- Email: [email protected]
Three novel Toll genes (PtToll1–3) identified from a marine crab, Portunus trituberculatus: Different tissue expression and response to pathogens
Fish & Shellfish Immunology 46 (2015) 737e744
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Three novel Toll genes (PtToll1e3) identified from a marine crab, Portunus trituberculatus: Different tissue expression and response to pathogens Su-Ming Zhou, Xue-Mei Yuan, Shun Liu, Meng Li, Zhen Tao, Guo-Liang Wang* Key Laboratory of the Ministry of Education for Applied Marine Biotechnology, School of Marine Science, Ningbo University, Ningbo 315211, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 May 2015 Received in revised form 28 July 2015 Accepted 29 July 2015 Available online 1 August 2015
The Toll signaling pathway is one of the most important regulators of the immune response in both vertebrates and invertebrates. Herein, three novel Toll (PtToll1e3) cDNA sequences were cloned from the swimming crab, Portunus trituberculatus. PtToll1 has 1003 amino acid residues and consists of an extracellular domain containing 15 leucine-rich repeats (LRRs) and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain of 139 residues. PtToll2 encodes 1196 peptides, with an extracellular domain containing 28 LRRs and a cytoplasmic TIR domain. PtToll3 is 1229 residues long and contains 26 LRRs and a cytoplasmic TIR domain. Based on sequence and phylogenetic analyses, PtToll1 distinctly clustered with almost all crustacean Tolls, except Litopenaeus vannamei Toll3. However, PtToll2 and PtToll3 were separated from most reported crustacean Tolls, which mostly clustered with Drosophila melanogaster (Dm) Toll8, L. vannamei Toll3, and DmToll6. Reverse transcription PCR and real-time quantitative PCR analyses showed that PtToll1 and PtToll3 were constitutively expressed in all tissues tested, but PtToll2 mRNA was only highly enriched in gills. Upon challenges with Vibrio alginolyticus, Candida lusitaniae, or white spot syndrome virus (WSSV), the three Tolls exhibited different responses: the PtToll1 transcript was up-regulated in response to C. lusitaniae or V. alginolyticus challenge, but did not respond to WSSV challenge; both PtToll2 and PtToll3 mRNAs were down-regulated 12 h after C. lusitaniae or V. alginolyticus infection. However, WSSV elicited the expression of PtToll2 at 6 h post-infection, but suppressed transcription of PtToll3 at 24 h post-infection. The study provides valuable data for understanding the role of Toll pathways in the host defense against microbial pathogens, which will facilitate future studies on hostepathogen interactions in crabs. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Portunus trituberculatus Innate immunity Toll Expression analysis
1. Introduction The innate immune system is the first line of the host defense against pathogens, and it has been conserved throughout evolution. Upon infection, microbe-specific immune elicitors, known as pathogen-associated molecular patterns (PAMPs), are recognized by a set of so-called pattern-recognition receptors (PRRs) [1]. The Toll-like receptor (TLR) family is one of the most extensively studied PRRs, and it plays a fundamental role in pathogen recognition and the activation of innate immunity [2]. Toll, the founding member of the TLR family, was initially identified as a gene product essential for the development of embryonic dorsoventral polarity
* Corresponding author. E-mail address: [email protected] (G.-L. Wang). http://dx.doi.org/10.1016/j.fsi.2015.07.027 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
in Drosophila [2,3]. Later, it was also shown to sense microbial pathogens, as were mammalian TLRs [4,5]. To date, one Toll-like protein in Caenorhabditis elegans [6], nine Toll-related receptors (Toll1e9) in Drosophila [1,3], and 13 members of TLRs in mammals [5,7] have been identified. However, studies have revealed differences between insects and mammals in terms of TLR domain organization, activation mode, and function. Sequence analysis of TLRs showed some structural differences between TLR families [8]. Based on the organization of extracellular arrays of leucine-rich repeats (LRRs), TLRs can be classified into two types: the vertebrate type (V-type) and the protostome-type (P-type). V-type TLRs have an array of LRRs capped by cysteine-rich domains located at the N-and C-terminal LRR domains (LRRNT and LRRCT, respectively). P-type TLRs also contain LRRNT and LRRCT domains, but they do not cap the LRR array, but are instead found within the array in a tandem orientation [9,10].
738
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
All Drosophila Tolls, except DmToll9, are P-type Tolls [10]. Functionally, accumulated evidence showed that mammalian TLRs can directly recognize different PAMPs via specific LRR domains in respective TLRs, as TLR1, TLR2, TLR5, TLR6, and TLR10 recognize microbial lipids, sugars, and proteomes, whereas the highly related subfamilies of TLR3, TLR7, TLR8, and TLR9 recognize nucleotide derivatives of viral or bacterial origin [5,10e12]. In contrast with mammals, to date, Drosophila melanogaster Toll1 (DmToll1) is the only confirmed Toll that is responsible for antimicrobial peptide (AMP) induction via the Toll pathway in Drosophila [1,3,11]. Moreover, Drosophila Toll recognizes its endogenous ligand, the cleaved form of Sp€ aetzle, which requires the participation of several accessory proteins [4,13]. Crustacea, most of which are aquatic and breath using gills, is another arthropod class that is distinct from the Insecta. In shrimp, Tolls have been identified in Litopenaeus vannamei, Fenneropenaeus chinensis, Penaeus monodon, and Marsupenaeus japonicus [14e17]. According to protein similarities, there are three different Tolls (Toll1e3) that have been identified in L. vannamei, and all Tolls were shown to respond to challenges with Vibrio alginolyticus or white spot syndrome virus (WSSV) [14]. Toll proteins were also found in two crab species, one in Scylla paramamosain [18] and two in Eriocheir sinensis [19], which were responsive to bacterial pathogens or PAMPs. In this paper, three novel Tolls (PtToll1e3) were reported in the marine crab Portunus trituberculatus. To explore their evolutionary relationships and elucidate the possible functions of these genes, we conducted a phylogenetic analysis, characterized their predicted functional domains, and examined their mRNA expression profiles in crab tissues. In addition, the expression profiles of these different Tolls in response to the injection of Candida lusitaniae, V. alginolyticus, or WSSV were also analyzed by real-time quantitative PCR (qRT-PCR). These data will expand our understanding of the response of crustacean Toll signaling cascades to pathogens. 2. Materials and methods 2.1. Tissue collection, RNA extraction, and cDNA synthesis Swimming crabs (P. trituberculatus; approximately 150 g body weight) were purchased from a local seafood market in Ningbo, Zhejiang province, China. Three individuals were randomly used for tissue preparation. Crab tissues, including hemocytes, gills, muscle, heart, intestine, and hepatopancreas, were removed via dissection and preserved at 80 C for RNA extraction. Total RNAs were extracted from the crab tissues using the E.Z.N.A. Total RNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer's instructions. All RNAs were checked spectrophotometrically (Thermo, NanoDrop 2000, USA), as well as by agarose gel electrophoresis. Approximately 5 mg of total RNA that was extracted from hemocytes was reverse transcribed with the PrimeScript™ 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) according to the manufacturer's instructions. 2.2. Cloning and sequencing of the full-length cDNAs The cDNA of PtToll1e3 was initially amplified by PCR using the degenerate primers listed in Table 1. Based on the cDNA fragments, the full-length PtToll1e3 cDNA was obtained via the 50 and 30 rapid amplification of cDNA ends (RACE) using the SMART RACE cDNA Amplification Kit (Clontech, Beijing, China) according to the manufacturers' instructions. The primers used in the 50 and 30 RACE are listed in Table 1. All the PCR products were sub-cloned into the plasmid vector pMD19-T Simple (Takara) and transformed into competent Escherichia coli DH5a cells for sequencing.
Table 1 PCR primers used in this study. Primer Degenerate PCR PtToll1 DF PtToll1 DR Pt Toll2/PtToll3 DF Pt Toll2/PtToll3 DR RACE PCR 50 PtToll1-RACE1 50 PtToll1-RACE2 30 PtToll1-RACE1 30 PtToll1-RACE2 50 PtToll2-RACE1 50 PtToll2-RACE2 30 PtToll2-RACE1 30 PtToll2-RACE2 50 PtToll3-RACE1 50 PtToll3-RACE2 30 PtToll3-RACE1 30 PtToll3-RACE2 qRT-PCR analysis PtToll1 F PtToll1 R PtToll2 F PtToll2 R PtToll3 F PtToll3 R 18s RNA F 18s RNA R GADPH F GADPH R
Sequence (50 e30 ) 50 50 50 50
GGAACTTGAARMMTGGCACYTGGA 30 AGGTTTCTCAGAGCATGAGGT 30 GAYGCCTGYGAYTGCGAGATGA 30 GGGAARTCSCGRTAGTGCA 30
50 50 50 50 50 50 50 50 50 50 50 50
CCAGGTGGCAGACTCTTGATAGG 30 TCTGGAGGCAATGAAGTGAACA 30 ATTGAGGACAGCCACAGGACT 30 ATCAGATCATCCCAGGTT 30 CTCGAACTCGTATCCCTTGAGC 30 CCAGTAGCCTCAGGCCATTG 30 AGCCCTGCCTATAAGTTGTGTCT 30 CCTCATCCTCTCAGAGAACTTCATC 30 AGGTTCCACTTTCAATGTGGGTA 30 GCCGTATAGATTGTGGAAGACCTG 30 CGGCAAGGACATCAAGTGCTACTCGG 30 GTGCTGCTGGTGCTGTGCTTCCTGT 30
50 50 50 50 50 50 50 50 50 50
GCTTCCACCACTGTCTTC 30 ACTTAGGCTCTCCACTCTC 30 GGTAACTACTTCGAGATTGAGAG 30 GGAGATGAGATTGTTGTTGAGA 30 TTATACCAGTGAGTCTCCAGTG 30 GTTGATCTTGTCGTCGTTGAG 30 TCCGATAACGAACGAGACT 30 TAAGAAGAAGCTGCGAACTG 30 TGAGGTGAAGGTAGAGGAT 30 CCAGTGAAGTGAGCAGAG 30
Note: M ¼ A þ C, R ¼ G þ A, S ¼ G þ C, Y ¼ C þ T; F indicates forward; R, reverse.
2.3. Bioinformatic analyses Nucleotide sequences were translated to amino acid sequences using the ExPASy Translate tool (http://www.expasy.ch/tools/dna. html). The predicted amino acid sequences were blasted against the NCBI database using the BLASTP program (http://blast.ncbi.nlm. nih.gov/Blast.cgi) to identify sequence identities and similarities. The identification and annotation of protein domains were performed using the web-based SMART program (http://smart.emblheidelberg.de/). Potential N-linked glycosylation sites were predicted according to the Asn-X-Ser/Thr rule (http://cbs.dtu.dk/ services/NetNGlyc). Phylogenetic analyses of the PtToll1e3 amino acid sequences were conducted using the MEGA 5 program. 2.4. Immune challenge The Gram-negative bacterium V. alginolyticus and the fungus C. lusitaniae are pathogenic to cultured swimming crabs, which were described as the aetiological agents of emulsification disease in this crab [20e22]. The WSSV has been recognized as an important viral pathogen in shrimp. However, because of mixed aquacultures of swimming crabs and other shrimp species, WSSV was also frequently detected in diseased swimming crabs in farms [23,24]. In this study, several groups (n ¼ 15) were used for the challenge experiments. Experimental crabs were reared in a recirculating water tank system filled with air-pumped seawater (2.4% salinity) at 24 ± 0.5 C. The crabs were allowed to acclimatize for at least 5 d before the experiments were conducted. Each group was injected with 0.2 mL of C. lusitaniae (6 106 colony-forming units (CFU)/ mL), V. alginolyticus (5.5 107 CFU/mL), WSSV (approximately 150 copies/mL, quantified by qRT-PCR) or phosphate-buffered saline (PBS). The gills of three crabs from each group were randomly collected at 0, 6, 12, and 24 h post-infection for RNA extraction.
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
2.5. RT-PCR analysis Gene expression patterns of PtToll1e3 in healthy crabs were determined using reverse transcription PCR (RT-PCR). Primer sets (Table 1) were used to amplify specific fragments for PtToll1e3, and
739
the PCR products were sequenced to verify their specificity. 18S rRNA was used as the internal control. The cycling protocol for PtToll1e3 consisted of an initial denaturation at 95 C for 2 min, followed by 35 cycles of 95 C for 20 s, 60 C for 20 s, and 72 C for 30 s. The cycling protocol for 18S rRNA consisted of an initial
Fig. 1. Nucleotide and deduced amino acid sequences of PtToll1e3. The amino acid sequences are shown under the cDNA sequences. Signal peptides are shaded in dark gray. Transmembrane (TM) segments are boxed. TIR domains are shaded in light gray, while letters representing start codons (ATG), stop codons (TAA), and potential N-linked glycosylation sites are bolded.
740
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
Fig. 2. Predicted protein domain architecture of PtToll1e3 determined by SMART analysis. All three Tolls belong to the P-type TLRs and contain a TIR domain, a TM domain, multiple extracellular LRRs, and an N-terminal signal peptide. Signal peptides are shown in red, TM domains are in dark blue, and low complexity regions are in pink. Other domains, including LRR domains and TIR domains, are labeled accordingly. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
denaturation at 95 C for 2 min, followed by 25 cycles of 95 C for 20 s, 60 C for 20 s, and 72 C for 30 s. PCR products were separated using electrophoresis in a 1.5% agarose gel and visualized under UV light.
2.6. Real-time quantitative PCR All samples were lysed to purify total RNA using the E.Z.N.A. Total RNA Kit (Omega Bio-Tek) according to the manufacturer's
Fig. 3. Multiple sequence alignments of the TIR domains of crustacean Tolls and DmToll1e9. The alignment was performed using Clustal X. Identical residues are indicated in black and similar residues are in light gray.
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
instruction. cDNAs for qRT-PCR analysis were synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara). Primers for PtToll1e3 and the 18S rRNA and glyceraldehyde 3-phosphate dehydrogenase (GADPH) reference genes were designed using Beacon Designer 7.80 software and listed in Table 1. Moreover, all specific amplicons were cloned into the pMD19-T vector to detect the amplification efficiency of the primer sets used for the qRT-PCR analysis. The efficiencies of the qRT-PCR primers for the PtToll1e3, 18S rRNA, and GADPH genes were 1.966, 1.889, 1.901, 2.015, and 2.031, respectively. qRT-PCR was performed with a Roche LightCycler 480 Real-time PCR System (Roche, Basel, Switzerland) using LightCycler 480 SYBR Green I Master (Roche). Each run included a no-template control to test the assay reagents for contamination. The cycling protocol consisted of an initial denaturation at 95 C for 5 min, followed by 40 cycles of 95 C for 15 s, 60 C for 15 s, and 72 C for 15 s. The specificities of the PCR products were determined by melting curve analysis and sequencing. Each sample was analyzed in triplicate. The relative expression ratio of the cytokine genes were analyzed using the 2△△CT method in triplicate for three independent, parallel samples [25]. 2.7. Statistical analysis
741
by L. vannamei Toll3 (LvToll3) and PtToll3 (69.5 and 69.6% identity, respectively) (Fig. 3). The full-length cDNA of PtToll3 is 4432 bp long, with an ORF of 3690 bp encoding a putative protein of 1229 amino acids. PtToll3 shared 18.0% identity with PtToll1, 76.2% identity with LvToll3, and 34.9% identity with DmToll6. The predicted PtToll2 protein consisted of 26 LRRs, including one LRRCT domain and one LRRNT domain, a single-pass transmembrane segment (amino acids 995e1017), and an intracellular TIR domain (amino acids 1047e1184) (Figs. 1 and 2). There were 14 potential N-linked glycosylation sites predicted in PtToll2 (Fig. 1). Comparison of the PtToll3 TIR domain with other known TIRs showed that the PtToll3 TIR domain was most similar to LvToll3 (94.2% identity), followed by PtToll2 and DmToll8 (69.6% and 66.7% identity, respectively) (Fig. 3). 3.2. Phylogenetic analysis Based on the deduced amino acid sequences of the PtTolls, phylogenetic trees were constructed with orthologs in other species to identify their evolutionary relationship. Fig. 4 shows that PtToll1 distinctly clustered with almost all crustacean Tolls, DmToll1 and DmToll5, while its phylogenetically closest relatives
The expression levels of PtToll1e3 (expressed as mean ± standard deviation) were analyzed by one-way analysis of variance (ANOVA), followed by Dunnett's test for multiple comparisons using the SPSS 16.0 statistical software program. p < 0.05 was considered statistically significant. 3. Results 3.1. Sequence analysis of PtToll1e3 The full-length cDNAs of PtToll1e3 (GenBank accession numbers KM514314, KR528473, and KR528474, respectively) were obtained using homology cloning and switching mechanism at the 50 end of the RNA template (SMART) rapid amplification of cDNA ends (RACE). There are 3733 nucleotides in PtToll1 cDNA, which contain a putative open reading frame (ORF) of 3012 bp encoding a polypeptide of 1003 amino acid residues. PtToll1 shared 87.9% identity with S. paramamosain Toll (SpToll), 61.2% identity with E. sinensis Toll1 (EsToll1), 38.8%e 43.9% identity with most shrimp Tolls, and 22.5% identity with DmToll1. Prediction of protein domains revealed that PtToll1 consisted of 15 LRRs, including two LRRCT domains, a singlepass transmembrane segment (amino acids 785e807), and an intracellular TIR domain (amino acids 837e975) (Figs. 1 and 2). There were 13 potential N-linked glycosylation sites predicted in PtToll1 (Fig. 1). Comparison of the PtToll1 TIR domain with other known TIRs showed that the PtToll1 TIR domain was most similar to SpToll (97.1% identity) and EsToll1 (90.6% identity), followed by other crustacean Tolls (66.1%e74.1% identity) and DmToll1 (54.7% identity) (Fig. 3). PtToll2 cDNA was 4277 bp in length, and it consisted of an ORF of 3591 bp encoding a polypeptide of 1196 amino acid residues. PtToll2 shared 17.4% identity with PtToll1, 43.9% identity with PtToll3, and 44.0% identity with DmToll8. The predicted PtToll2 protein consisted of 28 LRRs, including two LRRCT domains and one LRRNT, a single-pass transmembrane segment (amino acids 980e1002), and an intracellular TIR domain (amino acids 1032e1169) (Figs. 1 and 2). There were 17 potential N-linked glycosylation sites predicted in PtToll2 (Fig. 1). Comparison of the PtToll3 TIR domain with other known TIRs showed that the PtToll2 TIR domain was most similar to DmToll8 (70.3% identity), followed
Fig. 4. Phylogenetic tree of Toll proteins and PtToll1e3. PtToll1e3 are marked by black boxes. The rooted trees were constructed via the neighbor-joining method and bootstrapped 1000 times using MEGA 5.0 software (http://www.megasoftware.net/index. html). Sequences used for the phylogenetic tree analysis of Tolls included: FcToll (ABQ59330.1), PmToll (ADK55066.1), LvToll1 (ABK58729.1), MjToll1 (BAG68890.1), EsToll2 (AGT21374.1), LvToll2 (AEK86516.1), MjToll2 (BAF99007.1), EsToll1 (AGK90305.1), SpToll (AEX20238.1), PtToll1 (KM514314), PtToll2 (KR528473), PtToll3 (KR528474), LvToll3 (AEK86517.1), CrToll (ABK88278.1), TtToll (BAD12073.1) DmToll1 (AAA28941.1), DmToll2 (AAF57509.1), DmToll3 (AAF86229.1), DmToll4 (AAF52747.3), DmToll5 (AAF86227.1), DmToll6 (AAF86226.1), DmToll7 (AAF57514.1), DmToll8 (AAF86224.1), and DmToll9 (AAF51581.1). Abbreviations: Cr, Carcinoscorpius rotundicauda; Dm, Drosophila melanogaster; Es, Eriocheir sinensis; Fc, Fenneropenaeus chinensis; Lv, Litopenaeus vannamei; Mj, Marsupenaeus japonicas; Pm, Penaeus monodon; Pt, Portunus trituberculatus; Sp, Scylla paramamosain; Tt, Tachypleus tridentatus.
742
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
were SpToll and EsToll1. However, PtToll2 and PtToll3 were separated from most reported crustacean Tolls, as it mainly clustered with DmToll8, LvToll3, and DmToll6 (Fig. 4).
V. alginolyticus infection, and it was also suppressed 24 h after WSSV infection (Fig. 6). 4. Discussion
3.3. Tissue distribution of PtToll1e3 in healthy crabs In healthy crabs, PtToll1 and PtToll3 were constitutively expressed in all tissues tested, while PtToll2 showed tissue-specific expression (Fig. 5D). qRT-PCR analysis showed that PtToll1 expression was higher in hemocytes, gills, intestine, and heart than in muscle and hepatopancreas (Fig. 5A and D). However, the order of the level of the PtToll3 transcript, from lowest to highest, was hepatopancreas, hemocytes, muscle, intestine, heart, and gills (Fig. 5C and D). In comparison, PtToll2 was mainly expressed in gills, but was weakly expressed in other organs, as shown in Fig. 5B and D. Interestingly, all three Toll transcripts were strongly expressed in gills. 3.4. Expression profiles of PtToll1e3 in response to immune challenge To investigate the responses of PtToll1e3 to immune challenges, we collected crab gills at 0, 6, 12, and 24 h post-injection with C. lusitaniae, V. alginolyticus, or WSSV and performed a qRT-PCR analysis. The results showed that PtToll1 expression was upregulated in gills during 24 h post-injection of C. lusitaniae or V. alginolyticus, but did not respond to the WSSV challenge (Fig. 6). In comparison, PtToll2 expression was induced at 6 h post-injection of C. lusitaniae or WSSV, while it was sharply reduced 12 h after C. lusitaniae or V. alginolyticus infection (Fig. 6). Similarly, PtToll3 expression was down-regulated 12 h after C. lusitaniae or
Different Tolls have been found in several crustacean species [14e17]. According to sequence similarities and phylogenetic relationships, three different Tolls have been identified in crustaceans [14], compared with nine different Toll proteins in Drosophila [1,3]. In the present study, for the first time, three novel Tolls were identified in the marine crab P. trituberculatus. Based on the sequence similarity and phylogenetic analyses, PtToll1 exhibited high similarity to crab Toll proteins found in S. paramamosain and E. sinensis, and it clustered on one branch containing most of the shrimp Tolls, as well as DmToll1 and DmToll5. In comparison, PtToll2 shared only 17.4% identity with PtToll1 and other shrimp Tolls, and it mostly clustered with another insect Toll protein, DmToll8. These data suggested that PtToll2 represents a new type of Toll protein in crustaceans. PtToll3 shared 76.2% identity with LvToll3, and it was the phylogenetically closest relative to LvToll3, PtToll2, DmToll6, and DmToll8. Regarding structure, PtToll1 and PtToll2 contain more than one LRRCT motif in their ectodomains; PtToll3 contains one LRRCT domain and one LRRNT domain, but they are found within the array in a tandem orientation. Thus, all three Tolls identified in this study, PtToll1e3, are P-type TLRs. The existing literature has described tissue distributions of several crustacean Tolls. It showed that all three different type Tolls in L. vannamei were constitutively expressed in all tested tissues [14]. Tolls identified in two crab species were also shown to be widely expressed in various tissues [18,19]. However, PtToll1e3 showed different tissue distributions in this study. According to
Fig. 5. Detection of PtToll1e3 mRNA transcripts in various tissues from healthy crabs. AeC represent tissue distributions of the PtToll1e3 genes by qRT-PCR analysis, respectively; D shows the tissue distributions of the PtToll1e3 genes by RT-PCR analysis, respectively; Lane M, DNA size marker; Lanes 1e6 represent gills, heart, muscle, hemocytes, intestine, and hepatopancreas, respectively. The mRNA expression level was normalized to that of 18S rRNA using the relative standard curve method. Data are shown as mean values ± standard deviations.
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
743
Fig. 6. qRT-PCR analysis of PtToll1e3 mRNA expression in gills in response to Vibrio alginolyticus, Candida lusitaniae or white spot syndrome virus (WSSV) challenges. The relative expression levels of PtToll1e3 were normalized to glyceraldehyde 3-phosphate dehydrogenase (GADPH) using the relative standard curve method. Data are shown as mean values ± standard deviations. * (up-regulation) or x (down-regulation) indicate a significant difference between the phosphate-buffered saline (PBS) group and the challenge group: * or xp < 0.05; ** or xxp < 0.01.
their sequence similarity and phylogenetic relationship, PtToll1 belongs to the shrimp Toll2 type and PtToll3 belong to the shrimp Toll3 type. Our results showed that PtToll1 and PtToll3 were broadly expressed in the examined tissues, which is consistent with the expression profiles of most crustacean Tolls and LvToll3 [14e19]. Compared with PtToll1, PtToll3, and other crustacean Tolls, PtToll2 mRNA showed tissue-specific expression, as it was only highly enriched in gills (Fig. 5D). PtToll2 was phylogenetically closest to another insect Toll, DmToll8. In Drosophila, Toll8 also showed tissue-specific expression, as it was highly expressed in the tracheal epithelium, while it was expressed at lower levels in other tissues [26]. The innate immune system is the first and only line of defense against pathogen infections in invertebrates due to the lack of adaptive immunity. In the past few years, increasing evidence has confirmed that the insect Toll pathway displays anti-bacterial, antifungal, and anti-viral functions by regulating the expression of immune-related genes [27e30]. To better understand the response and role of different crab Tolls in host defense against various pathogens, the expression profiles of PtToll1e3 in response to different pathogenic microorganisms were investigated in gills of the swimming crab. The results revealed that PtToll1e3 showed different response to these pathogens. In detail, the PtToll1 transcript was up-regulated in response to C. lusitaniae or V. alginolyticus challenge in gills. These results are consistent with the findings that the transcription of many aquatic invertebrate Tolls could be activated by Gram-negative bacteria, including Vibrio
spp. [14,15,31]. A previous study also reported that Tolls in E. sinensis can be elicited by fungal zymosan [19]. Different from some shrimp Tolls [13,32], PtToll1 did not respond to WSSV challenge. Compared to PtToll1, the transcription of PtToll2 and PtToll3 exhibited almost the same trends after C. lusitaniae and V. alginolyticus challenge, in that both PtToll2 and PtToll3 mRNAs were down-regulated in gills 12 h after C. lusitaniae or V. alginolyticus infection. However, WSSV induced the expression of PtToll2, but suppressed the transcription of PtToll3. The Tolls of L. vannamei also respond differently to pathogens, as LvToll1 and LvToll3 are up regulated, albeit to a different degree, by both V. alginolyticus and WSSV, while LvToll2 is up-regulated only following WSSV challenge [14]. In summary, we have cloned and characterized three novel Tolls, PtToll1e3, from P. trituberculatus. Based on the sequence analysis, together with PtToll1e3 mRNA levels in tissues, we suggest that PtToll2 is a new type of Toll in crustaceans. Moreover, the expression profiles of PtToll1e3 following C. lusitaniae, V. alginolyticus, or WSSV challenge were also characterized in this study. The findings in this study will help us to obtain a better understanding of the role of Toll pathways in crab immunity, and, thus, it is beneficial to disease prevention in crabs. Acknowledgments This work was sponsored by Natural Science Foundation of Zhejiang Province (LY13C190007), Ningbo Municipal Innovative
744
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
Research Team (2011B81003, 2013B82012), Ningbo Municipal Natural Science Foundation (2014A610181) and K.C.Wong Magna Fund in Ningbo University. References [1] H. Bilak, S. Tauszig-Delamasure, J.L. Imler, Toll and Toll-like receptors in Drosophila, Biochem. Soc. Trans. 31 (2003) 648e651. [2] F. Leulier, B. Lemaitre, Toll-like receptors-taking an evolutionary approach, Nat. Rev. Genet. 9 (2008) 165e178. [3] S. Valanne, J.H. Wang, M. Ramet, The Drosophila Toll signaling pathway, J. Immunol. 186 (2011) 649e656. [4] B. Lemaitre, E. Nicolas, L. Michaut, J.M. Reichhart, J.A. Hoffmann, The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults, Cell 86 (1996) 973e983. [5] S. Akira, S. Uematsu, O. Takeuchi, Pathogen recognition and innate immunity, Cell 124 (2006) 783e801. [6] J.L. Tenor, A. Aballay, A conserved Toll-like receptor is required for Caenorhabditis elegans innate immunity, Embo Rep. 9 (2008) 103e109. [7] J.C. Roach, G. Glusman, L. Rowen, A. Kaur, M.K. Purcell, K.D. Smith, et al., The evolution of vertebrate Toll-like receptors, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 9577e9582. [8] T. Hibino, M. Loza-Coll, C. Messier, A.J. Majeske, A.H. Cohen, D.P. Terwilliger, et al., The immune gene repertoire encoded in the purple sea urchin genome, Dev. Biol. 300 (2006) 349e365. [9] J.P. Rast, L.C. Smith, M. Loza-Coll, T. Hibino, G.W. Litman, Genomic insights into the immune system of the sea urchin, Science 314 (2006) 952e956. [10] N.J. Gay, M. Gangloff, Structure and function of Toll receptors and their ligands, Annu. Rev. Biochem. 76 (2007) 141e165. [11] T. Kawai, S. Akira, The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors, Nat. Immunol. 11 (2010) 373e384. [12] H. Kumar, T. Kawai, S. Akira, Pathogen recognition in the innate immune response, Biochem. J. 420 (2009) 1e16. [13] A.N. Weber, S. Tauszig-Delamasure, J.A. Hoffmann, E. Lelievre, H. Gascan, K.P. Ray, et al., Binding of the Drosophila cytokine Spatzle to Toll is direct and establishes signaling, Nat. Immunol. 4 (2003) 794e800. [14] P.H. Wang, J.P. Liang, Z.H. Gu, D.H. Wan, S.P. Weng, X.Q. Yu, et al., Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spatzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei, Dev. Comp. Immunol. 36 (2012) 359e371. [15] C. Yang, J. Zhang, F. Li, H. Ma, Q. Zhang, P.T. Jose, et al., A Toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection, Fish Shellfish Immunol. 24 (2008) 564e574. [16] J.A. Arts, F.H. Cornelissen, T. Cijsouw, T. Hermsen, H.F. Savelkoul, R.J. Stet, Molecular cloning and expression of a Toll receptor in the giant tiger shrimp, Penaeus monodon, Fish Shellfish Immunol. 23 (2007) 504e513. [17] T. Mekata, T. Kono, T. Yoshida, M. Sakai, T. Itami, Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus
japonicus, Fish Shellfish Immunol. 24 (2008) 122e133. [18] Z. Lin, J. Qiao, Y. Zhang, L. Guo, H. Huang, F. Yan, et al., Cloning and characterisation of the SpToll gene from green mud crab, Scylla paramamosain, Dev. Comp. Immunol. 37 (2012) 164e175. [19] A.Q. Yu, X.K. Jin, X.N. Guo, S. Li, M.H. Wu, W.W. Li, et al., Two novel Toll genes (EsToll1 and EsToll2) from Eriocheir sinensis are differentially induced by lipopolysaccharide, peptidoglycan and zymosan, Fish Shellfish Immunol. 35 (2013) 1282e1292. [20] K. Muroga, K. Suzuki, K. Ishimaru, K. Mogami, Vibriosis of swimming crab Portunus trituberculatus in larviculture, J. World Aquacult. Soc. 25 (1994) 50e54. [21] W.J. Xu, H.X. Xu, H.W. Jin, Studies on milky disease of Portunus trituberculatus, J. Oceanol. Zhejiang Prov. 3 (2003) 209e213. [22] G.L. Wang, S. Jin, Y.E. Chen, Z. Li, Study on pathogens and pathogenesis of “emulsification disease” of Portunus trituberculatus, Adv. Mar. Sci. 24 (2006) 526e531. [23] X.H. Meng, I.K. Jang, H.C. Seo, Y.R. Cho, White spot syndrome virus quantification in blue crab Portunus trituberculatus hatchery-produced larvae and wild populations by TaqMan real-time PCR, with an emphasis on the relationship between viral infection and crab health, Aquaculture 291 (2009) 18e22. [24] Z. Wand, Z.Z. Wang, W.J. Xu, W.X. He, S.Y. Gu, Quantitative study of lethal effect of WSSV on Portunus trituberculatus from mix-culture ponds of prawns and crabs, Oceanol. Limnol. Sin. 39 (2008) 184e189. [25] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2△△CT method, Methods 25 (2001) 402e408. [26] I. Akhouayri, C. Turc, J. Royet, B. Charroux, Toll-8/Tollo negatively regulates antimicrobial response in the Drosophila respiratory epithelium, PLoS Pathog. 7 (2011) e1002319. [27] B. Lemaitre, J. Hoffmann, The host defense of Drosophila melanogaster, Annu. Rev. Immunol. 25 (2007) 697e743. [28] B. Lemaitre, J.M. Reichhart, J.A. Hoffmann, Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 14614e14619. [29] Z. Xi, J.L. Ramirez, G. Dimopoulos, The Aedes aegypti toll pathway controls dengue virus infection, PLoS Pathog. 4 (2008) e1000098. [30] J.L. Ramirez, G. Dimopoulos, The Toll immune signaling pathway control conserved anti-dengue defenses across diverse Ae. aegypti strains and against multiple dengue virus serotypes, Dev. Comp. Immunol. 34 (2010) 625e629. [31] Y. Zhang, X. He, F. Yu, Z. Xiang, J. Li, K.L. Thorpe, et al., Characteristic and functional analysis of toll-like receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity, PLoS One 8 (2013) e76464. [32] A. Deepika, K. Sreedharan, A. Paria, M. Makesh, K.V. Rajendran, Toll-pathway in tiger shrimp (Penaeus monodon) responds to white spot syndrome virus infection: Evidence through molecular characterisation and expression profiles of MyD88, TRAF6 and TLR genes, Fish Shellfish Immunol. 41 (2014) 441e454.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Three novel Toll genes (PtToll1e3) identified from a marine crab, Portunus trituberculatus: Different tissue expression and response to pathogens Su-Ming Zhou, Xue-Mei Yuan, Shun Liu, Meng Li, Zhen Tao, Guo-Liang Wang* Key Laboratory of the Ministry of Education for Applied Marine Biotechnology, School of Marine Science, Ningbo University, Ningbo 315211, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 May 2015 Received in revised form 28 July 2015 Accepted 29 July 2015 Available online 1 August 2015
The Toll signaling pathway is one of the most important regulators of the immune response in both vertebrates and invertebrates. Herein, three novel Toll (PtToll1e3) cDNA sequences were cloned from the swimming crab, Portunus trituberculatus. PtToll1 has 1003 amino acid residues and consists of an extracellular domain containing 15 leucine-rich repeats (LRRs) and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain of 139 residues. PtToll2 encodes 1196 peptides, with an extracellular domain containing 28 LRRs and a cytoplasmic TIR domain. PtToll3 is 1229 residues long and contains 26 LRRs and a cytoplasmic TIR domain. Based on sequence and phylogenetic analyses, PtToll1 distinctly clustered with almost all crustacean Tolls, except Litopenaeus vannamei Toll3. However, PtToll2 and PtToll3 were separated from most reported crustacean Tolls, which mostly clustered with Drosophila melanogaster (Dm) Toll8, L. vannamei Toll3, and DmToll6. Reverse transcription PCR and real-time quantitative PCR analyses showed that PtToll1 and PtToll3 were constitutively expressed in all tissues tested, but PtToll2 mRNA was only highly enriched in gills. Upon challenges with Vibrio alginolyticus, Candida lusitaniae, or white spot syndrome virus (WSSV), the three Tolls exhibited different responses: the PtToll1 transcript was up-regulated in response to C. lusitaniae or V. alginolyticus challenge, but did not respond to WSSV challenge; both PtToll2 and PtToll3 mRNAs were down-regulated 12 h after C. lusitaniae or V. alginolyticus infection. However, WSSV elicited the expression of PtToll2 at 6 h post-infection, but suppressed transcription of PtToll3 at 24 h post-infection. The study provides valuable data for understanding the role of Toll pathways in the host defense against microbial pathogens, which will facilitate future studies on hostepathogen interactions in crabs. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Portunus trituberculatus Innate immunity Toll Expression analysis
1. Introduction The innate immune system is the first line of the host defense against pathogens, and it has been conserved throughout evolution. Upon infection, microbe-specific immune elicitors, known as pathogen-associated molecular patterns (PAMPs), are recognized by a set of so-called pattern-recognition receptors (PRRs) [1]. The Toll-like receptor (TLR) family is one of the most extensively studied PRRs, and it plays a fundamental role in pathogen recognition and the activation of innate immunity [2]. Toll, the founding member of the TLR family, was initially identified as a gene product essential for the development of embryonic dorsoventral polarity
* Corresponding author. E-mail address: [email protected] (G.-L. Wang). http://dx.doi.org/10.1016/j.fsi.2015.07.027 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
in Drosophila [2,3]. Later, it was also shown to sense microbial pathogens, as were mammalian TLRs [4,5]. To date, one Toll-like protein in Caenorhabditis elegans [6], nine Toll-related receptors (Toll1e9) in Drosophila [1,3], and 13 members of TLRs in mammals [5,7] have been identified. However, studies have revealed differences between insects and mammals in terms of TLR domain organization, activation mode, and function. Sequence analysis of TLRs showed some structural differences between TLR families [8]. Based on the organization of extracellular arrays of leucine-rich repeats (LRRs), TLRs can be classified into two types: the vertebrate type (V-type) and the protostome-type (P-type). V-type TLRs have an array of LRRs capped by cysteine-rich domains located at the N-and C-terminal LRR domains (LRRNT and LRRCT, respectively). P-type TLRs also contain LRRNT and LRRCT domains, but they do not cap the LRR array, but are instead found within the array in a tandem orientation [9,10].
738
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
All Drosophila Tolls, except DmToll9, are P-type Tolls [10]. Functionally, accumulated evidence showed that mammalian TLRs can directly recognize different PAMPs via specific LRR domains in respective TLRs, as TLR1, TLR2, TLR5, TLR6, and TLR10 recognize microbial lipids, sugars, and proteomes, whereas the highly related subfamilies of TLR3, TLR7, TLR8, and TLR9 recognize nucleotide derivatives of viral or bacterial origin [5,10e12]. In contrast with mammals, to date, Drosophila melanogaster Toll1 (DmToll1) is the only confirmed Toll that is responsible for antimicrobial peptide (AMP) induction via the Toll pathway in Drosophila [1,3,11]. Moreover, Drosophila Toll recognizes its endogenous ligand, the cleaved form of Sp€ aetzle, which requires the participation of several accessory proteins [4,13]. Crustacea, most of which are aquatic and breath using gills, is another arthropod class that is distinct from the Insecta. In shrimp, Tolls have been identified in Litopenaeus vannamei, Fenneropenaeus chinensis, Penaeus monodon, and Marsupenaeus japonicus [14e17]. According to protein similarities, there are three different Tolls (Toll1e3) that have been identified in L. vannamei, and all Tolls were shown to respond to challenges with Vibrio alginolyticus or white spot syndrome virus (WSSV) [14]. Toll proteins were also found in two crab species, one in Scylla paramamosain [18] and two in Eriocheir sinensis [19], which were responsive to bacterial pathogens or PAMPs. In this paper, three novel Tolls (PtToll1e3) were reported in the marine crab Portunus trituberculatus. To explore their evolutionary relationships and elucidate the possible functions of these genes, we conducted a phylogenetic analysis, characterized their predicted functional domains, and examined their mRNA expression profiles in crab tissues. In addition, the expression profiles of these different Tolls in response to the injection of Candida lusitaniae, V. alginolyticus, or WSSV were also analyzed by real-time quantitative PCR (qRT-PCR). These data will expand our understanding of the response of crustacean Toll signaling cascades to pathogens. 2. Materials and methods 2.1. Tissue collection, RNA extraction, and cDNA synthesis Swimming crabs (P. trituberculatus; approximately 150 g body weight) were purchased from a local seafood market in Ningbo, Zhejiang province, China. Three individuals were randomly used for tissue preparation. Crab tissues, including hemocytes, gills, muscle, heart, intestine, and hepatopancreas, were removed via dissection and preserved at 80 C for RNA extraction. Total RNAs were extracted from the crab tissues using the E.Z.N.A. Total RNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer's instructions. All RNAs were checked spectrophotometrically (Thermo, NanoDrop 2000, USA), as well as by agarose gel electrophoresis. Approximately 5 mg of total RNA that was extracted from hemocytes was reverse transcribed with the PrimeScript™ 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) according to the manufacturer's instructions. 2.2. Cloning and sequencing of the full-length cDNAs The cDNA of PtToll1e3 was initially amplified by PCR using the degenerate primers listed in Table 1. Based on the cDNA fragments, the full-length PtToll1e3 cDNA was obtained via the 50 and 30 rapid amplification of cDNA ends (RACE) using the SMART RACE cDNA Amplification Kit (Clontech, Beijing, China) according to the manufacturers' instructions. The primers used in the 50 and 30 RACE are listed in Table 1. All the PCR products were sub-cloned into the plasmid vector pMD19-T Simple (Takara) and transformed into competent Escherichia coli DH5a cells for sequencing.
Table 1 PCR primers used in this study. Primer Degenerate PCR PtToll1 DF PtToll1 DR Pt Toll2/PtToll3 DF Pt Toll2/PtToll3 DR RACE PCR 50 PtToll1-RACE1 50 PtToll1-RACE2 30 PtToll1-RACE1 30 PtToll1-RACE2 50 PtToll2-RACE1 50 PtToll2-RACE2 30 PtToll2-RACE1 30 PtToll2-RACE2 50 PtToll3-RACE1 50 PtToll3-RACE2 30 PtToll3-RACE1 30 PtToll3-RACE2 qRT-PCR analysis PtToll1 F PtToll1 R PtToll2 F PtToll2 R PtToll3 F PtToll3 R 18s RNA F 18s RNA R GADPH F GADPH R
Sequence (50 e30 ) 50 50 50 50
GGAACTTGAARMMTGGCACYTGGA 30 AGGTTTCTCAGAGCATGAGGT 30 GAYGCCTGYGAYTGCGAGATGA 30 GGGAARTCSCGRTAGTGCA 30
50 50 50 50 50 50 50 50 50 50 50 50
CCAGGTGGCAGACTCTTGATAGG 30 TCTGGAGGCAATGAAGTGAACA 30 ATTGAGGACAGCCACAGGACT 30 ATCAGATCATCCCAGGTT 30 CTCGAACTCGTATCCCTTGAGC 30 CCAGTAGCCTCAGGCCATTG 30 AGCCCTGCCTATAAGTTGTGTCT 30 CCTCATCCTCTCAGAGAACTTCATC 30 AGGTTCCACTTTCAATGTGGGTA 30 GCCGTATAGATTGTGGAAGACCTG 30 CGGCAAGGACATCAAGTGCTACTCGG 30 GTGCTGCTGGTGCTGTGCTTCCTGT 30
50 50 50 50 50 50 50 50 50 50
GCTTCCACCACTGTCTTC 30 ACTTAGGCTCTCCACTCTC 30 GGTAACTACTTCGAGATTGAGAG 30 GGAGATGAGATTGTTGTTGAGA 30 TTATACCAGTGAGTCTCCAGTG 30 GTTGATCTTGTCGTCGTTGAG 30 TCCGATAACGAACGAGACT 30 TAAGAAGAAGCTGCGAACTG 30 TGAGGTGAAGGTAGAGGAT 30 CCAGTGAAGTGAGCAGAG 30
Note: M ¼ A þ C, R ¼ G þ A, S ¼ G þ C, Y ¼ C þ T; F indicates forward; R, reverse.
2.3. Bioinformatic analyses Nucleotide sequences were translated to amino acid sequences using the ExPASy Translate tool (http://www.expasy.ch/tools/dna. html). The predicted amino acid sequences were blasted against the NCBI database using the BLASTP program (http://blast.ncbi.nlm. nih.gov/Blast.cgi) to identify sequence identities and similarities. The identification and annotation of protein domains were performed using the web-based SMART program (http://smart.emblheidelberg.de/). Potential N-linked glycosylation sites were predicted according to the Asn-X-Ser/Thr rule (http://cbs.dtu.dk/ services/NetNGlyc). Phylogenetic analyses of the PtToll1e3 amino acid sequences were conducted using the MEGA 5 program. 2.4. Immune challenge The Gram-negative bacterium V. alginolyticus and the fungus C. lusitaniae are pathogenic to cultured swimming crabs, which were described as the aetiological agents of emulsification disease in this crab [20e22]. The WSSV has been recognized as an important viral pathogen in shrimp. However, because of mixed aquacultures of swimming crabs and other shrimp species, WSSV was also frequently detected in diseased swimming crabs in farms [23,24]. In this study, several groups (n ¼ 15) were used for the challenge experiments. Experimental crabs were reared in a recirculating water tank system filled with air-pumped seawater (2.4% salinity) at 24 ± 0.5 C. The crabs were allowed to acclimatize for at least 5 d before the experiments were conducted. Each group was injected with 0.2 mL of C. lusitaniae (6 106 colony-forming units (CFU)/ mL), V. alginolyticus (5.5 107 CFU/mL), WSSV (approximately 150 copies/mL, quantified by qRT-PCR) or phosphate-buffered saline (PBS). The gills of three crabs from each group were randomly collected at 0, 6, 12, and 24 h post-infection for RNA extraction.
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
2.5. RT-PCR analysis Gene expression patterns of PtToll1e3 in healthy crabs were determined using reverse transcription PCR (RT-PCR). Primer sets (Table 1) were used to amplify specific fragments for PtToll1e3, and
739
the PCR products were sequenced to verify their specificity. 18S rRNA was used as the internal control. The cycling protocol for PtToll1e3 consisted of an initial denaturation at 95 C for 2 min, followed by 35 cycles of 95 C for 20 s, 60 C for 20 s, and 72 C for 30 s. The cycling protocol for 18S rRNA consisted of an initial
Fig. 1. Nucleotide and deduced amino acid sequences of PtToll1e3. The amino acid sequences are shown under the cDNA sequences. Signal peptides are shaded in dark gray. Transmembrane (TM) segments are boxed. TIR domains are shaded in light gray, while letters representing start codons (ATG), stop codons (TAA), and potential N-linked glycosylation sites are bolded.
740
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
Fig. 2. Predicted protein domain architecture of PtToll1e3 determined by SMART analysis. All three Tolls belong to the P-type TLRs and contain a TIR domain, a TM domain, multiple extracellular LRRs, and an N-terminal signal peptide. Signal peptides are shown in red, TM domains are in dark blue, and low complexity regions are in pink. Other domains, including LRR domains and TIR domains, are labeled accordingly. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
denaturation at 95 C for 2 min, followed by 25 cycles of 95 C for 20 s, 60 C for 20 s, and 72 C for 30 s. PCR products were separated using electrophoresis in a 1.5% agarose gel and visualized under UV light.
2.6. Real-time quantitative PCR All samples were lysed to purify total RNA using the E.Z.N.A. Total RNA Kit (Omega Bio-Tek) according to the manufacturer's
Fig. 3. Multiple sequence alignments of the TIR domains of crustacean Tolls and DmToll1e9. The alignment was performed using Clustal X. Identical residues are indicated in black and similar residues are in light gray.
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
instruction. cDNAs for qRT-PCR analysis were synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara). Primers for PtToll1e3 and the 18S rRNA and glyceraldehyde 3-phosphate dehydrogenase (GADPH) reference genes were designed using Beacon Designer 7.80 software and listed in Table 1. Moreover, all specific amplicons were cloned into the pMD19-T vector to detect the amplification efficiency of the primer sets used for the qRT-PCR analysis. The efficiencies of the qRT-PCR primers for the PtToll1e3, 18S rRNA, and GADPH genes were 1.966, 1.889, 1.901, 2.015, and 2.031, respectively. qRT-PCR was performed with a Roche LightCycler 480 Real-time PCR System (Roche, Basel, Switzerland) using LightCycler 480 SYBR Green I Master (Roche). Each run included a no-template control to test the assay reagents for contamination. The cycling protocol consisted of an initial denaturation at 95 C for 5 min, followed by 40 cycles of 95 C for 15 s, 60 C for 15 s, and 72 C for 15 s. The specificities of the PCR products were determined by melting curve analysis and sequencing. Each sample was analyzed in triplicate. The relative expression ratio of the cytokine genes were analyzed using the 2△△CT method in triplicate for three independent, parallel samples [25]. 2.7. Statistical analysis
741
by L. vannamei Toll3 (LvToll3) and PtToll3 (69.5 and 69.6% identity, respectively) (Fig. 3). The full-length cDNA of PtToll3 is 4432 bp long, with an ORF of 3690 bp encoding a putative protein of 1229 amino acids. PtToll3 shared 18.0% identity with PtToll1, 76.2% identity with LvToll3, and 34.9% identity with DmToll6. The predicted PtToll2 protein consisted of 26 LRRs, including one LRRCT domain and one LRRNT domain, a single-pass transmembrane segment (amino acids 995e1017), and an intracellular TIR domain (amino acids 1047e1184) (Figs. 1 and 2). There were 14 potential N-linked glycosylation sites predicted in PtToll2 (Fig. 1). Comparison of the PtToll3 TIR domain with other known TIRs showed that the PtToll3 TIR domain was most similar to LvToll3 (94.2% identity), followed by PtToll2 and DmToll8 (69.6% and 66.7% identity, respectively) (Fig. 3). 3.2. Phylogenetic analysis Based on the deduced amino acid sequences of the PtTolls, phylogenetic trees were constructed with orthologs in other species to identify their evolutionary relationship. Fig. 4 shows that PtToll1 distinctly clustered with almost all crustacean Tolls, DmToll1 and DmToll5, while its phylogenetically closest relatives
The expression levels of PtToll1e3 (expressed as mean ± standard deviation) were analyzed by one-way analysis of variance (ANOVA), followed by Dunnett's test for multiple comparisons using the SPSS 16.0 statistical software program. p < 0.05 was considered statistically significant. 3. Results 3.1. Sequence analysis of PtToll1e3 The full-length cDNAs of PtToll1e3 (GenBank accession numbers KM514314, KR528473, and KR528474, respectively) were obtained using homology cloning and switching mechanism at the 50 end of the RNA template (SMART) rapid amplification of cDNA ends (RACE). There are 3733 nucleotides in PtToll1 cDNA, which contain a putative open reading frame (ORF) of 3012 bp encoding a polypeptide of 1003 amino acid residues. PtToll1 shared 87.9% identity with S. paramamosain Toll (SpToll), 61.2% identity with E. sinensis Toll1 (EsToll1), 38.8%e 43.9% identity with most shrimp Tolls, and 22.5% identity with DmToll1. Prediction of protein domains revealed that PtToll1 consisted of 15 LRRs, including two LRRCT domains, a singlepass transmembrane segment (amino acids 785e807), and an intracellular TIR domain (amino acids 837e975) (Figs. 1 and 2). There were 13 potential N-linked glycosylation sites predicted in PtToll1 (Fig. 1). Comparison of the PtToll1 TIR domain with other known TIRs showed that the PtToll1 TIR domain was most similar to SpToll (97.1% identity) and EsToll1 (90.6% identity), followed by other crustacean Tolls (66.1%e74.1% identity) and DmToll1 (54.7% identity) (Fig. 3). PtToll2 cDNA was 4277 bp in length, and it consisted of an ORF of 3591 bp encoding a polypeptide of 1196 amino acid residues. PtToll2 shared 17.4% identity with PtToll1, 43.9% identity with PtToll3, and 44.0% identity with DmToll8. The predicted PtToll2 protein consisted of 28 LRRs, including two LRRCT domains and one LRRNT, a single-pass transmembrane segment (amino acids 980e1002), and an intracellular TIR domain (amino acids 1032e1169) (Figs. 1 and 2). There were 17 potential N-linked glycosylation sites predicted in PtToll2 (Fig. 1). Comparison of the PtToll3 TIR domain with other known TIRs showed that the PtToll2 TIR domain was most similar to DmToll8 (70.3% identity), followed
Fig. 4. Phylogenetic tree of Toll proteins and PtToll1e3. PtToll1e3 are marked by black boxes. The rooted trees were constructed via the neighbor-joining method and bootstrapped 1000 times using MEGA 5.0 software (http://www.megasoftware.net/index. html). Sequences used for the phylogenetic tree analysis of Tolls included: FcToll (ABQ59330.1), PmToll (ADK55066.1), LvToll1 (ABK58729.1), MjToll1 (BAG68890.1), EsToll2 (AGT21374.1), LvToll2 (AEK86516.1), MjToll2 (BAF99007.1), EsToll1 (AGK90305.1), SpToll (AEX20238.1), PtToll1 (KM514314), PtToll2 (KR528473), PtToll3 (KR528474), LvToll3 (AEK86517.1), CrToll (ABK88278.1), TtToll (BAD12073.1) DmToll1 (AAA28941.1), DmToll2 (AAF57509.1), DmToll3 (AAF86229.1), DmToll4 (AAF52747.3), DmToll5 (AAF86227.1), DmToll6 (AAF86226.1), DmToll7 (AAF57514.1), DmToll8 (AAF86224.1), and DmToll9 (AAF51581.1). Abbreviations: Cr, Carcinoscorpius rotundicauda; Dm, Drosophila melanogaster; Es, Eriocheir sinensis; Fc, Fenneropenaeus chinensis; Lv, Litopenaeus vannamei; Mj, Marsupenaeus japonicas; Pm, Penaeus monodon; Pt, Portunus trituberculatus; Sp, Scylla paramamosain; Tt, Tachypleus tridentatus.
742
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
were SpToll and EsToll1. However, PtToll2 and PtToll3 were separated from most reported crustacean Tolls, as it mainly clustered with DmToll8, LvToll3, and DmToll6 (Fig. 4).
V. alginolyticus infection, and it was also suppressed 24 h after WSSV infection (Fig. 6). 4. Discussion
3.3. Tissue distribution of PtToll1e3 in healthy crabs In healthy crabs, PtToll1 and PtToll3 were constitutively expressed in all tissues tested, while PtToll2 showed tissue-specific expression (Fig. 5D). qRT-PCR analysis showed that PtToll1 expression was higher in hemocytes, gills, intestine, and heart than in muscle and hepatopancreas (Fig. 5A and D). However, the order of the level of the PtToll3 transcript, from lowest to highest, was hepatopancreas, hemocytes, muscle, intestine, heart, and gills (Fig. 5C and D). In comparison, PtToll2 was mainly expressed in gills, but was weakly expressed in other organs, as shown in Fig. 5B and D. Interestingly, all three Toll transcripts were strongly expressed in gills. 3.4. Expression profiles of PtToll1e3 in response to immune challenge To investigate the responses of PtToll1e3 to immune challenges, we collected crab gills at 0, 6, 12, and 24 h post-injection with C. lusitaniae, V. alginolyticus, or WSSV and performed a qRT-PCR analysis. The results showed that PtToll1 expression was upregulated in gills during 24 h post-injection of C. lusitaniae or V. alginolyticus, but did not respond to the WSSV challenge (Fig. 6). In comparison, PtToll2 expression was induced at 6 h post-injection of C. lusitaniae or WSSV, while it was sharply reduced 12 h after C. lusitaniae or V. alginolyticus infection (Fig. 6). Similarly, PtToll3 expression was down-regulated 12 h after C. lusitaniae or
Different Tolls have been found in several crustacean species [14e17]. According to sequence similarities and phylogenetic relationships, three different Tolls have been identified in crustaceans [14], compared with nine different Toll proteins in Drosophila [1,3]. In the present study, for the first time, three novel Tolls were identified in the marine crab P. trituberculatus. Based on the sequence similarity and phylogenetic analyses, PtToll1 exhibited high similarity to crab Toll proteins found in S. paramamosain and E. sinensis, and it clustered on one branch containing most of the shrimp Tolls, as well as DmToll1 and DmToll5. In comparison, PtToll2 shared only 17.4% identity with PtToll1 and other shrimp Tolls, and it mostly clustered with another insect Toll protein, DmToll8. These data suggested that PtToll2 represents a new type of Toll protein in crustaceans. PtToll3 shared 76.2% identity with LvToll3, and it was the phylogenetically closest relative to LvToll3, PtToll2, DmToll6, and DmToll8. Regarding structure, PtToll1 and PtToll2 contain more than one LRRCT motif in their ectodomains; PtToll3 contains one LRRCT domain and one LRRNT domain, but they are found within the array in a tandem orientation. Thus, all three Tolls identified in this study, PtToll1e3, are P-type TLRs. The existing literature has described tissue distributions of several crustacean Tolls. It showed that all three different type Tolls in L. vannamei were constitutively expressed in all tested tissues [14]. Tolls identified in two crab species were also shown to be widely expressed in various tissues [18,19]. However, PtToll1e3 showed different tissue distributions in this study. According to
Fig. 5. Detection of PtToll1e3 mRNA transcripts in various tissues from healthy crabs. AeC represent tissue distributions of the PtToll1e3 genes by qRT-PCR analysis, respectively; D shows the tissue distributions of the PtToll1e3 genes by RT-PCR analysis, respectively; Lane M, DNA size marker; Lanes 1e6 represent gills, heart, muscle, hemocytes, intestine, and hepatopancreas, respectively. The mRNA expression level was normalized to that of 18S rRNA using the relative standard curve method. Data are shown as mean values ± standard deviations.
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
743
Fig. 6. qRT-PCR analysis of PtToll1e3 mRNA expression in gills in response to Vibrio alginolyticus, Candida lusitaniae or white spot syndrome virus (WSSV) challenges. The relative expression levels of PtToll1e3 were normalized to glyceraldehyde 3-phosphate dehydrogenase (GADPH) using the relative standard curve method. Data are shown as mean values ± standard deviations. * (up-regulation) or x (down-regulation) indicate a significant difference between the phosphate-buffered saline (PBS) group and the challenge group: * or xp < 0.05; ** or xxp < 0.01.
their sequence similarity and phylogenetic relationship, PtToll1 belongs to the shrimp Toll2 type and PtToll3 belong to the shrimp Toll3 type. Our results showed that PtToll1 and PtToll3 were broadly expressed in the examined tissues, which is consistent with the expression profiles of most crustacean Tolls and LvToll3 [14e19]. Compared with PtToll1, PtToll3, and other crustacean Tolls, PtToll2 mRNA showed tissue-specific expression, as it was only highly enriched in gills (Fig. 5D). PtToll2 was phylogenetically closest to another insect Toll, DmToll8. In Drosophila, Toll8 also showed tissue-specific expression, as it was highly expressed in the tracheal epithelium, while it was expressed at lower levels in other tissues [26]. The innate immune system is the first and only line of defense against pathogen infections in invertebrates due to the lack of adaptive immunity. In the past few years, increasing evidence has confirmed that the insect Toll pathway displays anti-bacterial, antifungal, and anti-viral functions by regulating the expression of immune-related genes [27e30]. To better understand the response and role of different crab Tolls in host defense against various pathogens, the expression profiles of PtToll1e3 in response to different pathogenic microorganisms were investigated in gills of the swimming crab. The results revealed that PtToll1e3 showed different response to these pathogens. In detail, the PtToll1 transcript was up-regulated in response to C. lusitaniae or V. alginolyticus challenge in gills. These results are consistent with the findings that the transcription of many aquatic invertebrate Tolls could be activated by Gram-negative bacteria, including Vibrio
spp. [14,15,31]. A previous study also reported that Tolls in E. sinensis can be elicited by fungal zymosan [19]. Different from some shrimp Tolls [13,32], PtToll1 did not respond to WSSV challenge. Compared to PtToll1, the transcription of PtToll2 and PtToll3 exhibited almost the same trends after C. lusitaniae and V. alginolyticus challenge, in that both PtToll2 and PtToll3 mRNAs were down-regulated in gills 12 h after C. lusitaniae or V. alginolyticus infection. However, WSSV induced the expression of PtToll2, but suppressed the transcription of PtToll3. The Tolls of L. vannamei also respond differently to pathogens, as LvToll1 and LvToll3 are up regulated, albeit to a different degree, by both V. alginolyticus and WSSV, while LvToll2 is up-regulated only following WSSV challenge [14]. In summary, we have cloned and characterized three novel Tolls, PtToll1e3, from P. trituberculatus. Based on the sequence analysis, together with PtToll1e3 mRNA levels in tissues, we suggest that PtToll2 is a new type of Toll in crustaceans. Moreover, the expression profiles of PtToll1e3 following C. lusitaniae, V. alginolyticus, or WSSV challenge were also characterized in this study. The findings in this study will help us to obtain a better understanding of the role of Toll pathways in crab immunity, and, thus, it is beneficial to disease prevention in crabs. Acknowledgments This work was sponsored by Natural Science Foundation of Zhejiang Province (LY13C190007), Ningbo Municipal Innovative
744
S.-M. Zhou et al. / Fish & Shellfish Immunology 46 (2015) 737e744
Research Team (2011B81003, 2013B82012), Ningbo Municipal Natural Science Foundation (2014A610181) and K.C.Wong Magna Fund in Ningbo University. References [1] H. Bilak, S. Tauszig-Delamasure, J.L. Imler, Toll and Toll-like receptors in Drosophila, Biochem. Soc. Trans. 31 (2003) 648e651. [2] F. Leulier, B. Lemaitre, Toll-like receptors-taking an evolutionary approach, Nat. Rev. Genet. 9 (2008) 165e178. [3] S. Valanne, J.H. Wang, M. Ramet, The Drosophila Toll signaling pathway, J. Immunol. 186 (2011) 649e656. [4] B. Lemaitre, E. Nicolas, L. Michaut, J.M. Reichhart, J.A. Hoffmann, The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults, Cell 86 (1996) 973e983. [5] S. Akira, S. Uematsu, O. Takeuchi, Pathogen recognition and innate immunity, Cell 124 (2006) 783e801. [6] J.L. Tenor, A. Aballay, A conserved Toll-like receptor is required for Caenorhabditis elegans innate immunity, Embo Rep. 9 (2008) 103e109. [7] J.C. Roach, G. Glusman, L. Rowen, A. Kaur, M.K. Purcell, K.D. Smith, et al., The evolution of vertebrate Toll-like receptors, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 9577e9582. [8] T. Hibino, M. Loza-Coll, C. Messier, A.J. Majeske, A.H. Cohen, D.P. Terwilliger, et al., The immune gene repertoire encoded in the purple sea urchin genome, Dev. Biol. 300 (2006) 349e365. [9] J.P. Rast, L.C. Smith, M. Loza-Coll, T. Hibino, G.W. Litman, Genomic insights into the immune system of the sea urchin, Science 314 (2006) 952e956. [10] N.J. Gay, M. Gangloff, Structure and function of Toll receptors and their ligands, Annu. Rev. Biochem. 76 (2007) 141e165. [11] T. Kawai, S. Akira, The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors, Nat. Immunol. 11 (2010) 373e384. [12] H. Kumar, T. Kawai, S. Akira, Pathogen recognition in the innate immune response, Biochem. J. 420 (2009) 1e16. [13] A.N. Weber, S. Tauszig-Delamasure, J.A. Hoffmann, E. Lelievre, H. Gascan, K.P. Ray, et al., Binding of the Drosophila cytokine Spatzle to Toll is direct and establishes signaling, Nat. Immunol. 4 (2003) 794e800. [14] P.H. Wang, J.P. Liang, Z.H. Gu, D.H. Wan, S.P. Weng, X.Q. Yu, et al., Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spatzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei, Dev. Comp. Immunol. 36 (2012) 359e371. [15] C. Yang, J. Zhang, F. Li, H. Ma, Q. Zhang, P.T. Jose, et al., A Toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection, Fish Shellfish Immunol. 24 (2008) 564e574. [16] J.A. Arts, F.H. Cornelissen, T. Cijsouw, T. Hermsen, H.F. Savelkoul, R.J. Stet, Molecular cloning and expression of a Toll receptor in the giant tiger shrimp, Penaeus monodon, Fish Shellfish Immunol. 23 (2007) 504e513. [17] T. Mekata, T. Kono, T. Yoshida, M. Sakai, T. Itami, Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus
japonicus, Fish Shellfish Immunol. 24 (2008) 122e133. [18] Z. Lin, J. Qiao, Y. Zhang, L. Guo, H. Huang, F. Yan, et al., Cloning and characterisation of the SpToll gene from green mud crab, Scylla paramamosain, Dev. Comp. Immunol. 37 (2012) 164e175. [19] A.Q. Yu, X.K. Jin, X.N. Guo, S. Li, M.H. Wu, W.W. Li, et al., Two novel Toll genes (EsToll1 and EsToll2) from Eriocheir sinensis are differentially induced by lipopolysaccharide, peptidoglycan and zymosan, Fish Shellfish Immunol. 35 (2013) 1282e1292. [20] K. Muroga, K. Suzuki, K. Ishimaru, K. Mogami, Vibriosis of swimming crab Portunus trituberculatus in larviculture, J. World Aquacult. Soc. 25 (1994) 50e54. [21] W.J. Xu, H.X. Xu, H.W. Jin, Studies on milky disease of Portunus trituberculatus, J. Oceanol. Zhejiang Prov. 3 (2003) 209e213. [22] G.L. Wang, S. Jin, Y.E. Chen, Z. Li, Study on pathogens and pathogenesis of “emulsification disease” of Portunus trituberculatus, Adv. Mar. Sci. 24 (2006) 526e531. [23] X.H. Meng, I.K. Jang, H.C. Seo, Y.R. Cho, White spot syndrome virus quantification in blue crab Portunus trituberculatus hatchery-produced larvae and wild populations by TaqMan real-time PCR, with an emphasis on the relationship between viral infection and crab health, Aquaculture 291 (2009) 18e22. [24] Z. Wand, Z.Z. Wang, W.J. Xu, W.X. He, S.Y. Gu, Quantitative study of lethal effect of WSSV on Portunus trituberculatus from mix-culture ponds of prawns and crabs, Oceanol. Limnol. Sin. 39 (2008) 184e189. [25] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2△△CT method, Methods 25 (2001) 402e408. [26] I. Akhouayri, C. Turc, J. Royet, B. Charroux, Toll-8/Tollo negatively regulates antimicrobial response in the Drosophila respiratory epithelium, PLoS Pathog. 7 (2011) e1002319. [27] B. Lemaitre, J. Hoffmann, The host defense of Drosophila melanogaster, Annu. Rev. Immunol. 25 (2007) 697e743. [28] B. Lemaitre, J.M. Reichhart, J.A. Hoffmann, Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 14614e14619. [29] Z. Xi, J.L. Ramirez, G. Dimopoulos, The Aedes aegypti toll pathway controls dengue virus infection, PLoS Pathog. 4 (2008) e1000098. [30] J.L. Ramirez, G. Dimopoulos, The Toll immune signaling pathway control conserved anti-dengue defenses across diverse Ae. aegypti strains and against multiple dengue virus serotypes, Dev. Comp. Immunol. 34 (2010) 625e629. [31] Y. Zhang, X. He, F. Yu, Z. Xiang, J. Li, K.L. Thorpe, et al., Characteristic and functional analysis of toll-like receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity, PLoS One 8 (2013) e76464. [32] A. Deepika, K. Sreedharan, A. Paria, M. Makesh, K.V. Rajendran, Toll-pathway in tiger shrimp (Penaeus monodon) responds to white spot syndrome virus infection: Evidence through molecular characterisation and expression profiles of MyD88, TRAF6 and TLR genes, Fish Shellfish Immunol. 41 (2014) 441e454.