Molecular characterization and expression of a novel Toll gene from the swimming crab Portunus trituberculatus

Molecular Immunology 67 (2015) 388–397

Contents lists available at ScienceDirect

Molecular Immunology journal homepage: www.elsevier.com/locate/molimm

Molecular characterization and expression of a novel Toll gene from the swimming crab Portunus trituberculatus Meng Li a,b , Caiwen Li a,∗ , Jinfeng Wang a,b , Shuqun Song a a b

Key Lab of Marine Ecology and Environmental Sciences, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e

i n f o

Article history: Received 15 May 2015 Received in revised form 25 June 2015 Accepted 27 June 2015 Available online 17 July 2015 Keywords: Crustacean Toll receptor Transcript expression Innate immunity Parasite

a b s t r a c t Tolls/Toll-like receptors (TLRs) are important cell-surface receptors serving as pattern recognition receptors (PRRs) in the Tolls/TLRs signaling pathway of innate immune responses. In the present study, we isolated and characterized a novel Toll gene (PtToll) from Portunus trituberculatus, and further investigated its expression in various tissues of crab hosts challenged with the parasitic dinoflagellate Hematodinium. The full-length cDNA of PtToll was 3745 bp, with a 3012 bp open reading frame (ORF) encoding 1003 amino acids. Conserved domains consist of 15 tandem leucine-rich repeats (LRRs), a single-pass transmembrane segment (TM) and a cytoplasmic Toll/interleukin-1R (TIR) domain. The PtToll protein shared high similarity to other crustacean Tolls and was clustered with the crustacean Tolls in the phylogenetic tree. The PtToll gene was constitutively expressed in various tissues of P. trituberculatus, with the highest expression in hemocytes. After being challenged with the parasite, the transcripts of PtToll reacted immediately with significant alterations in all the tested tissues, and decreased consistently in most of the detected tissues (e.g., hemocytes, gill, heart, and muscle) within 24 h. Then the transcripts of PtToll were significantly up-regulated in hemocytes and heart at 48 h, and in hepatopancreas at 48 and 96 h post the parasitic challenge. By 192 h post challenge, the transcriptional level of PtToll indicated a significant suppression or a decreasing trend. The fluctuations of PtToll gene expression suggested that PtToll was closely associated with intrusion of the Hematodinium parasites, and may possess a vital and systematic function in the innate immunity of P. trituberculatus against the parasitic infection. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction The innate immunity plays crucial roles in the host defense against various pathogens, especially in invertebrates that lack the highly evolved acquired immunity (Loker et al., 2004). The innate immune response is generally triggered by recognizing the pathogen-associated molecular patterns (PAMPs) with a set of welldefined receptors-pattern recognition receptors (PRRs) (Kumar et al., 2009; Wang and Wang, 2013). Lately, Tolls/Toll-like receptors (TLRs) had been revealed to be an important PRR and a bridge between the innate and acquired immunity (Akira et al., 2001). Tolls/TLRs belong to type I integral membrane glycoproteins characterized with an ectodomain encompassing leucine-rich repeats (LRRs), a transmembrane (TM) domain, and an intracellular Toll/interleukin-1 receptor (TIR) domain for downstream signal transduction (Bowie and O’Neill, 2000; Kawai and Akira, 2010).

∗ Corresponding author. Fax: +86 532 82898995. E-mail address: [email protected] (C. Li). http://dx.doi.org/10.1016/j.molimm.2015.06.028 0161-5890/© 2015 Elsevier Ltd. All rights reserved.

TLRs participate in recognizing the PAMPs of various pathogens (e.g., bacteria, virus, fungi, and parasites), and further activate the TLRs-mediated signaling pathway to induce the innate immune responses (Kawai and Akira, 2011; O’Neill et al., 2013; Uematsu and Akira, 2008). Since, the first discovery of the Drosophila melanogaster Toll and the subsequent findings of its essential roles in the fly’s immunity (Anderson et al., 1985; Lemaitre et al., 1996), a large number of Tolls/TLRs had been identified across a wide range of vertebrates and invertebrates species (Coscia et al., 2011; Rauta et al., 2014). While in crustaceans, Toll genes had been isolated in limited number of shrimps including Penaeus monodon (Arts et al., 2007), Marsupenaeus japonicus (Mekata et al., 2008), Fenneropenaeus chinensis (Yang et al., 2008), Litopenaeus vannamei (Wang et al., 2012; Yang et al., 2007), Macrobrachium rosenbergii (Srisuk et al., 2014), and Procambarus clarkia (Wang et al., 2015), together with a few crabs such as Scylla paramamosain (Lin et al., 2012), Eriocheir sinensis (Yu et al., 2013), and Scylla serrata (Vidya et al., 2014). The crustacean Tolls had an extensive and constitutive tissue-level expression and were closely involved in innate immune

M. Li et al. / Molecular Immunology 67 (2015) 388–397

responses against pathogenic invasion (e.g., bacteria, WSSV) (Vidya et al., 2014; Wang et al., 2012; Yang et al., 2008). Moreover, the Toll of S. serrata possessed a broad-recognition capability of multiple PAMPs, such as peptidoglycan (PGN), lipopolysaccharides (LPS), and polyinosinic–polycytidylic acid (PolyI:C) corresponding to the Gram-positive bacteria, Gram-negative bacteria, and dsRNA viruses, respectively (Vidya et al., 2014). The swimming crab, Portunus trituberculatus is one of the most important commercial species extensively distributed in East Asia. It supports a large proportion of crab aquaculture in China, with the total yield exceeding 100,000 tons in 2013 (Fisheries Bureau of Agriculture Ministry of China, 2014). However, the sustainability of the crab aquaculture industry was constantly threatened by outbreaks of diseases caused by various pathogens (e.g., bacteria, viruses, fungi) (Wang et al., 2006; Wang et al., 2007). Since 2007, the parasitic dinoflagellate in the genus of Hematodinium had started causing epidemic diseases in cultured P. trituberculatus and resulted in severe economic losses to local farmers (Li et al., 2013; Xu et al., 2007). And Hematodinium has turned into a serious epidemic pathogen not only affecting the wild populations of commercially valuable crustaceans (Shields, 2012; Small, 2012; Stentiford and Shields, 2005). Whereas, there were limited researches conducted to explore the host-parasite interactions between the highly pathogenic parasite and its crustacean hosts (Li et al., 2015; Shields and Squyars, 2000). In this context, to explore the potentially essential role of novel gene in the innate immune response against parasitic infections, we isolated and characterized a novel Toll gene (PtToll) from P. trituberculatus, and further studied its expression in the major tissues of crab hosts challenged with the parasitic dinoflagellate Hematodinium. 2. Materials and methods 2.1. Experimental animals and sample collection The swimming crabs, P. trituberculatus (140 ± 10 g) were collected from a local aquaculture farm (Jiaonan, Shandong Province, China). The crabs deployed in laboratory challenge experiments were screened to be free of Hematodinium infection (referred as healthy crabs in following paragraphs), using both the microscopic assay and the molecular assay as described in Small et al. (2007) and Stentiford and Shields (2005). These crabs were acclimatized in an aerated recycling seawater system (30 ppt, 23 ± 0.5 ◦ C) for at least one week before being used in laboratory trials. Additional crabs with heavy Hematodinium infection were collected simultaneously from a separate pond and held temporarily in a separate tank until being used as donors for the challenge experiment. During the experimental period, crabs were fed clam meat once a day at night and food residues were then removed in the next morning. Waters were changed periodically to ensure the water quality being within an acceptable limit (ammonia: 0–0.3 ppm, nitrite: 0–0.6 ppm, pH: 7.4–8.2). To isolate and characterize the Toll gene from P. trituberculatus, hemocytes were withdrawn individually from four healthy crabs for cloning of the target gene. Hemolymph sampling and separation of hemocytes were performed according to the methods described in the previous study (Song et al., 2012). Hemocyte samples for gene cloning were homogenized with Trizol reagent (TaKaRa, Japan), frozen in liquid nitrogen immediately and then stored immediately at −80 ◦ C until being further processed. 2.2. RNA isolation and reverse transcription PCR (RT-PCR) Total RNAs were extracted with the Trizol reagent (TaKaRa, Japan), and further treated with RNase-free DNase I (TaKaRa, Japan).

389

The quality of RNA samples were assessed by the spectrophotometric method with an A260 nm/A280 nm ratio from 1.8 to 2.0, and further ascertained with 1% agarose gel electrophoresis based on the integrity of 18S and 28S rRNA bands. The cDNAs were synthesized from 1 ␮g of total RNA using the PrimeScriptTM RT reagent Kit (TaKaRa, Japan) according to the manufacturer’s protocols. The cDNAs templates were stored at −80 ◦ C and used for analysis of the gene expressions of PtToll. 2.3. Cloning of the full-length cDNA of PtToll To amplify partial cDNA fragments of the target gene from swimming crabs, pairs of primers (Table 1) were designed from the conserved regions of the counterparts reported in other crustaceans using the Primer Premier 5.0 software (Premier Biosoft., USA). PCR was conducted in 20 ␮L reaction volume containing 5 pmol of each specific primer, 1 unit of Taq DNA polymerase (TaKaRa, Japan) and 2 ␮L of the cDNA template. The PCR was performed in a LabCycler PCR machine (SensoQuest, Germany) with the following program: 94 ◦ C for 5 min, 38 cycles of 94 ◦ C for 30 s, 55.7 ◦ C for 30 s and 72 ◦ C for 1 min 30 s, followed by a final extension at 72 ◦ C for 10 min. The PCR products were inserted into the pMD18-T vector using TA cloning kit (TaKaRa, Japan). Five to ten independent clones with confirmed recombinant plasmids were sequenced by Invitrogen Company (Shanghai, China). To obtain the 5 - and 3 - ends of the PtToll cDNA, gene-specific primers (Table 1) were designed for the targeted PtToll gene to replicate sense or antisense regions of the amplified partial fragments. 5 - and 3 -RACE was performed with the SMART RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer’s instructions, respectively. The first round of the 5 - and 3 -end RACE-PCR (using the gene-specific primers 5gsp1 and 3gsp1 pairing with the UPM primers, respectively) was performed with the following touchdown program: 94 ◦ C for 5 min, 15 cycles of 94 ◦ C for 30 s, 68 ◦ C for 30 s (decrease 1 ◦ C per cycle) and 72 ◦ C for 2 min, 28 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s and 72 ◦ C for 2 min, followed by a final extension at 72 ◦ C for 10 min. Then a nested PCR, using the gene-specific primers (5gsp2 and 3gsp2) pairing with the NUP primers, was conducted with the same PCR program. The nested 5 - and 3 -RACE PCR products were processed and sequenced as described above. The full-length cDNA of the target gene were then assembled by alignment of the partial cDNA fragments, 5 - and 3 - RACE fragments with the aid of SeqMan program in Lasergene software (DNASTAR Inc., USA). 2.4. Sequence and phylogenetic analysis The putative protein sequence of PtToll was aligned with representative sequences of other species with the aid of MUSCLEMultiple Sequence Alignment (http://www.ebi.ac.uk/Tools/msa/ muscle/), and protein sequence identities (%) were evaluated with the MegAlign program of the Lasergene software (DNASTAR Inc., USA). Together with the amino-acid sequences of other reported Tolls/TLRs, a neighbor-joining phylogenetic tree was constructed using MEGA software (version 5.0, http://www.megasoftware.net/ ), with one-thousand bootstrap replicates to assess the robustness of the clades. Furthermore, the conservative domains of the deduced amino acid sequence were identified, and the protein domains were predicted by the Simple Modular Architecture Research Tool (SMART, http://smart.embl-heidelberg.de/). The molecular weight (MW) and theoretical iso-electric point (pI) of the protein were calculated by the sequence editor (EditSeq) of the Lasergene software (DNASTAR Inc., USA). The potential N-linked glycosylation sites were predicted by the NetNGlyc 1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/) (Blom et al., 2004).

390

M. Li et al. / Molecular Immunology 67 (2015) 388–397

Table 1 Primers designed for fragments cloning, 5 - and 3 -RACE and qRT-PCR of PtToll in this study. Primer

Sequence (5 –3 )

Nucleotide position (nt)

Remark

PtToll -F1 PtToll -R1 PtToll -F2 PtToll -R2 PtToll -F3 PtToll -R3 PtToll -F4 PtToll -R4 PtToll -5gsp1 PtToll -5gsp2 PtToll -3gsp1 PtToll -3gsp2 PtToll-QRT-F PtToll-QRT-R UPM

CAAGCAACGAATGGACAGGT TTCACCCACCACCAAGGAT ANACCTGAAGADCARACCTACTCC ATCCAAAATATACCTCATGCTC GCAGTTTCCTTTCTCAGACCAA ANCCTAAGTACCGTRTGTGCCT GCTGGAGAGTGGAGAGCCTAA TGCCACACCCACAGGAATT GCGATGTCCGTTACCAAATGTCTC GCCGTAGTGGGGGATTTCCA ATGGTGGTTGTCACTATTGCTTCC ACCAAAGCATTGAGGACAGCCAC CATTGAGGACAGCCACAGGAC TGGTAGAGAGGTACAGCTTGAGTTC LongCTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT ShortCTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT

90–109 606–624 506–527 1815–1836 1757–1778 2962–2983 2948–2968 3286–3304 659–682 262–281 2721–2744 3031–3053 3038–3058 3207–3231

PtToll fragment cloning

NUP

2.5. Quantitative real time PCR (qRT-PCR) The quantitative real time PCR (qRT-PCR) was performed with a Rotor-Gene Q 2plex HRM thermocycler (QIAGEN, Germany). Reactions (triplicate for each sample) were carried out in a 25 ␮L mixture composed of 12.5 ␮L SYBR Premix Ex Taq II (2×) (TaKaRa), 0.5 ␮L for each primer (10 ␮M), 1 ␮L RT reaction solution and additional double deionized water (10.5 ␮L). The reaction mixture was initially denatured at 95 ◦ C for 30 s, followed by 40 cycles of denaturation at 95 ◦ C for 5 s and annealing at 60 ◦ C for 30 s. Melt curve analysis was added at the end of each PCR thermal profile to assess the specificity of amplification. The efficiency (E) of qRT-PCR was calculated from the given slopes in Rotor-gene Real-Time PCR System Manager software by a 10-fold diluted cDNA sample series, with six dilution points measured in triplicate. E was determined by the equation E = 10 (−1/slope) (Rasmussen, 2001). 2.6. Tissue distribution of the PtToll gene in healthy crabs To investigate the tissue distribution of PtToll gene in P. trituberculatus, six healthy crabs were randomly selected and dissected. The tissue samples (0.1–0.3 g), including brain, gill, heart, hemocytes, hepatopancreas, intestine, muscle, stomach, and testis, were sampled and then processed similarly as the previous hemocyte samples for gene expression analysis. The tissue distribution of PtToll mRNA expression in the nine tissues was detected with the qRT-PCR assay using the specific qRT-PCR primers listed in Table 1. The specificity of the primers was verified by the melt curve analysis, and affirmed by the 1% agarose gel electrophoresis of amplicon from both qRT-PCR and standard PCR. Ct was obtained and the relative mRNA levels were calculated by the 2−DCt method as described in Livak and Schmittgen (2001), with ␤-actin acting as the endogenous control to normalize the mRNA expression of the target genes. 2.7. Expression of PtToll in crabs challenged with the Hematodinium parasite In addition, to obtain the expression profiles of PtToll gene in various tissues after immune challenge, swimming crabs in the challenge group (n = 50) received an inoculum of 100 ␮L Hematodinium trophonts (105 cells per crab) suspended in Nephrops saline (Shields and Squyars, 2000) at the juncture (sterilized with 70% ethanol) between the basis and ischium of the 5th walking

PtToll fragment cloning PtToll fragment cloning PtToll fragment cloning 5 RACE 3 RACE qRT-PCR 5 and 3 RACE

5 and 3 RACE

leg. While the crabs in control group (n = 50) were inoculated with 100 ␮L of Nephrops saline. During the experimental period, these crabs were maintained separately in two independent recycling systems set with the same environmental conditions. At 0, 3, 6, 12, 24, 48, 96, and 192 h (h) post inoculation, five crabs from each group were randomly selected, tissue samples (0.1–0.3 g) of gill, heart, hemocytes, hepatopancreas, and muscle were sampled and processed similarly as described above for gene expression analysis. Furthermore, the PtToll transcripts in the five different tissues were quantified and analyzed with the qRT-PCR assay as described above 2.8. Statistical analysis All data were shown as the mean ± standard deviation and were subjected to the one-way analysis of variance (ANOVA), followed by Duncan’s multiple range test using the SPSS Statistics software (version 18.0, SPSS, USA). Differences were considered statistically significant at the level of P < 0.05. 3. Results 3.1. Cloning and characterization of the full-length cDNA of PtToll The cDNA of PtToll was successfully acquired from the swimming crab P. trituberculatus, using the RT-PCR and RACE methods as schematically indicated in Fig. A. The full-length cDNA of PtToll (Genbank ID: KR108027) was 3745 bp in length, with a 3012 bp open reading frame (ORF) encoding 1003 amino acids, a 5 - untranslated region (UTR) of 371 bp, and a 3 - UTR of 362 bp (Fig. 1). The polyadenylation signal(AATAAA) was located closely upstream of the poly (A) tail in the 3 - UTR (Fig. 1). Additionally, the initiation code (ATG) and the stop code (TAA) were found in the full-length cDNA sequence of PtToll (Fig. 1). The putative PtToll protein contains a signal peptide of 27 residues (Fig. 1) and possessed a theoretical molecular weight of 114.6 kDa (pI, isoelectric point = 6.64). Fifteen tandem leucine-rich repeats (LRRs) domains, two LRR C-terminal domains (LRR-CTs) within the extracellular domain, a single-pass transmembrane segment (TM) (residues 785–807) and a cytoplasmic Toll/interleukin-1R (TIR) domain of 139 residues (residues 837–975) were identified in the deduced PtToll protein sequence (Fig. 1). There were 12 potential N-linked glycosylation sites predicted in the PtToll protein (Fig. 1). Additionally, the 15 tandem LRRs domains with an 11- residue insertion at position LRR13 was

M. Li et al. / Molecular Immunology 67 (2015) 388–397

391

Fig. 1. Nucleotide and amino acid sequences of the full-length cDNA of PtToll. The translated amino acid sequence was shown in standard one-letter code below the nucleotide sequence; amino acid residues were numbered in parentheses; the initiation code (ATG), stop code (TAA), and the polyadenylation signal (AATAAA) were indicated with bold letters; a signal peptide of 27 residues was indicated with a wavy line below. The tandem 15 leucine-rich repeats (LRRs) domains were distributed in the peptide section (residues 145–517) and each LRR domain was labeled with an underline and two arrows with inverse directions; two LRR C-terminal domains (LRRCT) were only indicated with underline; the single-pass transmembrane segment (TM) was labeled with italic letters in shade; the cytoplasmic Toll/interleukin-1R (TIR) domain of 139 residues (residues 837–975) was marked in shade. Twelve potential N-linked glycosylation sites were indicated with the bold letter N in the protein sequence.

392

M. Li et al. / Molecular Immunology 67 (2015) 388–397

Fig. 2. Alignments of the 15 LRRs in the ectodomain of PtToll protein to the prevailing 24-residue LRR consensus sequence of TLRs. Conserved residues were boxed; an insertion with 11 amino acid residues in LRR13 was indicated with underlines; the position of each LRR in PtToll protein was marked in parentheses.

Fig. 3. Schematic illustration of the domain architecture in PtToll. Abbreviations were shown as follows: SP, signal peptide; LRR, leucine-rich repeat; LRRCT, LRR C-terminal domain; TM, transmembrane domain; TIR, Toll/Interleukin-1R domain.

further summarized and showed in (Fig. 2), and the schematic of the whole PtToll protein was shown in Fig. 3. Supplementry material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.molimm.2015.06.028 3.2. Sequence alignment and phylogenetic analysis Multiple sequence alignments revealed that the entire protein sequence of PtToll exhibited highest identity (88%) with the Tolls of S. paramamosain and S. serrata, and followed by shrimp Tolls (>43%) and other invertebrate or vertebrate species (<30%) (Fig. 4). Furthermore, the TIR domain of PtToll protein shared much higher identity with those of other crustacean species (>70%) than the entire corresponding sequences (<50%) (Fig. 4). Meanwhile, the core conserved motifs, including YDA (residues 838–840), a proline (residue 858) and FW (residues 964–965), were identified in the TIR domain of PtToll (Fig. 5). PtToll clustered together with Tolls of crustacean species but separated from those of other invertebrates or vertebrates in the phylogenic tree (Fig. 6).

ach (Fig. 7). While low transcript levels of PtToll were detected in tissues of the heart and testis (Fig. 7). 3.4. Expression of PtToll post parasitic challenge Notable variations in transcripts of the PtToll gene were observed in the major tissues of P. trituberculatus responding to the Hematodinium parasites (Fig. 8). In the hemocytes, the mRNA expression of PtToll was significantly down-regulated at 3, 24, and 192 h (P < 0.05), while it was significantly elevated and reached a peak at 48 h (P < 0.05) post challenge (Fig. 8). Hepatopancreas displayed a significant up-regulation of the PtToll gene expression at time points of 3, 6, 48, and 96 h, but with significant inhibition at 24 and 192 h post-challenged with the parasite (P < 0.05, Fig. 8). A similar pattern of PtToll gene expressions were observed in gills and muscle. There was significant suppression in gills at time points of 3, 6, and 24 h, and in muscle at time points of 3, 12, 24, and 192 h (P < 0.05, Fig. 8). The gene expression of PtToll in heart indicated a significant decline at 3 and 6 h, followed by a significant elevation at 48 h post challenge (P < 0.05, Fig. 8).

3.3. Tissue distribution of PtToll in P. trituberculatus

4. Discussion

The mRNA of PtToll was constitutively expressed in all the nine tissues (heart, hemocytes, hepatopancreas, etc.) tested by qRT-PCR (Fig. 7). The PtToll transcripts exhibited the highest expression in the hemocytes, with moderate expression of PtToll gene observed in tissues of brain, gill, hepatopancreas, intestine, muscle, and stom-

In the present study, we isolated and characterized a novel Toll gene from the swimming crab P. trituberculatus (PtToll). The putative PtToll protein sequence showed high similarity (88%) to those of the closely related crab species S. paramamosain and S. serrata, and shared typical topology with other crustacean Tolls.

M. Li et al. / Molecular Immunology 67 (2015) 388–397

393

Fig. 4. Amino acid identities (%) of the entire protein sequence and TIR domain of PtToll with its counterparts from other species. a GenBank IDs for the sequences were as follows: DrTLR3, Danio rerio TLR3 (AAI07956); HsTLR3, Homo sapiens TLR3 (ABC86910); TrTLR3, Takifugu rubripes TLR3 (AAW69373); MmTLR3, Macaca mulatta TLR3 (ABY64988); XtTLR3, Xenopus tropicalis TLR3 (XP002934448); GgTLR3, Gallus gallus TLR3 (ACR26371); AjTLR3, Apostichopus japonicas TLR3 (AFR24259); CgToll, Crassostrea gigas Toll (ADV16386); AfToll, Azumapecten farreri Toll (ABC73693); TcToll, Tribolium castaneum Toll (EEZ99324); DmToll, Drosophila melanogaster Toll (AAQ64934); FcToll, Fenneropenaeus chinensis Toll (ACC68670); PmToll, Penaeus monodon Toll (ABO38434); LvToll2, Litopenaeus vannamei Toll2 (AEK86516); MrToll1, Macrobrachium rosenbergii Toll1 (AHL39100); EsToll, Eriocheir sinensis Toll (AGK90305); CmToll, Carcinus maenas Toll (CDO91661); SpToll, Scylla paramamosain Toll (AEX20238); SsToll, Scylla serrata Toll (AGG55849); PtToll, Portunus trituberculatus Toll (KR108027).

Furthermore, the tissue distribution of PtToll was carried out and the expression profiles of PtToll were further investigated in five tissues (e.g., hemocytes, hepatopancreas, gill, heart, and muscle) of P. trituberculatus after challenged with the Hematodinium parasites. The mRNA of PtToll gene demonstrated an extensive and constructive expression in all the detected tissues, with the highest expression in hemocytes. The significant fluctuations of the PtToll gene expression induced by the parasitic challenge suggested that PtToll was closely associated with intrusion of the Hematodinium parasites and likely possess a vital function in the innate immunity of P. trituberculatus against the Hematodinium parasite. This study present the first report on the transcriptional response of TLR gene in marine crabs against a parasite, and the major findings of the present study will contribute to better understanding of the roles of Tolls against parasitic infections in crustacean hosts. In crustaceans, innate immunity plays important roles in resisting different pathogens. Innate immune responses are triggered via recognition of pathogen-derived PAMPs by different pattern recognition receptors (PRRs) (Kumar et al., 2009; Wang and Wang, 2013). Among the PRRs, Toll-like receptors (TLRs) are capable of recognizing a wide range of different pathogens (e.g., bacteria, fungi, viruses, parasites), and play important roles in innate immunity. Since, Toll receptors were firstly isolated from D. melanogaster (Anderson et al., 1985; Lemaitre et al., 1996), Toll/Toll-like proteins have been increasingly studied (Coscia et al., 2011; Rauta et al., 2014). In crustaceans, Toll/Toll-like proteins were identified in a few shrimp and crab species, indicating its important roles in crustacean innate immunity (Vidya et al., 2014; Wang et al., 2012, 2015 Yu et al., 2013). However, compared to the insects and mammals, the biological functions of Tolls in crustacean innate immunity are still poorly understood, particularly against parasitic infection. In the present study, we firstly isolated and characterized a full-length cDNA of PtToll from the swimming crab P. trituberculatus. Multiple sequence alignments revealed that the entire PtToll protein sequence shared much higher identity to crustacean species (>43%), particularly its highest identity (88%) to S. paramamosain and S. serrata. And the phylogenetic analysis showed that PtToll was clustered together

with Tolls of crustacean species but separated from those of other invertebrates or vertebrates in the phylogenic tree. The PtToll protein was featured by the prevailing conserved domains that include fifteen tandem leucine-rich repeats (LRRs) with the prevailing 24-residue motif of x-L-x-x-L-x-L-x-x-N-x-F-xx-F-x-x-x-x-F-x-x-L-x (Rothberg et al., 1990), two LRR C-terminal (LRR-CT) domains, a transmembrane domain (TM), and an intracellular carboxyl terminal Toll/interleukin-1 receptor domain (TIR). In mammals, LRRs of TLRs were capable of directly recognizing the PAMPs originated from various pathogens (e.g., bacteria, fungi, viruses, and parasites) (Kumar et al., 2009). It had been reported that the structure of the LRRs region was involved in the interaction between TLRs and PAMPs (Bell et al., 2005; Jin and Lee, 2008). Besides, LRR-CTs might be surface-exposed and perform important roles in the protein–protein interactions of receptor dimerization (Leulier and Lemaitre, 2008). Furthermore, an insertion of 11-residue was identified at position LRR13 in PtToll, which was in agreement with the 14—residue insertion in LRR13 of S. paramamosain Toll (SpToll) (Lin et al., 2012) and S. serrata Toll (SsToll) (Vidya et al., 2014). As proposed in previous researches (Hemmi and Akira, 2002; Jin and Lee, 2008), we speculated the insertion in PtToll might play an important role in recognition of PAMPs. In Tolls of other crustacean species, nine to sixteen potential N-linked glycosylation sites were pervasively predicted (Mekata et al., 2008; Srisuk et al., 2014; Vidya et al., 2014; Yang et al., 2007 Yu et al., 2013). Similarly, 12 potential N-linked glycosylation sites were predicted in the ectodomain of the PtToll protein of P. trituberculatus in the present study. In plant and human, the N-linked glycosylation of TLRs was involved in surface representation, tracking, binding activities, and recognizing PAMPs (Haweker et al., 2010; Kataoka et al., 2006; Weber et al., 2004), while the physiological function of the potential N-linked glycosylation sites in the crustacean Tolls still needs to be further investigated. The intracellular TIR domain mediates the protein–protein interaction and is required for the downstream signal transduction (Kawai and Akira, 2010; Xu et al., 2000). Xu et al. (2000) reported that the conserved TIR domain acting in protein–protein

394

M. Li et al. / Molecular Immunology 67 (2015) 388–397

Fig. 5. Comparision of the PtToll amino acid sequence with its counterparts of other species. a GenBank IDs of the sequences used for comparision of amino acid residues were shown as follows: PtToll, P. trituberculatus Toll (KR108027); SpToll, S. paramamosain Toll (AEX20238); SsToll, S. serrata Toll (AGG55849); CmToll, C. maenas Toll (CDO91661); LvToll, L. vannamei Toll (AEK86516); MrToll1, M. rosenbergii Toll1 (AHL39100); HsTLR3, H. sapiens TLR3 (ABC86910); GgTLR3, G. gallus TLR3 (ACR26371); DrTLR3, D. rerio TLR3 (AAI07956); DmToll, D. melanogaster Toll (AAQ64934). The Toll/interleukin-1R (TIR) domain was labeled with letters in shade and two neighboring arrows with inverse directions; the conserved motifs including YDA, FW, and P amino acid in the TIR domain were indicated in bold and boxed; the identical, highly conserved, and less conserved amino acid residues were indicated by (*), (:), and (.) respectively with the aid of an internet tool at http://www.ebi.ac.uk/Tools/msa/muscle/.

M. Li et al. / Molecular Immunology 67 (2015) 388–397

395

Fig. 6. Phylogenetic analysis of PtToll. GenBank IDs for the sequences for the phylogenetic analysis were as follows: PtToll, P. trituberculatus Toll (KR108027); SpToll, S. paramamosain Toll (AEX20238); SsToll, S. serrata Toll (AGG55849); CmToll, C. maenas Toll (CDO91661); EsToll, E. sinensis Toll (AGK90305); MjToll2, Marsupenaeus japonicus Toll2 (BAG68890); LvToll, L. vannamei Toll (ABK58729); FcToll, F. chinensis Toll (ACC68670); PmToll, P. monodon Toll (ABO38434); LvToll2, L. vannamei Toll2 (AEK86516); MrToll1, M. rosenbergii Toll1 (AHL39100); DmToll, D. melanogaster Toll (AAQ64934); TcToll, T. castaneum Toll (EEZ99324); AaToll, Aedes aegypti Toll (XP 001649813); LvToll3, L. vannamei Toll3 (AEK86517); AfToll, A. farreri Toll (ABC73693); CgToll1, C. gigas Toll1 (ADV16386); AjTLR3, A. japonicas TLR3 (AFR24259); SpTLR3, Strongylocentrotus purpuratus TLR3 (XP 003731595); DrTLR3, D. rerio TLR3 (AAI07956); TrTLR3, T. rubripes TLR3 (AAW69373); XtTLR3, X. tropicalis TLR3 (XP 002934448); CmTLR3, Cairina moschata TLR3 (AFK29094); GgTLR3, G. gallus TLR3 (ACR26371); HsTLR3, H. sapiens TLR3 (ABC86910); MmTLR3, M. mulatta TLR3 (ABY64988). Bootstrap values (%) were indicated (1000 replicates). The scale bar indicates 0.1 expected amino acid substitutions per site.

interaction began with the conserved (F/Y) DA motif and ended approximately eight residues carboxy-terminal to the conserved FW motif. While in PtToll protein, we noticed that the TIR domain (residues 837–975) also possessed the YDA motif and ends 10 residues after the conserved FW motif. The alignment of the TIR domain of PtToll with other TIRs indicated that the TIR of PtToll shared high identities with its counterparts of other crustaceans (>70%). Especially, the TIR of PtToll indicated the highest identity (96.2%) with those of the crabs (SsToll and SpToll). Considering the function of the conserved domain during signal transduction, the

TIR in the Tolls of crabs might also possess similar functions in mediating the Toll signaling pathway. Like other crustaceans Tolls (e.g., SpToll, EsToll, and SsToll) (Lin et al., 2012; Vidya et al., 2014 Yu et al., 2013), the transcript of PtToll was detected in multiple tissues of P. trituberculatus, indicating its important roles in the innate immune system responding to pathogens. After the parasitic challenge, the transcripts of the PtToll reacted immediately and showed significant decreases in most of the detected tissues (e.g., gill, heart, hemocytes, and muscle) within 24 h. The significant down-regulation within 24 h was in agree-

Fig. 7. Tissue distribution of PtToll transcripts in P. trituberculatus analyzed by qRT-PCR. The values were calibrated with the internal control ␤-actin, and transcript abundance of PtToll gene was expressed relatively to that of the heart. Data was shown as the mean ± SD (n = 6 for each value).

396

M. Li et al. / Molecular Immunology 67 (2015) 388–397

Fig. 8. Relative mRNA expression profiles of PtToll transcripts in various tissues of P. trituberculatus after challenged with Hematodinium parasites. The mRNA expression of PtToll was measured by qRT-PCR, and calibrated with the internal control ␤-actin. Each value was shown as the mean ± SD (n = 5 for each value). Statistically significant difference across the controls was set at P < 0.05 and marked with (*).

ment with that of the FcToll in lymphoid organ of F. chinensisis and the SsToll in hemocytes of S. serrata, responding to WSSV or Vibrio parahaemolyticus challenge respectively (Vidya et al., 2014; Yang et al., 2008). While contradictory expression pattern of Tolls were also observed in other studies, the Tolls of the L. vannamei, E. sinensis and Procambarus clarkia were significantly induced by other pathogens (e.g. virus, bacteria, fungi) in gills and hemocytes respectively (Wang et al., 2012, 2015 Yu et al., 2013). Given that Tolls of crustacean were involved in the innate immunity and TLRs could trigger the innate responses against parasites (Gazzinelli and Denkers, 2006; Uematsu and Akira, 2008), the suppressed expression of PtToll induced by the Hematodinium parasites within 24 h might suggest a transient inhibition of the Toll-mediated immune response in the crab host, which facilitated the survival of parasites.

The gene expression of PtToll showed a consistent increasing trend in all the examined tissues at 48 to 96 h post challenge. The results were in accordance with the results of Deepika et al. (2014), where significant up-regulations of PmToll in various tissues of Penaeus monodon were observed after WSSV infection. Besides, the enhanced mRNA expressions of SpToll and SsToll were observed in hemocytes of the crab species of S. paramamosain and S. serrata at 48 h after the bacterial or viral challenge (Lin et al., 2012; Vidya et al., 2014). Thus, we speculated PtToll was associated with the innate immune response against the parasitic infection. Finally by 192 h post challenge, the transcriptional level of the PtToll gene was suppressed significantly in tissues of hemocytes, hepatopancreas and muscle. By this stage, the Toll signaling pathway involved in the innate responses might be overwhelmed by the Hemato-

M. Li et al. / Molecular Immunology 67 (2015) 388–397

dinium parasites, when the affected hosts start developing light to moderate infection (Li et al., 2015; Shields and Squyars, 2000). Thus, as boosted by previous researches, the PtToll was closely involved in the interaction between Hematodinium parasites and the crab host P. trituberculatus. While due to the lack of studies on the host-parasite interaction of Hematodinium and its crustacean hosts, future studies are necessarily needed to clarify how the PtToll functions in the signaling cascades in crabs, and to provide more affirmative evidence on the roles of PtToll in the crab innate immunity against the parasitic infection. Acknowledgements This study was financially supported by the Joint Research Fund of NNSFC—Shandong Province (grant no. U1406403), the China youth project (grant no. 41206145) of the National Natural Science Foundation of China (NNSFC), and the 100 Talents Program from the Chinese Academy of Sciences. References Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675–680. Anderson, K.V., Bokla, L., Nusslein-Volhard, C., 1985. Establishment of dorsal-ventral polarity in the Drosophila embryo: the induction of polarity by the Toll gene product. Cell 42, 791–798. Arts, J.A., Cornelissen, F.H., Cijsouw, T., Hermsen, T., Savelkoul, H.F., Stet, R.J., 2007. Molecular cloning and expression of a Toll receptor in the giant tiger shrimp, Penaeus monodon. Fish Shellfish Immunol. 23, 504–513. Bell, J.K., Botos, I., Hall, P.R., Askins, J., Shiloach, J., Segal, D.M., Davies, D.R., 2005. The molecular structure of the Toll-like receptor 3 ligand-binding domain. Proc. Natl. Acad. Sci. U. S. A. 102, 10976–10980. Blom, N., Sicheritz-Pontén, T., Gupta, R., Gammeltoft, S., Brunak, S., 2004. Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics 4, 1633–1649. Bowie, A., O’Neill, L.A., 2000. The interleukin-1 receptor/Toll-like receptor superfamily: signal generators for pro-inflammatory interleukins and microbial products. J. Leukoc. Biol. 67, 508–514. Coscia, M.R., Giacomelli, S., Oreste, U., 2011. Toll-like receptors: an overview from invertebrates to vertebrates. Invertebrate Surviv. J. 8, 210–226. Deepika, A., Sreedharan, K., Paria, A., Makesh, M., Rajendran, K.V., 2014. Toll-pathway in tiger shrimp (Penaeus monodon) responds to white spot syndrome virus infection: evidence through molecular characterisation and expression profiles of MyD88, TRAF6 and TLR genes. Fish Shellfish Immunol. 41, 441–454. Fisheries Bureau of Agriculture Ministry of China, 2014. China fisheries yearbook 2014. China Agriculture Press, Beijing. Gazzinelli, R.T., Denkers, E.Y., 2006. Protozoan encounters with Toll-like receptor signalling pathways: implications for host parasitism. Nat. Rev. Immunol. 6, 895–906. Haweker, H., Rips, S., Koiwa, H., Salomon, S., Saijo, Y., Chinchilla, D., Robatzek, S., Schaewen, A., 2010. Pattern recognition receptors require N-glycosylation to mediate plant immunity. J. Biol. Chem. 285, 4629–4636. Hemmi, H., Akira, S., 2002. A novel toll-like receptor that recognizes bacterial DNA. In: Raz, E. (Ed.), Microbial DNA and Host Immunity. Humana Press, pp. pp. 39–47. Jin, M.S., Lee, J.O., 2008. Structures of TLR-ligand complexes. Curr. Opin. Immunol. 20, 414–419. Kataoka, H., Yasuda, M., Iyori, M., Kiura, K., Narita, M., Nakata, T., Shibata, K.I., 2006. Roles of N-linked glycans in the recognition of microbial lipopeptides and lipoproteins by TLR2. Cell Microbiol. 8, 1199–1209. Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11, 373–384. Kawai, T., Akira, S., 2011. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 34, 637–650. Kumar, H., Kawai, T., Akira, S., 2009. Pathogen recognition in the innate immune response. Biochem. J. 420, 1–16. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Leulier, F., Lemaitre, B., 2008. Toll-like receptors—taking an evolutionary approach. Nat. Rev. Genet. 9, 165–178. Li, C., Song, S., Liu, Y., Chen, T., 2013. Hematodinium infections in cultured Chinese swimming crab, Portunus trituberculatus, in northern China. Aquaculture 396–399, 59–65. Li, M., Li, C., Wang, J., Song, S., 2015. Immune response and gene expression in hemocytes of Portunus trituberculatus inoculated with the parasitic dinoflagellate Hematodinium. Mol. Immunol. 65, 113–122.

397

Lin, Z., Qiao, J., Zhang, Y., Guo, L., Huang, H., Yan, F., Li, Y., Wang, X., 2012. Cloning and characterization of the SpToll gene from green mud crab, Scylla paramamosain. Dev. Comp. Immunol. 37, 164–175. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T.B., 2004. Invertebrate immune systemse not homogeneous, not simple, not well understood. Immunol. Rev. 198, 10–24. Mekata, T., Kono, T., Yoshida, T., Sakai, M., Itami, T., 2008. Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicus. Fish Shellfish Immunol. 24, 122–133. O’Neill, L.A.J., Golenbock, D., Bowie, A.G., 2013. The history of Toll-like receptors-redefining innate immunity. Nat. Rev. Immunol. 13, 453–460. Rasmussen, R., 2001. Quantification on the LightCycler. In: Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real-time PCR, Methods and Applications. Springer Press, Heidelberg, pp. 21–34. Rauta, P.R., Samanta, M., Dash, H.R., Nayak, B., Das, S., 2014. Toll-like receptors (TLRs) in aquatic animals: signaling pathways, expressions and immune responses. Immunol. Lett. 158, 14–24. Rothberg, J.M., Jacobs, J.R., Goodman, C.S., Artavanis-Tsakonas, S., 1990. Slit: an extracellular protein necessary for development of midline. Genes Dev. 4, 2169–2187. Shields, J.D., 2012. The impact of pathogens on exploited populations of decapod crustaceans. J. Invertebr. Pathol. 110, 211–224. Shields, J.D., Squyars, C.M., 2000. Mortality and hematology of blue crabs Callinectes sapidus, experimentally infected with the parasitic dinoflagellate Hematodinium perezi. Fish Bull. 98, 139–152. Small, H.J., 2012. Advances in our understanding of the global diversity and distribution of Hematodinium spp.—significant pathogens of commercially exploited crustaceans. J. Invertebr. Pathol. 110, 234–246. Small, H.J., Shields, J.D., Hudson, K.L., Reece, K.S., 2007. Molecular detection of Hematodinium sp. infecting the blue crab, Callinectes sapidus. J. Shellfish Res. 26, 131–139. Song, C., Cui, Z., Liu, Y., Li, Q., Wang, S., 2012. Cloning and expression of arginine kinase from a swimming crab, Portunus trituberculatus. Mol. Biol. Rep. 39, 4879–4888. Srisuk, C., Longyant, S., Senapin, S., Sithigorngul, P., Chaivisuthangkura, P., 2014. Molecular cloning and characterization of a Toll receptor gene from Macrobrachium rosenbergii. Fish Shellfish Immunol. 36, 552–562. Stentiford, G.D., Shields, J.D., 2005. A review of the parasitic dinoflagellates Hematodinium species and Hematodinium-like infections in marine crustaceans. Dis. Aquat. Org. 66, 47–70. Uematsu, S., Akira, S., 2008. Toll-Like receptors (TLRs) and their ligands. In: Bauer, S., Hartmann, G. (Eds.), Toll-Like Receptors (TLRs) and Innate Immunity. Springer, Berlin, Heidelberg, pp. 1–20. Vidya, R., Paria, A., Deepika, A., Sreedharan, K., Makesh, M., Purushothaman, C.S., Chaudhari, A., Babu, P.G., Rajendran, K.V., 2014. Toll-like receptor of mud crab, Scylla serrata: molecular characterisation, ontogeny and functional expression analysis following ligand exposure, and bacterial and viral infections. Mol. Biol. Rep. 41, 6865–6877. Wang, G.L., Shan, J., Chen, Y., Li, Z., 2006. Study on pathogens and pathogenesis of emulsification disease of Portunus trituberculatus. Adv. Marine Sci. 24, 527–531. Wang, P.H., Liang, J.P., Gu, Z.H., Wan, D.H., Weng, S.P., Yu, X.Q., He, J.G., 2012. Molecular cloning, characterisation and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spätzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei. Dev. Comp. Immunol. 36, 359–371. Wang, X., Chi, Z., Yue, L., Li, J., Li, M., Wu, L., 2007. A marine killer yeast against the pathogenic yeast strain in crab (Portunus trituberculatus) and an optimization of the toxin production. Microbiol. Res. 162, 77–85. Wang, X.W., Wang, J.X., 2013. Pattern recognition receptors acting in innate immune system of shrimp against pathogen infections. Fish Shellfish Immunol. 34, 981–989. Wang, Z., Chen, Y.H., Dai, Y.J., Tan, J.M., Huang, Y., Lan, J.F., Ren, Q., 2015. A novel vertebrates Toll-like receptor counterpart regulating the anti-microbial peptides expression in the freshwater crayfish, Procambarus clarkii. Fish Shellfish Immunol. 43, 219–229. Weber, A.N., Morse, M.A., Gay, N.J., 2004. Four N-linked glycosylation sites in human toll-like receptor 2 cooperate to direct efficient biosynthesis and secretion. J. Biol. Chem. 279, 34589–34594. Xu, W., Shi, H., Xu, H., Small, H.J., 2007. Preliminary study on the Hematodinium infection in cultured Portunus trituberculatus. Acta. Hydrobiol. Sin. 31, 640–647. Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J.L., Tong, L., 2000. Structural basis for signal transduction by the Toll/interleukin-1 receptor domains. Nature 408, 111–115. Yang, C., Zhang, J., Li, F., Ma, H., Zhang, Q., Jose Priya, T.A., Zhang, X., Xiang, J., 2008. A Toll receptor from Chinese shrimp Fenneropenaeus chinensisis responsive to Vibrio anguillarum infection. Fish Shellfish Immunol. 24, 564–574. Yang, L.S., Yin, Z.X., Liao, J.X., Huang, X.D., Guo, C.J., Weng, S.P., Chan, S.M., Yu, X.Q., He, J.G., 2007. A Toll receptor in shrimp. Mol. Immunol. 44, 1999–2008. Yu, A.Q., Jin, X.K., Guo, X.N., Li, S., Wu, M.H., Li, W.W., Wang, Q., 2013. Two novel Toll genes (EsToll1 and EsToll2) from Eriocheir sinensis are differentially induced by lipopolysaccharide, peptidoglycan and zymosan. Fish shellfish immunol. 35, 1282–1292.