibitory processes, functions of fronto-striatal circuits (Aron, Behrens, Smith, Frank, & Poldrack, 2007; Beste, Willemssen, Saft, & Falkenstein, 2010d; Beste, Dziobek, Hielscher, Willemssen, & Falkenstein, 2009; Garavan, Hester, Murphy, Fassbender, & Kelly, 2006) and especially the direct and indirect pathway are important (Beste et al., 2010a,b). The direct and the indirect pathway are antagonistically organized: Decreases in nigro-striatal activity render the direct pathway less active, while the indirect pathway

val/val

Pz [µV]

6

val/met-met/met

word reading

color naming

5 4 3 2 1

compatible

incompatible

compatible

incompatible

Fig. 4. Mean amplitudes of the N450/P3b at Pz in compatible and incompatible trials in word reading (left) and colour naming blocks (right) for the BDNF Val/Val and Val/Met–Met/Met groups.

3561

becomes more active (Gale, Amirnovin, Williams, Flaherty, & Edkandar, 2008). As a result of such a displacement of the balance between these pathways the inhibitory tone becomes stronger (cf. Beste et al., 2010a). This in turn may affect the ability to control for interference as induced by Stroop stimuli and may be the mechanisms underlying the observation that the Met-allele confers a benefit to its carriers with regard to inhibitory control functions. Yet, with respect to findings suggesting that a similar effect of the Met-allele on inhibitory processes is observable in healthy young and elderly adults (Beste et al., 2010a), the effect observed in the current study does most likely not reflect an age-specific effect. Rather, the effect of the Met-allele inhibitory processes may be conserved throughout ontogenic development and may therefore reflect a general effect of BDNF Met-alleles on cognitive brain functions. Obviously, this interpretation is speculative as we did not investigate young participants and warrants testing in future studies directly comparing young and elderly healthy subjects with the same experimental paradigm. Nevertheless, it should be kept in mind that most studies reported enhanced cognitive abilities in homozygote Val-allele careers, but the observations were mainly restricted to specific memory functions. The present study provides evidence that Val- and Met-allele of the Val66Met polymorphism affects interference processing as a critical executive function. However, due to the frequencies of the genotypes, no conclusions can be drawn, as to whether the effects are modulated in an allele-dose fashion. Future studies may examine this issue. Opposed to the cognitive-neurophysiological data, the results of the neuropsychological testing did not differentiate between the genotypes. One possible reason for the lack of any effects is a lower sensitivity and reliability of the paper and pencil tests compared to the PC-based test to detect subtle differences among genotypes. Whereas a classic Stroop test provides only a one measure of a total performance time, the computer based testing allows collection of a series of trials which considerably increase the reliability of the measure by reducing the measuring error. Finally, the cohort used in our study was possibly too small to detect any effects in the tests (cf. Mandelman & Grigorenko, 2012), however, a lack of BDNF effects in a number of neuropsychological tests was also reported by Houlihan et al., 2009 despite a clearly larger cohort of 1031 elderly individuals.

val/val

difference waves

val/met-met/met

word reading

color naming

Pz

Pz

[µV] -3

[µV] -3

0

0

3

3 0 target

500

1000 [ms]

0

500

1000 [ms]

target

Fig. 5. Difference waves (incompatible–compatible) of the target-locked ERPs for word reading (left) and colour naming blocks (right) at Pz. The negative wave reflects the difference in interference processing between the BDNF Val/Val and Val/Met–Met/Met groups.

3562

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

In summary the study provides further evidence that specific executive processes such as interference processing, vary across Val/Val genotype group and Met-allele carriers. The results show that especially the Met-allele confers a benefit to its carriers. This is possibly due to effects of this functional SNP in fronto-striatal networks. Other cognitive functions, like preparatory processes, which are necessary to allocate cognitive resources to a particular task were not affected by the BDNF Val66Met polymorphism. This suggests that the BDNF Val66Met polymorphism differentially affects various cognitive processes and that even within a broad category of functions (i.e., ‘executive functions’) not all processes are affected to the same extent.

Acknowledgements This work was supported by a grant from the German Insurance Association (GDV, Gesamtverband der Deutschen Versicherungswirtschaft) to M.F. and P.G. and by a Grant from the Deutsche Forschungsgemeinschaft (DFG) BE 4045/10-1 to C.B. We thank Ludger Blanke, Christiane Westedt, Brita Rietdorf, Claudia Wipking, Kirsten Liesenhoff-Henze and Marion Page for excellent technical and organizational assistance, Dr. Meinolf Blaszkewicz and Marie-Louise Lehmann (IfADo) for helpful discussion and advise and all participants for their support. We wish to thank the two anonymous reviewers for their thoughtful comments. References ¨ ¨ Arand, M., Muhlbauer, R., Hengstler, J. G., Jager, E., Fuchs, J., Winkler, L., et al. (1996). A multiplex polymerase chain reaction protocol for the simultaneous analysis of the glutathione S-transferase GSTM1 and GSTT1 polymorphisms. Analytical Biochemistry, 236, 184–186. Aron, A. R., Behrens, T. E., Smith, S., Frank, M. J., & Poldrack, R. A. (2007). Triangulating a cognitive control network using diffusion-weighted magnetic resonance imaging (MRI) and functional MRI. Journal of Neuroscience, 27, 3743–3752. ¨ Aschenbrenner, S. Tucha. O., & Lange, K.W. (2001). Der Regensburger Wortrflus¨ sigkeits-Test. Gottingen: Hogrefe. Atkinson, C. M., Drysdale, K. A., & Fulham, W. R. (2003). Event-related potentials to Stroop and reverse Stroop stimuli. International Journal of Psychophysiology 47, 1–21. Beck, A. T., Ward, C. H., Mendelson, M., Mock, J., & Erbaugh, J. (1961). An inventory for measuring depression. Archives of General Psychiatry, 4, 561–571. Bekinschtein, P., Cammarota, M., Katche, C., Slipczuk, L., Rossato, J. I., Goldin, A., et al. (2008). BDNF is essential to promote persistence of long-term memory storage. Proceedings of the National Academy of Sciences of the United States of America, 105, 2711–2716. ¨ Beste, C., Ness, V., Lukas, C., Hoffmann, R., Stuwe, S., Falkenstein, M., et al. (2012). Mechanisms mediating parallel action monitoring in fronto-striatal circuits. Neuroimage, 62, 137–146. Beste, C., Baune, B. T., Domschke, K., Falkenstein, M., & Konrad, C. (2010a). Paradoxical association of the brain-derived-neurotrophic factor val66met genotype with response inhibition. Neuroscience, 166, 178–184. Beste, C., Kolev, V., Yordanova, J., Domschke, K., Falkenstein, M., Baune, B. T., et al. (2010b). The role of the BDNF Val66Met polymorphism for the synchronzation of error-specific neural networks. Journal of Neuroscience, 30, 10727–10733. Beste, C., Domschke, K., Falkenstein, M., & Konrad, C. (2010c). Differential modulations of response control processes by 5-HT1A gene variation. Neuroimage, 50, 764–771. Beste, C., Willemssen, R., Saft, C., & Falkenstein, M. (2010d). Response inhibition subprocesses and dopaminergic pathways: basal ganglia disease effects. Neuropsychologia, 48, 366–373. Beste, C., Baune, B. T., Domschke, K., Falkenstein, M., & Konrad, C. (2010e). Dissociable influence of NR2B-receptor related neural transmission on functions of distinct associative basal ganglia circuits. Neuroimage, 52, 309–315. Beste, C., Dziobek, I., Hielscher, H., Willemssen, R., & Falkenstein, M. (2009). Effects of stimulus–response compatibility on inhibitory processes in Parkinson’s disease. European Journal of Neuroscience, 29, 855–860. Brickenkamp, R. (1994). Test d2, Aufmerksamkeits-Belastungs-Test (8th ed.). Hogrefe: Goettingen. Broadbent, D. E., Cooper, P. F., FitzGerald, P., & Parkes, K. R. (1982). The cognitive failures questionnaire (CFQ) and its correlates. British Journal of Clinical Psychology, 21, 1–16. Chen, Z. Y., Patel, P. D., Sant, G., Meng, C. X., Teng, K. K., Hempstead, B. L., et al. (2004). Variant brain-derived neurotrophic factor (BDNF) (Met66) alters the

intracellular trafficking and activity-dependent secretion of wild-type BDNF in neurosecretory cells and cortical neurons. Journal of Neuroscience, 24, 4401–4411. Chen, A., Bailey, K., Tiernan, B. N., & West, R. (2011). Neural correlates of stimulus and response interference in a 2-1 mapping Stroop task. International Journal of Psychophysiology, 80, 129–138. Chudasama, Y., & Robbins, T. W. (2006). Functions of fronto-striatal systems in cognition: comparative neuropsychopharmacological studies in rats, monkeys and humans. Biological Psychology, 73, 19–38. Coderre, E., Conklin, K., & van Heuven, W. J. B. (2011). Electrophysiological measures of conflict detection and resolution in the Stroop task. Brain Research, 1413, 51–59. Cohen, J.D, Dunbar, K, & McClelland, J. L. (1990). On the control of automatic processes: a parallel distributed processing model of the Stroop effect. Psychological Review, 97, 332–361. Cohen, J. D., & Servan-Schreiber, D. (1992). Context, cortex and dopamine: a connectionist approach to behavior and biology in schizophrenia. Psychological Review, 99, 45–77. Costa, P. T., Jr., & McCrae, R. R. (1992). Revised NEO personality inventory (NEO-PI-R) and NEO five-factor inventory (NEO-FFI) professional manual. Odessa, F.L: Psychological Assesment Ressources, Inc. Dempster, E., Toulopoulou, T., McDonald, C., Bramon, E., Walshe, M., Filbey, F., et al. (2005). Association between BDNF val66 met genotype and episodic memory. American Journal of Medical Genetics B, 134B, 73–75. Egan, M. F., Kojima, M., Callicott, J. H., Goldberg, T. E., Kolchana, B. S., Bertolino, A., et al. (2003). The BDNF val66met polymorphism affects activity-dependent secretion of BDNF and human memory and hippocampal function. Cell, 112, 257–269. Erickson, K. I., Kim, J. S., Suever, B. L., Voss, M. W., Francis, B. M., & Kramer, A. F. (2008). Genetic contributions to age-related decline in executive function: a 10-year longitudinal study of COMT and BDNF polymorphisms. Frontiers in Human Neuroscience, 2, 11. Falkenstein, M., Hoormann, J., Hohnsbein, J., & Kleinsorge, T. (2003). Short-term mobilization of processing resources is revealed in the event-related potential. Psychophysiology, 40, 914–923. Folstein, M. F., Folstein, S. E., & Mc Hugh, P. R. (1975). Mini-mental state. A practical method for grading the cognitive state of patients for the clinician. Journal of Psychiatry Research, 12, 189–198. Foltynie, T., Lewis, S. G. J., Goldberg, T. E., Blackwell, A. D., Kolachana, B. S., Weinberger, D. R., et al. (2005). The BDNF Val66Met polymorphism has a gender specific influence on planning ability in Parkinson’s disease. Journal of Neurology, 252, 833–838. Freude, G., & Ullsperger, P. (2000). Slow brain potentials as a measure of effort? Applications in mental workload studies in laboratory settings. In: R. W. Backs, & W. Boucsein (Eds.), Engineering psychophysiology: issues and applications (pp. 255–267). Mahwah, NJ: Lawrence Erlbaum Associates. Friedman, N. P., & Miyake, A. (2004). The relations among inhibition and interference control functions: a latent-variable analysis. Journal of Experimental Psychology General, 133, 101–135. Gajewski, P. D., Hengstler, J., Golka, K., Falkenstein, M., & Beste, C. (2011). The Metallele of the BDNF Val66Met polymorphism enhances task switching in elderly. Neurobiology of Aging, 32, 2327.e7–2327.e19. Gajewski, P. D., Stoerig, P., & Falkenstein, M. (2008). ERP—correlates of response selection in a response conflict paradigm. Brain Research, 1189, 127–134. Gale, J. T., Amirnovin, R., Williams, Z. M., Flaherty, A. W., & Edkandar, E. N. (2008). From symphony to cacophony: pathophysiology of the human basal ganglia in Parkinson’s disease. Neuroscience & Biobehavioural Reviews, 32, 378–387. Garavan, H., Hester, R., Murphy, K., Fassbender, C., & Kelly, C. (2006). Individual differences in the functional neuroanatomy of inhibitory control. Brain Research, 1105, 130–142. Getzmann, S. Gajewski, P.D., Hengstler, J. Golka, K., Falkenstein, M. Beste C. The role of the BDNF Val66Met polymorphism for goal-directed behaviour in healthy elderly – evidence from auditory distraction. Neuroimage. in press. Golka, K., Hermes, M., Selinski, S., Blaszkewicz, M., Bolt, H. M., Roth, G., et al. (2009). Susceptibility to urinary bladder cancer: relevance of rs9642880[T], GSTM1 0/0 and occupational exposure. Pharmacogenet Genomics, 19(11), 903–906. Gratton, G., Coles, M. G. H., & Donchin, E. (1983). A new method for off-line removal of ocular artifact. Electroencephalography and Clinical Neurophysiology, 55, 468–484. Hariri, A. R., Goldberg, T. E., Mattay, V. S., Kolachana, B. S., Callicott, J. H., Egan, M. F., et al. (2003). Brain-derived neurotrophic factor val66met polymorphism affects human memory-related hippocampal activity and predicts memory performance. Journal of Neuroscience, 23, 6690–6694. Harris, S. E., & Deary, I. J. (2011). The genetics of cognitive ability and cognitive ageing in healthy older people. Trends in Cognitive Science, 15, 388–394. Harris, S. E., Fox, H., Wright, A. F., Hayward, C., Starr, J. M., Whalley, L. J., et al. (2006). The brain-derived neurotrophic factor Val66Met polymorphism is associated with age-related change in reasoning skills. Molecular Psychiatry, 11, 505–513. Hayashi, M., Mistunaga, F., Ohira, K., & Shimizu, K. (2001). Changes in BDNFimmunoreactive structures in the hippocampal formation of the aged macaque monkey. Brain Research, 918, 191–196. Helmstaedter, C., & Durwen, H. F. (1990). VLMT: Verbaler Lern- und ¨ Merkfahigkeitstest. Ein praktikables und differenziertes Instrumentarium zur

P.D. Gajewski et al. / Neuropsychologia 50 (2012) 3554–3563

¨ ¨ Prufung der verbalen Gedachtnisleistungen. Schweizer Archiv f¨ ur Neurologie und Psychiatrie, 141, 21–30. Houlihan, L. M., Harris, S. E., Luciano, M., Gow, A. J., Starr, J. M., Visscher, P. M., et al. (2009). Replication study of candidate genes for cognitive abilities: the Lothian Birth Cohort 1936. Genes, Brain and Behavior, 8, 238–247. Hultsch, D. F., & MacDonald, S. W. S. (2004). Intraindividual variability in performance as a theoretical window onto cognitive aging. In: R. A. Dixon (Ed.), New frontiers in cognitive aging ((Eds.)). Oxford: Oxford University Press. Jasper, H. H. (1958). The ten–twenty electrode system of the International Federation. Electroencephalography and Clinical Neurophysiology, 10, 370–375. ¨ ¨ Jager, A., & Althoff, K. (1994). Der WILDE-Intelligenz-Test. Gottingen: Hogrefe. Kafitz, K. W., Rose, C. R., Thoenen, H., & Konnerth, A. (1999). Neurotrophin-evoked rapid excitation through TrkB receptors. Nature, 401, 918–921. Kok, A. (1999). Varieties of Inhibition: manifestations in cognition, event-related potentials and aging. Acta Psychologica, 101, 129–158. Lehmann, M. L., Selinski, S., Blaszkewicz, M., et al. (2010). Rs710521[A] on chromosome 3q28 close to TP63 is associated with increased urinary bladder cancer risk. Archives of Toxicology, 84, 967–978. Lehrl, S. (1995). Mehrfach-Wortwahl-Test (MWT). Erlangen: Medizinische Verlagsgesellschaft. Li, S. C., Chicherio, C., Nyberg, L., von Oertzen, T., Nagel, I. E., Papenberg, G., et al. (2010). Ebbinghaus revisited: influences of the BDNF Val66Met polymorphism on backward serial recall are modulated by human aging. Journal of Cognitive Neuroscience, 22, 2164–2173. ¨ Lindenberger, U., Nagel, I. E., Chicherio, C., Li, S. C., Heekeren, H. R., & Backman, L. (2008). Age-related decline in brain resources modulates genetic effects on cognitive functioning. Frontiers in Neuroscience, 2, 234–244. Liotti, M., Woldorff, M. G., Perez, R., & Mayberg, H. S. (2000). An ERP study of the temporal course of the Stroop colour-word interference effect. Neuropsychologia, 38, 701–711. ¨ MacDonald, S. W.S, Nyberg, L., & Backman, L. (2006). Intraindividual variability in behavior: links to brain structure, neurotransmission, and neuronal activity. Trends in Neuroscience, 29, 474–480. ¨ ¨ Mager, R., Bullinger, A. H., Brand, S., Schmidlin, M., Scharli, H., Muller-Spahn, F., et al. (2007). Age-related changes in cognitive conflict processing: an eventrelated potential study. Neurobiology of Aging, 28, 1925–1935. Mandelman, S. D., & Grigorenko, E. L. (2012). BDNF Val66Met and cognition: all, none, or some? A meta-analysis of the genetic association. Genes, Brain and Behavior, 11, 127–136. Markela-Lerenc, J., Ille, N., Kaiser, S., Fiedler, P., Mundt, C., & Weisbrod, M. (2004). Prefrontal-cingulate activation during executive control: which comes first? Brain Research, Cognitive Brain Research, 18, 278–287. Matsushita, S., Arai, H., Matsui, T., Yuzuriha, T., Urakami, K., Masaki, T., et al. (2005). Brain-derived neurotrophic factor gene polymorphisms and Alzheimer’s disease. Journal of Neural Transmission, 112, 703–711. McAllister, A. K., Katz, L. C., & Lo, D. C. (1999). Neurotrophins and synaptic plasticity. Annual Review of Neuroscience, 22, 295–318. Miyajima, F., Ollier, W., Mayes, A., Jackson, A., Thacker, N., Rabbitt, P., et al. (2008). Brain-derived neurotrophic factor polymorphism Val66Met influences cognitive abilities in the elderly. Genes, Brain and Behavior, 7, 411–417. Mostovsky, S. H., & Simmonds, D. J. (2008). Response inhibition and response selection: two sides of the same coin. Journal of Cognitive Neuroscience, 20, 751–761. Nacmias, B., Piccini, C., Bagnoli, S., Tedde, A., Cellini, E., Bracco, L., et al. (2004). Brain-derived neurotrophic factor, apolipoprotein E genetic variants and cognitive performance in Alzheimer’s disease. Neuroscience Letters, 367, 379–383. Nagel, I. E., Chicherio, C., Li, S.-C., von Oertzen, T., Sander, T., Villringer, A., et al. (2008). Human aging magnifies genetic effects on executive functioning and working memory. Frontiers in Human Neuroscience, 2, 1–8. Osterrieth, P. A. (1944). Filetest de copie d’une figure complex: contribution a l’etude de la perception et de la memoire. [The test of copying a complex

3563

figure: a contribution to the study of perception and memory]. Archives de Psychologie, 30, 286–356. Pang, P. T., & Lu, B. (2004). Regulation of late-phase LTP and long-term memory in normal and aging hippocampus: role of secreted proteins tPA and BDN. Ageing Research Reviews, 3, 407–430. Paus, T. (2001). Primate anterior cingulate cortex: where motor control, drive and cognition interface. Nature Reviews Neuroscience, 2, 417–424. Payton, A. (2009). The impact of genetic research on our understanding of normal cognitive ageing: 1995 to 2009. Neuropsychology Review, 19, 451–477. Picard, N., & Strick, P. L. (1996). Motor areas of the medial wall: a review of their location and functional activation. Cerebral Cortex, 6, 342–353. Pezawas, L., Verchinski, B. A., Mattay, V. S., Callicott, J. H., Kolachana, B. S., Straub, R. E., et al. (2004). The brain-derived neurotrophic factor val66met polymorphism and variation in human cortical morphology. Journal of Neuroscience, 24, 10099–10102. Reitan, R. M. (1992). Trail making test: manual for administration and scoring. Tucson, AZ: Reitan Neuropsychology Laboratory. Raz, N., Rodrigue, K. M., Kennedy, K. M., & Land, S. (2009). Genetic and vascular modifiers of age-sensitive cognitive skills: effects of COMT, BDNF, ApoE and hypertension. Neuropsychology, 23, 105–116. Rebai, M., Bernard, C., & Lannou, J. (1997). The Stroop’s test evokes a negative brain potential, the N400. International Journal of Neuroscience, 91, 85–94. Rybakowski, J. K. (2008). BDNF gene: functional Val66Met polymorphism in mood disorders and schizophrenia. Pharmacogenomics, 9, 1589–1593. Strauss, J., Barr, C. L., George, C. J., Ryan, C. M., King, N., Shaikh, S., et al. (2004). BDNF and COMT polymorphisms: relation to memory phenotypes in young adults with childhood-onset mood disorder. Neuromolecular Medicine, 5, 181–192. Stroop, J. R. (1935). Studies of interference in serial verbal reactions. Journal of Experimental Psychology, 18, 643–662. Turken, A. U., & Swick, D. (1999). Response selection in the human anterior cingulate cortex. Nature Neuroscience, 2, 920–924. van Thriel, C., Westerink, R. H., Beste, C., Bale, A. S., Lein, P. J., & Leist, M. (2012). Translating neurobehavioural endpoints of developmental neurotoxicity tests into in vitro assays and readouts. Neurotoxicology, 33, 911–924. van Wingen, G., Rijpkema, M., Franke, B., van Eijndhoven, P., Tendolkar, I., Verkes, R. J., et al. (2010). The brain-derived neurotrophic factor Val66Met polymorphism affects memory formation and retrieval of biologically salient stimuli. Neuroimage, 50, 1212–1218. Ventriglia, M., Bocchio-Chiavetto, L., Benussi, L., Binetti, G., Zanetti, O., Riva, M. A., et al. (2002). Association between the BDNF 196 A/G polymorphism and sporadic Alzheimer’s disease. Molecular Psychiatry, 7, 136–137. Walter, W. G., Cooper, R., Aldridge, V. J., McCallum, W. C., & Winter, A. L. (1964). Contingent negative variation: an electric sign of sensorimotor association and expectancy in the human brain. Nature, 203, 380–384. Wechsler, D. (1955). Manual for the Wechsler adult intelligence scale. New York. Psychological Corporation. West, R. (2003). Neural correlates of cognitive control and conflict detection in the Stroop and digit-location tasks. Neuropsychologia, 41, 1122–1135. West, R. (2004). The effects of aging on controlled attention and conflict processing in the Stroop task. Journal of Cognitive Neuroscience, 16, 103–113. West, R., & Alain, C. (1999). Event-related neural activity associated with the Stroop task. Brain Research Cognitive Brain Research, 16, 157–164. West, R., & Alain, C. (2000). Age-related decline in inhibitory control contributes to the increased Stroop effect observed in older adults. Psychophysiology, 37, 179–189. West, R., Jakubek, K., Wymbs, N., Perry, M., & Moore, K. (2005). Neural correlates of conflict processing. Experimental Brain Research, 167, 38–48. ¨ Zysset, S., Muller, K., Lohmann, G., & von Cramon, D. Y. (2001). Colour-word matching Stroop task: separating interference and response conflict. Neuroimage, 13, 29–36.