- Email: [email protected]
Characterisation and functional analysis of an L-type lectin from the swimming crab Portunus trituberculatus
Gene 664 (2018) 27–36
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Characterisation and functional analysis of an L-type lectin from the swimming crab Portunus trituberculatus
T
⁎
Zhibin Lua,b, Zhiming Rena, Changkao Mua, , Ronghua Lia, Yangfang Yea, Weiwei Songa, Ce Shia, ⁎ Lei Liua, Chunlin Wanga, a b
Key Laboratory of Applied Marine Biotechnology, Ministry of Education, Ningbo University, Ningbo 315211, China Collaborative Innovation Center for Zhejiang Marine High-efficiency and Healthy Aquaculture, Ningbo University, Ningbo 315211, China
A R T I C LE I N FO
A B S T R A C T
Keywords: L-type lectin Glycoprotein secretion Portunus trituberculatus Carbohydrate recognition domain Protein expression Immune response
L-type lectins are involved in glycoprotein secretion and are associated with immune responses. Herein, an Ltype lectin was identified in swimming crab (Portunus trituberculatus). The 1347 bp PtLTL cDNA includes a 26 bp 5′-untranslated region (UTR), a 547 bp 3′-UTR with a poly(A) tail, and a 774 bp open reading frame encoding a 257 amino acid protein with a putative 21 residue signalling peptide. The protein includes an L-type lectin carbohydrate recognition domain containing four conserved cysteines. The 714 bp cDNA fragment encoding the mature peptide of PtLTL1 was recombined into pET-21a (+) with a C-terminally hexa-histidine tag fused inframe and expressed in Escherichia coli Origami (DE3). Recombinant PtLTL1 caused agglutination of all three Gram-positive and Gram-negative bacterial strains tested. In addition, erythrocyte agglutination and LPSbinding activity were observed. PtLTL1 mRNA transcripts were most abundant in P. trituberculatus hepatopancreas and hemocytes, and expression was up-regulated in hemocytes challenged with Vibrio alginolyticus, suggesting PtLTL functions in the immune response against bacterial pathogens.
1. Introduction Innate immunity, including humoral and cellular immunity, is the first and most important line of defence against microbial infections (Wang et al., 2007). It is especially important in invertebrates because they lack true adaptive immunity and depend entirely on innate immune responses. Lectins are an important class of pattern recognition receptor (PRR) that recognise specific sugar conjugates and promote bacteria agglutination by binding sugars on the bacterial surface (Yamaura et al., 2008). Apart from pathogen recognition, lectins function in others biological processes, such as cell-cell interactions, protein synthesis and transport, and signal transduction (Zhang et al., 2000). Based on structure and function, crustacean lectins can be classified into seven lectin families: C-type, L-type, P-type, M-type, fibrinogen-like domain lectins, galectins, and calnexin/calreticulin (Wang and Wang, 2013). Many types of lectins have been identified and reported in different species of crustacean, especially C-type lectins (Ma et al., 2008; Jiang et al., 2012; Lu et al., 2017), but reports on L-lectins are scarce.
Lectins are a group of molecules which are highly specific for the binding of carbohydrate. It was firstly discovered in leguminous plants, which contain a luminal carbohydrate recognition domain (CRD), also known as an LTL domain (LTLD), therefore it was named legume lectin (L-type lectin) (Zhu et al., 2013). To date, > 70 LTLs have been identified and isolated from various sources including bacteria, algae, plants, fungi, body fluid of invertebrates, lower vertebrates and mammalian (Singh et al., 1999). They differ in their carbohydrate specificities, but resemble one another in their physicochemical properties and structures (Appenzeller-Herzog et al., 2004). L-type lectins have different intracellular distributions and dynamics in the endoplasmic reticulum (ER)-Golgi system of the secretary pathway (Hauri et al., 2000., Moussalli et al., 1999). Recent studies showed there were only two kind of L-type lectin identified in invertebrates, endoplasmic reticulum Golgi intermediate compartment-53 (ERGIC-53) and 36 kDa vesicular integral membrane protein (VIP36) (Sarnataro et al., 1999; Fiedler and Simons, 1996; Zhang et al., 2012). ERGIC-53 is a mannose-specific membrane lectin operating as a cargo receptor for the transport of glycoproteins from the ER to the
Abbreviations: LTL, L-type lectin; PRR, pattern recognition receptor; CRD, carbohydrate recognition domain; RACE, rapid-amplification of cDNA ends; EST, expressed sequence tag; ORF, open reading frame; ERGIC-53, reticulum Golgi intermediate compartment-53; VIP36, 36 kDa vesicular integral membrane protein; qRT-PCR, quantitative real-time PCR; FITC, fluorescein isothiocyanate isomer I; LPS, lipopolysaccharide ⁎ Corresponding author at: Ningbo University, 818 Fenghua Rd., Ningbo 315211, China. E-mail addresses: [email protected] (C. Mu), [email protected] (C. Wang). https://doi.org/10.1016/j.gene.2018.04.041 Received 27 January 2018; Received in revised form 26 March 2018; Accepted 16 April 2018 Available online 22 April 2018 0378-1119/ © 2018 Published by Elsevier B.V.
Gene 664 (2018) 27–36
Z. Lu et al.
Table 1 Oligonucleotide primers used in this study. Primer
Sequence(5′-3′)
Sequence information
P1 P 2 (forward) P 3 (reverse) P 4 (forward) P 5 (reverse) P 6 (forward) P 7 (reverse) RV-M (forward) M13-47 (reverse)
GACTTTCTTGGGTCCACGAT CACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGC CCGAAAGGAAGCTGAGTTGGCTGCTGCCA TGTGATTGCTGTAGGTGT CCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATA CGAAACCTTCAACACTCCCG GATAGCGTGAGGAAGGGCATA CGCCAGGGTTTTCCCAGTCACGAC GACTAACAGGAGACATTCAG
Specific primer (for RACE) Recombinant primer (for expression) Recombinant primer (for expression) Specific primer (for Real-time PCR) Specific primer (for Real-time PCR) β-actin primer (for Real-time PCR) β-actin primer (for Real-time PCR) Vector primer (for sequencing) Vector primer (for sequencing)
ERGIC. ERGIC-53 may affect β-integrin traffic, since an ERGIC-53 mutant caused β-integrin-related developmental defects in Drosophila (Kamiya et al., 2008). VIP36 is a type I integral membrane glycoprotein, which was earliest isolated from Madin-Darby canine kidney cells as a component of detergent-insoluble, glycolipid-enriched complexes containing apical marker proteins (Hauri et al., 2000). VIP36 was located in the Golgi and transfers between Golgi and endoplasmic reticulum (ER) (Nichols et al., 1998; Neve et al., 2003; Zhang, 2009). VIP36 has lectin activity and recognises high mannose-type glycans that contain more than seven mannose residues, but its efficient binding requires the additional presence of an a-substituted asparagine residue (Hauri et al., 2000; Kuge et al., 1999). ERGIC-53 binds glycoproteins in a Ca2+- and pH-dependent manner, but the Ca2+ requirement for sugar binding of VIP36 to high mannose-type glycans remains controversial (Zhang, 2009; Herzog et al., 2004). Thus, ERGIC-53 and VIP36 share similar L-type lectin domains and mannose-binding selectivity, but have distinct functions within the early secretary pathway. Recently, A number of LTLs have been isolated from decapod crustaceans, all of which are involved in various aspects of the immune response (Xu et al., 2014; Huang et al., 2014). The swimming crab, Portunus trituberculatus, is among the most important marine species in Japan, Korea, and China (Hamasaki et al., 2006). With the advancement of artificial breeding techniques, the P. trituberculatus aquaculture industry has expanded rapidly, but mortality problems have emerged, such as toothpaste disease caused by Vibrio alginolyticus infection (Liu, 2007). As invertebrates that lack adaptive immunity, crustaceans rely exclusively on the innate immune system to recognise potential pathogens and subsequently clear invading microorganisms (Medzhitov and Janeway, 2002). A better understanding of the immune defence mechanisms of P. trituberculatus is essential to help control diseases and maintain crab aquaculture. In the present study, an LTL was identified in P. trituberculatus, and its structural features, bacterial agglutination, haemagglutination, LPS-binding, tissue distribution, and temporal expression following V. alginolyticus challenge were investigated to investigate its functions in the immune responses.
2.2. Sample collection, RNA extraction, and cDNA synthesis Five healthy crabs were isolated for examination of PtLTL expression in hepatopancreas, muscle, hemocytes, and gills. All tissue samples were immediately snap-frozen in liquid nitrogen and stored at −80 °C for RNA isolation and subsequent analyses. All serum samples were centrifuged at 3000g for 10 min at 4 °C and stored at −80 °C for serum immune index analysis. Total RNA was extracted from tissues using Trizol Reagent (Invitrogen, USA), spectrophotometrically quantified, and electrophoresed on a 1% denaturing agarose gel to confirm integrity. For each reverse transcription (RT) reaction, 3 mg of total RNA was subjected to cDNA synthesis using a SMARTer RACE cDNA Amplification Kit (Clontech, USA) in a 20 μL volume according to the manufacturer's instructions. The 3′ CDS-Primer was used as a 3′RACE RT Primer to introduce an adaptor, and the 5′CDS-Primer and SMARTer Oligo were used to synthesise the 5′ ends of the full-length gene (Clontech, USA). All primers were synthesised by the Beijing Genomics Institute (Shanghai, China). 2.3. Cloning of PtLTL PCR amplification of PtLTL was conducted using an Eppendorf Mastercycler gradient instrument (Eppendorf, Germany) with degenerate primers P1 and UPM (Clontech, USA) (Table 1). All reactions were performed in a 25 μL volume containing 10.5 μL PCR-grade water, 8 μL 10× PCR buffer, 2.5 μL UPM, 2 μL dNTPs (2.5 mM), 0.5 μL polymerase (5 U mL−1), 0.5 μL primer03 (10 mM), and 1 μL cDNA mix (Clontech, USA). The program was carried out as follows; five cycles at 94 °C for 30 s, then 72 °C for 3 min; five cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 3 min; 20 cycles at 94 °C 30 s, 68 °C for 30 s, and 72 °C for 3 min. PCR products were subjected to electrophoresis on a 1.5% agarose gel and purified prior to cloning into the pMD-18T vector (Takara, Japan). After transformation of competent E. coli DH5a cells, positive recombinants were identified using anti-Amp selection and confirmed by PCR. Positive clones were sequenced in both directions with primers RV-M and M13-47 (Table 1), and the resulting sequences were verified and subjected to cluster analysis using NCBI databases.
2. Materials and methods 2.1. Immune challenge
2.4. Sequence and phylogenetic analyses
To investigate the immunity-related functions of PtLTL, V. alginolyticus was used as an immune stimulant in time course experiments. Sixty healthy swimming crabs (initial body weight of 100 ± 10 g) were collected from a commercial farm in Yinzhou, China, and intraperitoneally injected with 1.0 mL of V. alginolyticus (106 CFU mL−1) suspended in phosphate buffered saline (PBS; pH 7.0; 1 mL per animal) into the arthrodial membrane of the last walking leg. Sixty healthy swimming crabs were also injected with the same amount of PBS and kept separately as a control group. Injected crabs were returned to the water and 6 individuals were sampled from challenge and control groups at 0, 3, 6, 12, 24 and 48 h.
The cDNA sequence and deduced amino acid sequence of PtLTL were analysed using the BLAST algorithm (http://www.ncbi.nlm.nih. gov/blast) and the Expert Protein Analysis System (http://www.expasy. org/). The signal peptide was predicted with the SignalP 4.1 server (http://www.cbs.dtu.dk/service/SignalP). Protein domains were revealed by the PROSITE program (http://www.kr.expasy.org/prosite/) and SMART version 4.0 (http://www.smart.emblheidelberg.de/). In addition, the ProtParam program (http://www.expasy.ch/tools/ protparam.html) was used to compute physical and chemical parameters of the deduced amino acid sequence. The ClustalW program was used to perform multiple sequence alignment, and an unrooted phylogenetic tree was constructed based on the sequence alignment using the 28
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 1. Nucleotide and deduced amino acid sequence of PtLTL from P. trituberculatus. The predicted signal peptide is subscripted to the dotted line. The revelation codon (ATG) and the stop codon (TGA) are marked with double underline. The LTLD domain is underlined. The lamG domain is shaded with gray. The carbohydratebinding sites and carbohydrate-binging region are enclosed.
with primers P3 and P4 and confirmed by DNA sequencing. The parent vector without the inserted fragment was used as the negative control. After DNA sequencing to confirm in-frame gene insertion, positive transformants and the negative control were incubated respectively in LB medium (containing 50 mg mL−1 ampicillin and 1% glucose) at 37 °C with shaking at 220 rpm. When the culture reached an absorbance at 600 nm (OD600) of 0.5–0.7, IPTG was added to a final concentration of 1 mM and incubation was continued for an additional 4 h under the same conditions. Cells were harvested by centrifugation at 8000g for 2 min and resuspended in 50 mM PBS containing 8 M urea and 0.5 mM NaCl (pH 7.4). After sonication at 4 °C for 60 s the recombinant PtLTL1 protein (rPtLTL) and the negative control sample were subjected to purification using Ni-agarose resin (CoWinBiosciences, China) according to the manufacturer's instructions (Zhang, 2007). The purified protein was refolded by sequential dialysis in buffers containing 6, 4, 2, 1, and 0 M urea (pH 7.0) as well as 50 mM Tris-HCl, 50 mM NaCl, 10%
neighbor joining (NJ) algorithm in Mega 5.0 (Livak and Schmittgen, 2001). The reliability of the branching was tested by bootstrap resampling (5000 pseudo-replicates). 2.5. Expression and purification of recombinant PtLTL Gene-specific primers P2 (containing an N-terminal hexahistidine tag) and P3 (Table 1) were designed to amplify a PCR fragment encoding the mature peptide. In order to facilitate cloning, an NdeI site was added to the 5′ end of P2, and an XhoI site was added to the 3′ end of P3 after the stop codon. PCR products were cloned into the pMD18-T vector (Takara, Japan), digested completely with NdeI and XhoI (NEB, China), and subcloned into the NdeI and XhoI sites of the pET-21a(t) expression vector (Novagen, China). The resulting recombinant plasmid pET-21a(t)-PtLTL1 was transformed into competent E. coli Origami (DE3) cells (Novagen, China), and positive clones were screened by PCR 29
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 2. Multiple sequence alignment of CRD in PtLTL and other LTLs. The conserved amino acid residues are shaded with black. The sequences are as follows: M.japonicus JQ804833, A.aegypti XM001654620, A.gambiae XM313693, C.elegans NM075750, D.melanogaster NM142967, H.sapiens AY358929, P.clarkii HQ414545, X.tropicalis NM001078728, E.sinensis KM433865, C.aethiops AF160877, H.sapiens AK312869, R.norvegicus NM053886, D.rerio BC091860, H.sapiens AY358929, X.tropicalis NM001247993, A.gambiae XM315413, A.aegypti DQ440341, C.briggsae XM002639129.
30
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 3. Phylogenetic tree based on CRDs from PtLTL and other invertebrate LTLs. The tree is constructed by the neighbor-joining (NJ) algorithm using the Mega 5.1 program. Bootstrap trails are replicated 1000 times to derive the confidence value. The protein sequence used for phylogenetic analysis are as follows: M.japonicus JQ804833, A.aegypti XM001654620, A.gambiae XM313693, C.elegans NM075750, D.melanogaster NM142967, H.sapiens AY358929, P.clarkii HQ414545, X.tropicalis NM001078728, E.sinensis KM433865, C.aethiops AF160877, H.sapiens AK312869, R.norvegicus NM053886, D.rerio BC091860, X.tropicalis NM001247993, A.gambiae XM315413, A.aegypti DQ440341, C.briggsae XM002639129.
2007). Briefly, erythrocytes derived from rabbits were washed three times with TBS-Ca buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM CaCl2, pH 7.5), trypsinised, and resuspended in 2% TBS-Ca buffer. A 25 μL volume of two-fold serially diluted rPtLTL in TBS-Ca buffer was mixed with 25 μL of erythrocyte suspension in a 96-well microtitre plate. EDTA at a final concentration of 10 mM was added to wells containing rPtLTL to determine whether agglutination was calciumdependent, and 25 μL of TBS-Ca buffer without rPtLTL was also used as a blank control. The plate was incubated for 1 h at room temperature before the extent of haemagglutination was observed under a light microscope (Nikon, Japan). Gram-positive bacterial strains Bacillus aquimaris, Micrococcus lysodeik, Staphylococcus aureus and Gram-negative bacterial strains Aeromonas hydrophila, Vibrio alginolyticus, Chryseobacterium indologenesis were tested in the rPtLTL agglutination assay previously described (Liu et al., 2016). After staining with fluorescein isothiocyanate (FITC), bacteria were incubated with 20 μL of rPtLTL (final concentration = 99.67 μg mL−1) or 20 μL of dialysis buffer at room temperature for 45 min, and cells were observed by fluorescence microscopy (Nikon, Japan).
2.7. LPS-binding assay The wells of a flat-bottomed 96-well assay plate were coated with LPS derived from E. coli (Sigma, L2630) as described previously (Zhang et al., 2009). A 50 μL volume of rPtLTL in TRIS buffer (TB; 50 mM TRISHCl, 50 mM NaCl, pH 8.0) containing 5 mM CaCl2 and 0.1 mg mL−1 of different concentrations of BSA were added to each well. Wells containing 50 μL TB buffer were used as blank controls, and wells with 50 μL TB buffer containing 5 mM CaCl2 and 0.1 mg mL−1 BSA were used as negative controls. The results were expressed using the ELISA index (EI) according to the following formula: EI/OD sample/cut-off, where the cut-off was established as the mean OD value of three negative controls plus three standard deviations (S.D.). Samples with an EI > 1.0 were considered positive.
Fig. 4. SDS-PAGE analysis of rPtLTL. Lane 1: protein molecular standard; lane 2: purified rPtLTL; lane 3: expression of rPtLTL1 after IPTG induction; lane 4: uninduced control without IPTG induction.
glycerol, 1% glycine, 1 mM EDTA, 0.2 mM oxidised glutathione, and 2 mM reduced glutathione (Mu et al., 2012). Purified proteins were verified by 15% SDS-PAGE, and the concentration was determined using a Total Protein Quantitative Assay Kit (Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer's protocol. 2.6. Haemagglutination and bacterial agglutination assay This procedure was performed as described previously (Zhang, 31
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 5. Bacterial aggregation induced by rPtLTL. The magnification is 100 ×. A, B: Bacillus aquimaris; C, D: Micrococcus lysodeik; E, F: Staphylococcus aureus; G, H: Aeromonas hydrophila; I, J: Vibrio alginolyticus; K, L: Chryseobacterium indologenes; A, C, E, G, I, K: no protein is contained; B, D, F, J, L: 99.67 μg ml−1 rPtLTL recombinant protein is contained.
3. Results
2.8. Quantification of PtLTL transcripts by quantitative real-time PCR and statistical analysis
3.1. Molecular characterisation of PtLTL Quantitative real-time PCR was applied to evaluate the transcription of PtLTL in different tissues of healthy and infected crabs and fish. A pair of gene-specific primers (P4 and P5) was designed for the quantitative analysis. The β-actin housekeeping gene P6 and P7 were used as an internal reference for normalising experimental data (Table 1). Firststrand cDNA was synthesised, and for each quantitative real-time PCR, 1 μL of the resultant dilution was added as template in final volume of 25 μL. Reactions were carried out on a quantitative thermal cycler using SYBR green I as a fluorescent dye. Quantitative real-time PCR was performed as follows: 95 °C for 2 min, followed by 35 cycles of 95 °C for 5 s, 60 °C for 15 s, and 72 °C for 20 s. Fluorescent data were acquired during each annealing phase. To verify that the primer pair produced only a single product, the melting curve of the product was determined by heating from 59 °C to 90 °C at the end of the reaction. During detection, all samples were analysed in triplicate, and reactions without cDNA were included as negative controls. Finally, Ct values obtained from qPCR were converted into relative expression levels using the 2−ΔΔCT method (Livak and Schmittgen, 2001), and values represent n-fold differences relative to the calibrator. Statistical analysis was performed using IBM SPSS statistics 22 software. All data are the mean relative mRNA expression ± S.E. Statistical significance was determined by one-way ANOVA and posthoc Duncan multiple range tests, and P < 0.05 was considered significant.
In the present study, a novel LTL (PtLTL) was cloned and characterised from swimming crab P. trituberculatus following an expressed sequence tag (EST) search and rapid amplification of cDNA ends (RACE) experimental approach. Sequence data have been deposited in GenBank under accession number MG515241. The complete nucleotide sequence of the 1347 bp PtLTL cDNA contains a 774 bp ORF, a 26 bp 5′untranslated region (UTR), a 547 bp 3′-UTR with a poly (A) tail (Fig. 1), encoding a deduced protein of 257 amino acids (with a signal peptide at the N-terminus) with a predicted molecular weight of 28.97 kDa and a predicted isoelectric point of 5.88. The LTLD and LamG domains include three carbohydrate-binding sites with the same apparent specificity, and two carbohydrate-binding regions were also identified (Fig. 1). Analysis revealed that PtLTL, EsVIP-36, MjLTL, and PcLTL from different species are highly evolutionarily conserved, with almost identical amino acid sequences (Fig. 2). BLASTP searches of the nonredundant protein database in GeneBank showed that PtLTL shares highest sequence identity (85%) with EsVIP36 (Eriocheir sinensis, KM433865.1). To probe the evolutionary relationships of PtLTL, sequences of LTLs from fish, mammals, and invertebrates were used to construct a phylogenetic tree (Fig. 3). The results showed that PtLTL shares high identity with lectins from E.sinensis (KM433865.1), Procambarus clarkii (HQ414545.1), and Marsupenaeus japonicus (JQ804833). These results showed that PtLTL was clustered into the VIP36 family.
32
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 6. Agglutination activity of rPtLTL to rabbit erythrocytes (40×). A: no protein is contained. B: 99.67 μg ml−1 protein and 10 mmol L−1 EDTA are contained. C: 99.67 μg mL−1 protein is contained. D: 49.83 μg mL−1 protein is contained. E:24.92 μg mL−1 protein is contained. F: 12.46 μg mL−1 protein.
Fig. 7. Binding activity toward LPS of PtLTL.
The recombinant plasmid pET-21a (+)-PtLTL was transformed into E. coli Origami (DE3) as described above. Following IPTG induction, one major protein with an apparent molecular weight of 25.9 kDa was detected in the positive transformant (Fig. 4), which could be further purified to homogeneity by Ni-NTA Sepharose column. The concentration of the rPtLTL protein was 99.67 mg mL−1.
induced by rPtLTL. In the presence of Ca2+, rPtLTL (99.67 μg mL−1) was found to significantly agglutinate all six tested bacteria, including three Gram-positive bacterial strains and three Gram-negative bacterial strains. No obvious agglutination was observed in the control group (Fig. 5). When rabbit erythrocytes were incubated with 99.67 μg mL−1 rPtLTL, agglutination was observed. However, no agglutination was observed when EDTA was added, or when the rPtLTL solution was diluted by more than eight-fold (Fig. 6).
3.3. Bacterial agglutination and haemagglutination activity of rPtLTL
3.4. LPS-binding activity of rPtLTL
3.2. Expression, purification, and characterisation of PtLTL
The LPS-binding activity of rPtLTL was examined using an enzyme-
Six FITC-stained bacterial strains were used to test the agglutination 33
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 8. Tissue distribution of the PtLTL transcription detected by quantitative real-time PCR. Each bar represents the mean ± S.E. (n = 5). Different letters represent significant differences (P < 0.05). Fig. 9. PtLTL transcription in the hemocytes after Vibrio alginolyticus challenge. The mRNA expression of PtLTL (relative to β-actin) in the hemocytes in response to V. alginolyticus (black bars) or saline control (white bars) at 0, 3, 6, 12, 24 and 48 h postinjection was determined by quantitative real-time PCR. Data are represented as means ± S.E. (n = 5). Different letters represent significant differences (P < 0.05).
3.5. Expression of PtLTL in different tissues and following V. alginolyticus challenge
linked immunosorbent assay (ELISA). After incubating the samples and washing, the amount of bound rPtLTL was detected using a mouse antiHis antibody. PtLTL displayed high binding affinity toward LPS with a dose-dependent manner (Fig. 7). The ELISA index with different concentrations of rPtLTL was higher than 1.0, hence the samples were considered positive. For negative control, no apparent binding capacities were identified (Fig. 7).
The results of RT-PCR showed that PtLTL mRNA expression was detected in all tissues (hemocytes, gill, hepatopancreas and muscle) obtained from healthy crabs prior to any treatment (Fig. 8). The highest expression level was observed in the hepatopancreas, which was sevenfold (P < 0.01) higher than that in hemocytes, while the lowest expression was observed in gill and muscle. Expression of PtLTL in 34
Gene 664 (2018) 27–36
Z. Lu et al.
by exposure to V. alginolyticus. Recombinant PtLTL binds to LPS, and causes agglutination of both Gram-positive and Gram-negative bacteria, and facilitated the clearance of V. alginolyticus. These results suggest PtLTL may be involved in the innate immunity of crabs.
hemocytes was observed in response to exposure to V. alginolyticus, which is a serious pathogen of this crab species (Liu, 2007). Quantitative real-time PCR was carried to investigate the function of PtLTL in anti-bacterial innate immunity. The mRNA expression of PtLTL in hemocytes following V. alginolyticus challenge is presented in Fig. 9. PtLTL was rapidly up-regulated following bacterial exposure, and peaked within 12 h, then decreased from 12 to 48 h, gradually recovering to normal levels at 48 h post-infection. In addition, PtLTL transcripts in hemocytes did not change significantly after exposure to PBS alone between 3 h and 48 h.
Acknowledgements The authors are grateful to all the members of the lab, thanks to their technical advice and helpful discussion. This work was supported by the National Natural Science Foundation of China (41476124), Major Agriculture Program of Ningbo (2017C110007), China Agriculture Research System (CARS-48), Natural Science Foundation of Ningbo (2015A610260), and the K C Wong Magana Fund in Ningbo University.
4. Discussion In the present study, PtLTL from the Swimming crab P. trituberculatus was identified, cloned, and characterised using EST search and RACE techniques. The complete 1347 bp nucleotide sequence of PtLTL contains a 774 bp ORF encoding a deduced protein of 257 amino acids (including a 21 amino acid signal peptide and L-lectin super family domains) with a predicted molecular weight of 28.97 kDa (Fig. 1). The results revealed the presence of three carbohydrate-binding sites with the same specificity and two carbohydrate-binding regions (Fig. 1), consistent with previous reports that most L-lectins consist of two or four subunits, each with a single, small carbohydrate-binding site with the same specificity (Sharon and Lis, 2002; Suttisrisung et al., 2011). Each 200–300 amino acid subunit is 25–30 kDa (Sharon and Lis, 2002). The deduced PtLTL protein includes a putative signal peptide of 21 residues at the N-terminus, and an LTLD of 224 amino acids at the Cterminus, similar to other known L-type lectins. Comparison with four other L-type lectins showed that PtLTL shares similar domains with MjLTL, PcLTL, and EsVIP36 from crustaceans (Xu et al., 2014; Huang et al., 2014; Dai et al., 2016). Aggregation activity is the most important feature of lectins, and PtLTL clearly caused agglutination of both Gram-positive and Gramnegative bacteria in the absence of calcium in the present study. Agglutination activity has also been reported for a low-density lipoprotein receptor class A domain-containing C-type lectin (EsCTLD), specifically for its CTLD domain (Huang et al., 2014), as well as two novel single-CRD-containing C-type lectins EsLecA and EsLecG (Jin et al., 2013). Furthermore, VIP36 has the ability to bind LPS as well as Gram-positive (S. aureus, B. thuringiensis, and B. subtilis) and G-negative (E. coli, V. natriegens, V. parahaemolyticus, and A. hydrophila) bacteria (Huang et al., 2014). In the present research, the L-type lectin from P. trituberculatus agglutinated two Gram-positive (M. lysodeik and S. aureus) and four Gram-negative (B. aquimaris, V. alginolyticus, C.indologenes, and A. hydrophila) strains. LPS is a major component on the surface of both Gram-positive and Gram-negative bacteria. The ability of rPtLTL to bind LPS suggests it may participate in immune responses to both Gram-positive and Gram-negative bacterial pathogens. A previous study showed that LTLs play an important role in the sorting and transportation of mature glycoproteins in animal, but their functions in infectious responses are less well documented (Denis et al., 2017). A recent study suggested that LTLs are also involved in pathways of the innate immune system (Zhang et al., 2012). Our findings are consistent with work on MjLTL1 from M. japonicus which is highly expressed in the hepatopancreas and up-regulated following bacterial challenge (Xu et al., 2014). ERGIC-53 of the Chinese mitten crab (E. sinensis) has also been linked directly to the clearance of the virulent bacterium V. parahaemolyticus (Huang et al., 2014). In the present study, expression of PtLTL mRNA was detected in all tested tissues, with highest expression in the hepatopancreas, considered the most crucial immunity-related organ. Expression of PtLTL mRNA in hemocytes was significantly up-regulated at 3 h after challenge, and peaked after 12 h. These results suggest PtLTL functions in the immune response against bacterial stimulation in crustaceans. In conclusion, this study is the first to identify an L-type lectin in the hepatopancreas of P. trituberculatus, and its expression was up-regulated
References Appenzeller-Herzog, C., Roche, A.C., Nufer, O., Hauri, H.P., 2004. PH-induced conversion of the transport Lectin ERGIC-53 triggers glycoprotein release. J.Biol. Chem. 279, 12943–12950. Dai, Y.J., Wang, Y., Zhao, L., Qin, Z., Yuan, J., Qin, Q., Li, L., Lan, J.F., 2016. A novel Ltype lectin was required for the multiplication of WSSV in red swamp crayfish (Procambaru sclakii). Fish Shellfish Immunol. 55, 48–55. Denis, M., Ramasamy, M.S., Thayappan, K., Munusamy, A., 2017. Immune response of anti-lectin Pjlec antibody in freshwater crab Paratelphusa jacquemontii. Int. J. Biol. Macromol. 104, 1212–1222. Fiedler, K., Simons, K., 1996. Characterization of VIP36, an animal lectin homologous to leguminous lectins. J. Cell Sci. 109, 271–276. Hamasaki, K., Fukunaga, K., Kitada, S., 2006. Batch fecundity of the swimming crab Portunus trituberculatus (Brachyura: Portunidae). Aquaculture 253, 359–365. Hauri, H.P., Appenzeller, C., Kuhn, F., Nufer, O., 2000. Lectins and traffic in the secretary pathway. FEBS Lett. 476, 32–37. Herzog, C., Roche, A., Nufer, O., Hauri, H.P., 2004. PH-induced conversion of the transport Lectin ERGIC-53 triggers glycoprotein release. Biol. Chem. 279, 12943–12950. Huang, Y., Tan, J., Wang, Z., Yin, S., Huang, X., Wang, W., Ren, Q., 2014. Cloning and characterization of two different L-type lectin genes from the Chinese mitten crab Eriocheirs inensis. Dev. Comp. Immunol. 46, 255–266. Jiang, K.J., Zhang, D., Zhang, F.Y., Sun, M.M., Qi, L., Zhang, S.F., Qiao, Z.G., Ma, L.B., 2012. Isolation of the C-type lectin like-domain cDNAs from the mud crab Scylla paramamosain and its expression profiles in various tissues, during larval development, and under Vibrio challenge. Crustaceana 85, 817–834. Jin, X.K., Li, S., Guo, X.N., Cheng, L., Wu, M.H., et al., 2013. Two antibacterial C-type lectins from crustacean, Eriocheirs inensis, stimulated cellular encapsulation in vitro. Dev. Comp. Immunol. 41, 544–552. Kamiya, Y., Kamiya, D., Yamamoto, K., Nyfeler, B., Hauri, H.P., Kato, K., 2008. Molecular basis of sugar recognition by the human L-type lectins ERGIC-53, VIPL, and VIP36. J. Biol. Chem. 283, 1857–1861. Kuge, H., Ohkura, S., Seko, T., Yamashita, A., 1999. Vesicular-integralmembrane protein, VIP36, recognizes high-mannose type glycans containingalpha1 → 2 mannosyl residues in MDCK cells. Glycobiology 9, 833–839. Liu, Q., 2007. Identification and phylogenetic analysis of a strain of Vibrio alginolyticus, a pathogen in Portunus trituberculatus with toothpaste disease. Fish. Res. 28, 9–13. Liu, Y., Li, N.Q., Zhao, X.P., Yue, B., He, S.W., Gao, Z.X., Zhou, S., Zhang, M., 2016. A Ctype lectin that inhibits bacterial infection and facilitates viral invasion in black rockfish, Sebastes schlegelii. Fish Shellfish Immunol. 57, 309–317. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lu, J.K., Yu, Z.B., Mu, C.K., Li, R.H., Wang, C.L., 2017. Characterization and functional analysis of a novel C-type lectin from the swimming crab Portunustrituberculatus. Fish Shellfish Immunol. 64, 185–192. Ma, T.H.T., Benzie, J.A.H., He, J.G., Chan, S.M., 2008. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J. Invertebr. Pathol. 99, 332–341. Medzhitov, R., Janeway Jr., C.A., 2002. Decoding the patterns of self and nonself by the innate immune system. Science 296, 298–300. Moussalli, M., Pipe, S.W., Hauri, H.P., Nichols, W.C., Ginsburg, D., Kaufman, R.J., 1999. Mannose-dependent endoplasmic reticulum (ER)-Golgi intermediate compartment53-mediated ER to Golgi trafficking of coagulation factors V and VIII. J. Biol. Chem. 274, 32539–32542. Mu, C.K., Song, X.Y., Zhao, J.M., Wang, L.L., Qiu, L.M., Zhang, H., Zhou, Z., Wang, M.Q., Song, L.S., Wang, C.L., 2012. A scallop C-type lectin from Argopecten irradians (AiCTL5) with activities of lip polysaccharide binding and Gram-negative bacteria agglutination. Fish Shellfish Immunol. 32, 716–723. Neve, E.P., Svensson, K., Fuxe, J., Pettersson, R.F., 2003. VIPL, a VIP36-like membrane protein with a putative function in the export of glycoproteins from the endoplasmic reticulum. Exp. Cell Res. 288, 70–83. Nichols, W.C., Seligsohn, U., Zivelin, A., Terry, V.H., Hertel, C.E., Wheatley, M.A., 1998. Mutations in the ER–golgi intermediate compartment protein ERGIC-53 cause combined deficiency of coagulation factors V and VIII. Cell 93, 61–70.
35
Gene 664 (2018) 27–36
Z. Lu et al.
Biochem. Physiol. B Biochem. Mol. Med. 149, 168–175. Zhang, J., 2007. Disulfide-bond reshuffling in the evolution of an ape placental ribonuclease. Mol. Biol. Evol. 24, 505–512. Zhang, B., 2009. Recent developments in the understanding of the combined deficiency of FV and FVIII. Haematologica 145, 15–23. Zhang, H., Robison, B., Thorgaard, G.H., Ristow, S.S., 2000. Cloning, mapping and genomic organization of a fish C-type lectin gene from homozygous clones of rainbow trout (Oncorhyn chusmykiss). Biochim. Biophys. Acta 1494, 14–22. Zhang, H., Wang, H., Wang, L.L., Song, L.S., Song, X.Y., Zhao, J.M., Li, L., Qiu, L.M., 2009. Cflec-4, a multidomain c-type lectin involved in immune defense of zhikong scallop Chlamys farreri. Dev. Comp. Immunol. 33, 780. Zhang, H., Peatman, E., Liu, H., Feng, T.T., Chen, L.Q., Liu, Z.J., 2012. Molecular characterization of three L-type lectin genes from channel catfish, Ictalurus punctatus and their responses to Edwardsiella ictaluri challenge. Fish Shellfish Immunol. 32, 598–608. Zhu, H.X., Du, J., Hui, K.M., Liu, P., Chen, J., Xiu, Y.J., Yao, W., Wu, T., Meng, Q.G., Gu, W., Ren, Q., Wang, W., 2013. Diversity of lectins in Macrobrachium rosenbergii and their expression patterns under spiroplasma MR-1008 stimulation. Fish Shellfish Immunol. 35, 300–309.
Sarnataro, S., Caporaso, M.G., Bonatti, S., Remondelli, P., 1999. Sequence and expression of the monkey homologue of the ER–golgi intermediate compartment lectin, ERGIC53. Biochim. Biophys. Acta 1447, 334–340. Sharon, N., Lis, H., 2002. How proteins bind carbohydrates: lessons from legume lectins. Agric. Food Chem. 50, 6586–6591. Singh, R.S., Tiwary, A.K., Kennedy, J.F., 1999. Lectins: sources, activities and applications. Crit. Rev. Biotechnol. 19, 145–178. Suttisrisung, S., Senapin, S., Withyachumnarnkul, B., Wongprasert, K., 2011. Identification and characterization of a novel legume-like lectin cDNA sequence from the red marine algae Gracilaria fisheri. J. Biosci. 36, 833–843. Wang, X.W., Wang, J.X., 2013. Diversity and multiple functions of lectins in shrimp immunity. Dev. Comp. Immunol. 39, 27–38. Wang, H., Song, L.S., Li, C.H., Zhao, J.M., Zhang, H., Ni, Duojiao, Xu, Wei, 2007. Cloning and characterization of a novel C-type lectin from Zhikong scallop Chlamys farreri. Mol. Immunol. 44, 722–731. Xu, S., Wang, L., Wang, X.W., Zhao, Y.R., Bi, W.J., Zhao, X.F., Wang, J.X., 2014. L-type lectin from the kuruma shrimp Marsupenaeus japonicus promotes hemocyte phagocytosis. Dev. Comp. Immunol. 44, 397–405. Yamaura, K., Takahashi, K.G., Suzuki, T., 2008. Identification and tissue expression analysis of C-type lectin and galectin in the Pacific oyster, Crassostreagigas. Comp.
36
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Characterisation and functional analysis of an L-type lectin from the swimming crab Portunus trituberculatus
T
⁎
Zhibin Lua,b, Zhiming Rena, Changkao Mua, , Ronghua Lia, Yangfang Yea, Weiwei Songa, Ce Shia, ⁎ Lei Liua, Chunlin Wanga, a b
Key Laboratory of Applied Marine Biotechnology, Ministry of Education, Ningbo University, Ningbo 315211, China Collaborative Innovation Center for Zhejiang Marine High-efficiency and Healthy Aquaculture, Ningbo University, Ningbo 315211, China
A R T I C LE I N FO
A B S T R A C T
Keywords: L-type lectin Glycoprotein secretion Portunus trituberculatus Carbohydrate recognition domain Protein expression Immune response
L-type lectins are involved in glycoprotein secretion and are associated with immune responses. Herein, an Ltype lectin was identified in swimming crab (Portunus trituberculatus). The 1347 bp PtLTL cDNA includes a 26 bp 5′-untranslated region (UTR), a 547 bp 3′-UTR with a poly(A) tail, and a 774 bp open reading frame encoding a 257 amino acid protein with a putative 21 residue signalling peptide. The protein includes an L-type lectin carbohydrate recognition domain containing four conserved cysteines. The 714 bp cDNA fragment encoding the mature peptide of PtLTL1 was recombined into pET-21a (+) with a C-terminally hexa-histidine tag fused inframe and expressed in Escherichia coli Origami (DE3). Recombinant PtLTL1 caused agglutination of all three Gram-positive and Gram-negative bacterial strains tested. In addition, erythrocyte agglutination and LPSbinding activity were observed. PtLTL1 mRNA transcripts were most abundant in P. trituberculatus hepatopancreas and hemocytes, and expression was up-regulated in hemocytes challenged with Vibrio alginolyticus, suggesting PtLTL functions in the immune response against bacterial pathogens.
1. Introduction Innate immunity, including humoral and cellular immunity, is the first and most important line of defence against microbial infections (Wang et al., 2007). It is especially important in invertebrates because they lack true adaptive immunity and depend entirely on innate immune responses. Lectins are an important class of pattern recognition receptor (PRR) that recognise specific sugar conjugates and promote bacteria agglutination by binding sugars on the bacterial surface (Yamaura et al., 2008). Apart from pathogen recognition, lectins function in others biological processes, such as cell-cell interactions, protein synthesis and transport, and signal transduction (Zhang et al., 2000). Based on structure and function, crustacean lectins can be classified into seven lectin families: C-type, L-type, P-type, M-type, fibrinogen-like domain lectins, galectins, and calnexin/calreticulin (Wang and Wang, 2013). Many types of lectins have been identified and reported in different species of crustacean, especially C-type lectins (Ma et al., 2008; Jiang et al., 2012; Lu et al., 2017), but reports on L-lectins are scarce.
Lectins are a group of molecules which are highly specific for the binding of carbohydrate. It was firstly discovered in leguminous plants, which contain a luminal carbohydrate recognition domain (CRD), also known as an LTL domain (LTLD), therefore it was named legume lectin (L-type lectin) (Zhu et al., 2013). To date, > 70 LTLs have been identified and isolated from various sources including bacteria, algae, plants, fungi, body fluid of invertebrates, lower vertebrates and mammalian (Singh et al., 1999). They differ in their carbohydrate specificities, but resemble one another in their physicochemical properties and structures (Appenzeller-Herzog et al., 2004). L-type lectins have different intracellular distributions and dynamics in the endoplasmic reticulum (ER)-Golgi system of the secretary pathway (Hauri et al., 2000., Moussalli et al., 1999). Recent studies showed there were only two kind of L-type lectin identified in invertebrates, endoplasmic reticulum Golgi intermediate compartment-53 (ERGIC-53) and 36 kDa vesicular integral membrane protein (VIP36) (Sarnataro et al., 1999; Fiedler and Simons, 1996; Zhang et al., 2012). ERGIC-53 is a mannose-specific membrane lectin operating as a cargo receptor for the transport of glycoproteins from the ER to the
Abbreviations: LTL, L-type lectin; PRR, pattern recognition receptor; CRD, carbohydrate recognition domain; RACE, rapid-amplification of cDNA ends; EST, expressed sequence tag; ORF, open reading frame; ERGIC-53, reticulum Golgi intermediate compartment-53; VIP36, 36 kDa vesicular integral membrane protein; qRT-PCR, quantitative real-time PCR; FITC, fluorescein isothiocyanate isomer I; LPS, lipopolysaccharide ⁎ Corresponding author at: Ningbo University, 818 Fenghua Rd., Ningbo 315211, China. E-mail addresses: [email protected] (C. Mu), [email protected] (C. Wang). https://doi.org/10.1016/j.gene.2018.04.041 Received 27 January 2018; Received in revised form 26 March 2018; Accepted 16 April 2018 Available online 22 April 2018 0378-1119/ © 2018 Published by Elsevier B.V.
Gene 664 (2018) 27–36
Z. Lu et al.
Table 1 Oligonucleotide primers used in this study. Primer
Sequence(5′-3′)
Sequence information
P1 P 2 (forward) P 3 (reverse) P 4 (forward) P 5 (reverse) P 6 (forward) P 7 (reverse) RV-M (forward) M13-47 (reverse)
GACTTTCTTGGGTCCACGAT CACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGC CCGAAAGGAAGCTGAGTTGGCTGCTGCCA TGTGATTGCTGTAGGTGT CCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATA CGAAACCTTCAACACTCCCG GATAGCGTGAGGAAGGGCATA CGCCAGGGTTTTCCCAGTCACGAC GACTAACAGGAGACATTCAG
Specific primer (for RACE) Recombinant primer (for expression) Recombinant primer (for expression) Specific primer (for Real-time PCR) Specific primer (for Real-time PCR) β-actin primer (for Real-time PCR) β-actin primer (for Real-time PCR) Vector primer (for sequencing) Vector primer (for sequencing)
ERGIC. ERGIC-53 may affect β-integrin traffic, since an ERGIC-53 mutant caused β-integrin-related developmental defects in Drosophila (Kamiya et al., 2008). VIP36 is a type I integral membrane glycoprotein, which was earliest isolated from Madin-Darby canine kidney cells as a component of detergent-insoluble, glycolipid-enriched complexes containing apical marker proteins (Hauri et al., 2000). VIP36 was located in the Golgi and transfers between Golgi and endoplasmic reticulum (ER) (Nichols et al., 1998; Neve et al., 2003; Zhang, 2009). VIP36 has lectin activity and recognises high mannose-type glycans that contain more than seven mannose residues, but its efficient binding requires the additional presence of an a-substituted asparagine residue (Hauri et al., 2000; Kuge et al., 1999). ERGIC-53 binds glycoproteins in a Ca2+- and pH-dependent manner, but the Ca2+ requirement for sugar binding of VIP36 to high mannose-type glycans remains controversial (Zhang, 2009; Herzog et al., 2004). Thus, ERGIC-53 and VIP36 share similar L-type lectin domains and mannose-binding selectivity, but have distinct functions within the early secretary pathway. Recently, A number of LTLs have been isolated from decapod crustaceans, all of which are involved in various aspects of the immune response (Xu et al., 2014; Huang et al., 2014). The swimming crab, Portunus trituberculatus, is among the most important marine species in Japan, Korea, and China (Hamasaki et al., 2006). With the advancement of artificial breeding techniques, the P. trituberculatus aquaculture industry has expanded rapidly, but mortality problems have emerged, such as toothpaste disease caused by Vibrio alginolyticus infection (Liu, 2007). As invertebrates that lack adaptive immunity, crustaceans rely exclusively on the innate immune system to recognise potential pathogens and subsequently clear invading microorganisms (Medzhitov and Janeway, 2002). A better understanding of the immune defence mechanisms of P. trituberculatus is essential to help control diseases and maintain crab aquaculture. In the present study, an LTL was identified in P. trituberculatus, and its structural features, bacterial agglutination, haemagglutination, LPS-binding, tissue distribution, and temporal expression following V. alginolyticus challenge were investigated to investigate its functions in the immune responses.
2.2. Sample collection, RNA extraction, and cDNA synthesis Five healthy crabs were isolated for examination of PtLTL expression in hepatopancreas, muscle, hemocytes, and gills. All tissue samples were immediately snap-frozen in liquid nitrogen and stored at −80 °C for RNA isolation and subsequent analyses. All serum samples were centrifuged at 3000g for 10 min at 4 °C and stored at −80 °C for serum immune index analysis. Total RNA was extracted from tissues using Trizol Reagent (Invitrogen, USA), spectrophotometrically quantified, and electrophoresed on a 1% denaturing agarose gel to confirm integrity. For each reverse transcription (RT) reaction, 3 mg of total RNA was subjected to cDNA synthesis using a SMARTer RACE cDNA Amplification Kit (Clontech, USA) in a 20 μL volume according to the manufacturer's instructions. The 3′ CDS-Primer was used as a 3′RACE RT Primer to introduce an adaptor, and the 5′CDS-Primer and SMARTer Oligo were used to synthesise the 5′ ends of the full-length gene (Clontech, USA). All primers were synthesised by the Beijing Genomics Institute (Shanghai, China). 2.3. Cloning of PtLTL PCR amplification of PtLTL was conducted using an Eppendorf Mastercycler gradient instrument (Eppendorf, Germany) with degenerate primers P1 and UPM (Clontech, USA) (Table 1). All reactions were performed in a 25 μL volume containing 10.5 μL PCR-grade water, 8 μL 10× PCR buffer, 2.5 μL UPM, 2 μL dNTPs (2.5 mM), 0.5 μL polymerase (5 U mL−1), 0.5 μL primer03 (10 mM), and 1 μL cDNA mix (Clontech, USA). The program was carried out as follows; five cycles at 94 °C for 30 s, then 72 °C for 3 min; five cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 3 min; 20 cycles at 94 °C 30 s, 68 °C for 30 s, and 72 °C for 3 min. PCR products were subjected to electrophoresis on a 1.5% agarose gel and purified prior to cloning into the pMD-18T vector (Takara, Japan). After transformation of competent E. coli DH5a cells, positive recombinants were identified using anti-Amp selection and confirmed by PCR. Positive clones were sequenced in both directions with primers RV-M and M13-47 (Table 1), and the resulting sequences were verified and subjected to cluster analysis using NCBI databases.
2. Materials and methods 2.1. Immune challenge
2.4. Sequence and phylogenetic analyses
To investigate the immunity-related functions of PtLTL, V. alginolyticus was used as an immune stimulant in time course experiments. Sixty healthy swimming crabs (initial body weight of 100 ± 10 g) were collected from a commercial farm in Yinzhou, China, and intraperitoneally injected with 1.0 mL of V. alginolyticus (106 CFU mL−1) suspended in phosphate buffered saline (PBS; pH 7.0; 1 mL per animal) into the arthrodial membrane of the last walking leg. Sixty healthy swimming crabs were also injected with the same amount of PBS and kept separately as a control group. Injected crabs were returned to the water and 6 individuals were sampled from challenge and control groups at 0, 3, 6, 12, 24 and 48 h.
The cDNA sequence and deduced amino acid sequence of PtLTL were analysed using the BLAST algorithm (http://www.ncbi.nlm.nih. gov/blast) and the Expert Protein Analysis System (http://www.expasy. org/). The signal peptide was predicted with the SignalP 4.1 server (http://www.cbs.dtu.dk/service/SignalP). Protein domains were revealed by the PROSITE program (http://www.kr.expasy.org/prosite/) and SMART version 4.0 (http://www.smart.emblheidelberg.de/). In addition, the ProtParam program (http://www.expasy.ch/tools/ protparam.html) was used to compute physical and chemical parameters of the deduced amino acid sequence. The ClustalW program was used to perform multiple sequence alignment, and an unrooted phylogenetic tree was constructed based on the sequence alignment using the 28
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 1. Nucleotide and deduced amino acid sequence of PtLTL from P. trituberculatus. The predicted signal peptide is subscripted to the dotted line. The revelation codon (ATG) and the stop codon (TGA) are marked with double underline. The LTLD domain is underlined. The lamG domain is shaded with gray. The carbohydratebinding sites and carbohydrate-binging region are enclosed.
with primers P3 and P4 and confirmed by DNA sequencing. The parent vector without the inserted fragment was used as the negative control. After DNA sequencing to confirm in-frame gene insertion, positive transformants and the negative control were incubated respectively in LB medium (containing 50 mg mL−1 ampicillin and 1% glucose) at 37 °C with shaking at 220 rpm. When the culture reached an absorbance at 600 nm (OD600) of 0.5–0.7, IPTG was added to a final concentration of 1 mM and incubation was continued for an additional 4 h under the same conditions. Cells were harvested by centrifugation at 8000g for 2 min and resuspended in 50 mM PBS containing 8 M urea and 0.5 mM NaCl (pH 7.4). After sonication at 4 °C for 60 s the recombinant PtLTL1 protein (rPtLTL) and the negative control sample were subjected to purification using Ni-agarose resin (CoWinBiosciences, China) according to the manufacturer's instructions (Zhang, 2007). The purified protein was refolded by sequential dialysis in buffers containing 6, 4, 2, 1, and 0 M urea (pH 7.0) as well as 50 mM Tris-HCl, 50 mM NaCl, 10%
neighbor joining (NJ) algorithm in Mega 5.0 (Livak and Schmittgen, 2001). The reliability of the branching was tested by bootstrap resampling (5000 pseudo-replicates). 2.5. Expression and purification of recombinant PtLTL Gene-specific primers P2 (containing an N-terminal hexahistidine tag) and P3 (Table 1) were designed to amplify a PCR fragment encoding the mature peptide. In order to facilitate cloning, an NdeI site was added to the 5′ end of P2, and an XhoI site was added to the 3′ end of P3 after the stop codon. PCR products were cloned into the pMD18-T vector (Takara, Japan), digested completely with NdeI and XhoI (NEB, China), and subcloned into the NdeI and XhoI sites of the pET-21a(t) expression vector (Novagen, China). The resulting recombinant plasmid pET-21a(t)-PtLTL1 was transformed into competent E. coli Origami (DE3) cells (Novagen, China), and positive clones were screened by PCR 29
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 2. Multiple sequence alignment of CRD in PtLTL and other LTLs. The conserved amino acid residues are shaded with black. The sequences are as follows: M.japonicus JQ804833, A.aegypti XM001654620, A.gambiae XM313693, C.elegans NM075750, D.melanogaster NM142967, H.sapiens AY358929, P.clarkii HQ414545, X.tropicalis NM001078728, E.sinensis KM433865, C.aethiops AF160877, H.sapiens AK312869, R.norvegicus NM053886, D.rerio BC091860, H.sapiens AY358929, X.tropicalis NM001247993, A.gambiae XM315413, A.aegypti DQ440341, C.briggsae XM002639129.
30
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 3. Phylogenetic tree based on CRDs from PtLTL and other invertebrate LTLs. The tree is constructed by the neighbor-joining (NJ) algorithm using the Mega 5.1 program. Bootstrap trails are replicated 1000 times to derive the confidence value. The protein sequence used for phylogenetic analysis are as follows: M.japonicus JQ804833, A.aegypti XM001654620, A.gambiae XM313693, C.elegans NM075750, D.melanogaster NM142967, H.sapiens AY358929, P.clarkii HQ414545, X.tropicalis NM001078728, E.sinensis KM433865, C.aethiops AF160877, H.sapiens AK312869, R.norvegicus NM053886, D.rerio BC091860, X.tropicalis NM001247993, A.gambiae XM315413, A.aegypti DQ440341, C.briggsae XM002639129.
2007). Briefly, erythrocytes derived from rabbits were washed three times with TBS-Ca buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM CaCl2, pH 7.5), trypsinised, and resuspended in 2% TBS-Ca buffer. A 25 μL volume of two-fold serially diluted rPtLTL in TBS-Ca buffer was mixed with 25 μL of erythrocyte suspension in a 96-well microtitre plate. EDTA at a final concentration of 10 mM was added to wells containing rPtLTL to determine whether agglutination was calciumdependent, and 25 μL of TBS-Ca buffer without rPtLTL was also used as a blank control. The plate was incubated for 1 h at room temperature before the extent of haemagglutination was observed under a light microscope (Nikon, Japan). Gram-positive bacterial strains Bacillus aquimaris, Micrococcus lysodeik, Staphylococcus aureus and Gram-negative bacterial strains Aeromonas hydrophila, Vibrio alginolyticus, Chryseobacterium indologenesis were tested in the rPtLTL agglutination assay previously described (Liu et al., 2016). After staining with fluorescein isothiocyanate (FITC), bacteria were incubated with 20 μL of rPtLTL (final concentration = 99.67 μg mL−1) or 20 μL of dialysis buffer at room temperature for 45 min, and cells were observed by fluorescence microscopy (Nikon, Japan).
2.7. LPS-binding assay The wells of a flat-bottomed 96-well assay plate were coated with LPS derived from E. coli (Sigma, L2630) as described previously (Zhang et al., 2009). A 50 μL volume of rPtLTL in TRIS buffer (TB; 50 mM TRISHCl, 50 mM NaCl, pH 8.0) containing 5 mM CaCl2 and 0.1 mg mL−1 of different concentrations of BSA were added to each well. Wells containing 50 μL TB buffer were used as blank controls, and wells with 50 μL TB buffer containing 5 mM CaCl2 and 0.1 mg mL−1 BSA were used as negative controls. The results were expressed using the ELISA index (EI) according to the following formula: EI/OD sample/cut-off, where the cut-off was established as the mean OD value of three negative controls plus three standard deviations (S.D.). Samples with an EI > 1.0 were considered positive.
Fig. 4. SDS-PAGE analysis of rPtLTL. Lane 1: protein molecular standard; lane 2: purified rPtLTL; lane 3: expression of rPtLTL1 after IPTG induction; lane 4: uninduced control without IPTG induction.
glycerol, 1% glycine, 1 mM EDTA, 0.2 mM oxidised glutathione, and 2 mM reduced glutathione (Mu et al., 2012). Purified proteins were verified by 15% SDS-PAGE, and the concentration was determined using a Total Protein Quantitative Assay Kit (Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer's protocol. 2.6. Haemagglutination and bacterial agglutination assay This procedure was performed as described previously (Zhang, 31
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 5. Bacterial aggregation induced by rPtLTL. The magnification is 100 ×. A, B: Bacillus aquimaris; C, D: Micrococcus lysodeik; E, F: Staphylococcus aureus; G, H: Aeromonas hydrophila; I, J: Vibrio alginolyticus; K, L: Chryseobacterium indologenes; A, C, E, G, I, K: no protein is contained; B, D, F, J, L: 99.67 μg ml−1 rPtLTL recombinant protein is contained.
3. Results
2.8. Quantification of PtLTL transcripts by quantitative real-time PCR and statistical analysis
3.1. Molecular characterisation of PtLTL Quantitative real-time PCR was applied to evaluate the transcription of PtLTL in different tissues of healthy and infected crabs and fish. A pair of gene-specific primers (P4 and P5) was designed for the quantitative analysis. The β-actin housekeeping gene P6 and P7 were used as an internal reference for normalising experimental data (Table 1). Firststrand cDNA was synthesised, and for each quantitative real-time PCR, 1 μL of the resultant dilution was added as template in final volume of 25 μL. Reactions were carried out on a quantitative thermal cycler using SYBR green I as a fluorescent dye. Quantitative real-time PCR was performed as follows: 95 °C for 2 min, followed by 35 cycles of 95 °C for 5 s, 60 °C for 15 s, and 72 °C for 20 s. Fluorescent data were acquired during each annealing phase. To verify that the primer pair produced only a single product, the melting curve of the product was determined by heating from 59 °C to 90 °C at the end of the reaction. During detection, all samples were analysed in triplicate, and reactions without cDNA were included as negative controls. Finally, Ct values obtained from qPCR were converted into relative expression levels using the 2−ΔΔCT method (Livak and Schmittgen, 2001), and values represent n-fold differences relative to the calibrator. Statistical analysis was performed using IBM SPSS statistics 22 software. All data are the mean relative mRNA expression ± S.E. Statistical significance was determined by one-way ANOVA and posthoc Duncan multiple range tests, and P < 0.05 was considered significant.
In the present study, a novel LTL (PtLTL) was cloned and characterised from swimming crab P. trituberculatus following an expressed sequence tag (EST) search and rapid amplification of cDNA ends (RACE) experimental approach. Sequence data have been deposited in GenBank under accession number MG515241. The complete nucleotide sequence of the 1347 bp PtLTL cDNA contains a 774 bp ORF, a 26 bp 5′untranslated region (UTR), a 547 bp 3′-UTR with a poly (A) tail (Fig. 1), encoding a deduced protein of 257 amino acids (with a signal peptide at the N-terminus) with a predicted molecular weight of 28.97 kDa and a predicted isoelectric point of 5.88. The LTLD and LamG domains include three carbohydrate-binding sites with the same apparent specificity, and two carbohydrate-binding regions were also identified (Fig. 1). Analysis revealed that PtLTL, EsVIP-36, MjLTL, and PcLTL from different species are highly evolutionarily conserved, with almost identical amino acid sequences (Fig. 2). BLASTP searches of the nonredundant protein database in GeneBank showed that PtLTL shares highest sequence identity (85%) with EsVIP36 (Eriocheir sinensis, KM433865.1). To probe the evolutionary relationships of PtLTL, sequences of LTLs from fish, mammals, and invertebrates were used to construct a phylogenetic tree (Fig. 3). The results showed that PtLTL shares high identity with lectins from E.sinensis (KM433865.1), Procambarus clarkii (HQ414545.1), and Marsupenaeus japonicus (JQ804833). These results showed that PtLTL was clustered into the VIP36 family.
32
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 6. Agglutination activity of rPtLTL to rabbit erythrocytes (40×). A: no protein is contained. B: 99.67 μg ml−1 protein and 10 mmol L−1 EDTA are contained. C: 99.67 μg mL−1 protein is contained. D: 49.83 μg mL−1 protein is contained. E:24.92 μg mL−1 protein is contained. F: 12.46 μg mL−1 protein.
Fig. 7. Binding activity toward LPS of PtLTL.
The recombinant plasmid pET-21a (+)-PtLTL was transformed into E. coli Origami (DE3) as described above. Following IPTG induction, one major protein with an apparent molecular weight of 25.9 kDa was detected in the positive transformant (Fig. 4), which could be further purified to homogeneity by Ni-NTA Sepharose column. The concentration of the rPtLTL protein was 99.67 mg mL−1.
induced by rPtLTL. In the presence of Ca2+, rPtLTL (99.67 μg mL−1) was found to significantly agglutinate all six tested bacteria, including three Gram-positive bacterial strains and three Gram-negative bacterial strains. No obvious agglutination was observed in the control group (Fig. 5). When rabbit erythrocytes were incubated with 99.67 μg mL−1 rPtLTL, agglutination was observed. However, no agglutination was observed when EDTA was added, or when the rPtLTL solution was diluted by more than eight-fold (Fig. 6).
3.3. Bacterial agglutination and haemagglutination activity of rPtLTL
3.4. LPS-binding activity of rPtLTL
3.2. Expression, purification, and characterisation of PtLTL
The LPS-binding activity of rPtLTL was examined using an enzyme-
Six FITC-stained bacterial strains were used to test the agglutination 33
Gene 664 (2018) 27–36
Z. Lu et al.
Fig. 8. Tissue distribution of the PtLTL transcription detected by quantitative real-time PCR. Each bar represents the mean ± S.E. (n = 5). Different letters represent significant differences (P < 0.05). Fig. 9. PtLTL transcription in the hemocytes after Vibrio alginolyticus challenge. The mRNA expression of PtLTL (relative to β-actin) in the hemocytes in response to V. alginolyticus (black bars) or saline control (white bars) at 0, 3, 6, 12, 24 and 48 h postinjection was determined by quantitative real-time PCR. Data are represented as means ± S.E. (n = 5). Different letters represent significant differences (P < 0.05).
3.5. Expression of PtLTL in different tissues and following V. alginolyticus challenge
linked immunosorbent assay (ELISA). After incubating the samples and washing, the amount of bound rPtLTL was detected using a mouse antiHis antibody. PtLTL displayed high binding affinity toward LPS with a dose-dependent manner (Fig. 7). The ELISA index with different concentrations of rPtLTL was higher than 1.0, hence the samples were considered positive. For negative control, no apparent binding capacities were identified (Fig. 7).
The results of RT-PCR showed that PtLTL mRNA expression was detected in all tissues (hemocytes, gill, hepatopancreas and muscle) obtained from healthy crabs prior to any treatment (Fig. 8). The highest expression level was observed in the hepatopancreas, which was sevenfold (P < 0.01) higher than that in hemocytes, while the lowest expression was observed in gill and muscle. Expression of PtLTL in 34
Gene 664 (2018) 27–36
Z. Lu et al.
by exposure to V. alginolyticus. Recombinant PtLTL binds to LPS, and causes agglutination of both Gram-positive and Gram-negative bacteria, and facilitated the clearance of V. alginolyticus. These results suggest PtLTL may be involved in the innate immunity of crabs.
hemocytes was observed in response to exposure to V. alginolyticus, which is a serious pathogen of this crab species (Liu, 2007). Quantitative real-time PCR was carried to investigate the function of PtLTL in anti-bacterial innate immunity. The mRNA expression of PtLTL in hemocytes following V. alginolyticus challenge is presented in Fig. 9. PtLTL was rapidly up-regulated following bacterial exposure, and peaked within 12 h, then decreased from 12 to 48 h, gradually recovering to normal levels at 48 h post-infection. In addition, PtLTL transcripts in hemocytes did not change significantly after exposure to PBS alone between 3 h and 48 h.
Acknowledgements The authors are grateful to all the members of the lab, thanks to their technical advice and helpful discussion. This work was supported by the National Natural Science Foundation of China (41476124), Major Agriculture Program of Ningbo (2017C110007), China Agriculture Research System (CARS-48), Natural Science Foundation of Ningbo (2015A610260), and the K C Wong Magana Fund in Ningbo University.
4. Discussion In the present study, PtLTL from the Swimming crab P. trituberculatus was identified, cloned, and characterised using EST search and RACE techniques. The complete 1347 bp nucleotide sequence of PtLTL contains a 774 bp ORF encoding a deduced protein of 257 amino acids (including a 21 amino acid signal peptide and L-lectin super family domains) with a predicted molecular weight of 28.97 kDa (Fig. 1). The results revealed the presence of three carbohydrate-binding sites with the same specificity and two carbohydrate-binding regions (Fig. 1), consistent with previous reports that most L-lectins consist of two or four subunits, each with a single, small carbohydrate-binding site with the same specificity (Sharon and Lis, 2002; Suttisrisung et al., 2011). Each 200–300 amino acid subunit is 25–30 kDa (Sharon and Lis, 2002). The deduced PtLTL protein includes a putative signal peptide of 21 residues at the N-terminus, and an LTLD of 224 amino acids at the Cterminus, similar to other known L-type lectins. Comparison with four other L-type lectins showed that PtLTL shares similar domains with MjLTL, PcLTL, and EsVIP36 from crustaceans (Xu et al., 2014; Huang et al., 2014; Dai et al., 2016). Aggregation activity is the most important feature of lectins, and PtLTL clearly caused agglutination of both Gram-positive and Gramnegative bacteria in the absence of calcium in the present study. Agglutination activity has also been reported for a low-density lipoprotein receptor class A domain-containing C-type lectin (EsCTLD), specifically for its CTLD domain (Huang et al., 2014), as well as two novel single-CRD-containing C-type lectins EsLecA and EsLecG (Jin et al., 2013). Furthermore, VIP36 has the ability to bind LPS as well as Gram-positive (S. aureus, B. thuringiensis, and B. subtilis) and G-negative (E. coli, V. natriegens, V. parahaemolyticus, and A. hydrophila) bacteria (Huang et al., 2014). In the present research, the L-type lectin from P. trituberculatus agglutinated two Gram-positive (M. lysodeik and S. aureus) and four Gram-negative (B. aquimaris, V. alginolyticus, C.indologenes, and A. hydrophila) strains. LPS is a major component on the surface of both Gram-positive and Gram-negative bacteria. The ability of rPtLTL to bind LPS suggests it may participate in immune responses to both Gram-positive and Gram-negative bacterial pathogens. A previous study showed that LTLs play an important role in the sorting and transportation of mature glycoproteins in animal, but their functions in infectious responses are less well documented (Denis et al., 2017). A recent study suggested that LTLs are also involved in pathways of the innate immune system (Zhang et al., 2012). Our findings are consistent with work on MjLTL1 from M. japonicus which is highly expressed in the hepatopancreas and up-regulated following bacterial challenge (Xu et al., 2014). ERGIC-53 of the Chinese mitten crab (E. sinensis) has also been linked directly to the clearance of the virulent bacterium V. parahaemolyticus (Huang et al., 2014). In the present study, expression of PtLTL mRNA was detected in all tested tissues, with highest expression in the hepatopancreas, considered the most crucial immunity-related organ. Expression of PtLTL mRNA in hemocytes was significantly up-regulated at 3 h after challenge, and peaked after 12 h. These results suggest PtLTL functions in the immune response against bacterial stimulation in crustaceans. In conclusion, this study is the first to identify an L-type lectin in the hepatopancreas of P. trituberculatus, and its expression was up-regulated
References Appenzeller-Herzog, C., Roche, A.C., Nufer, O., Hauri, H.P., 2004. PH-induced conversion of the transport Lectin ERGIC-53 triggers glycoprotein release. J.Biol. Chem. 279, 12943–12950. Dai, Y.J., Wang, Y., Zhao, L., Qin, Z., Yuan, J., Qin, Q., Li, L., Lan, J.F., 2016. A novel Ltype lectin was required for the multiplication of WSSV in red swamp crayfish (Procambaru sclakii). Fish Shellfish Immunol. 55, 48–55. Denis, M., Ramasamy, M.S., Thayappan, K., Munusamy, A., 2017. Immune response of anti-lectin Pjlec antibody in freshwater crab Paratelphusa jacquemontii. Int. J. Biol. Macromol. 104, 1212–1222. Fiedler, K., Simons, K., 1996. Characterization of VIP36, an animal lectin homologous to leguminous lectins. J. Cell Sci. 109, 271–276. Hamasaki, K., Fukunaga, K., Kitada, S., 2006. Batch fecundity of the swimming crab Portunus trituberculatus (Brachyura: Portunidae). Aquaculture 253, 359–365. Hauri, H.P., Appenzeller, C., Kuhn, F., Nufer, O., 2000. Lectins and traffic in the secretary pathway. FEBS Lett. 476, 32–37. Herzog, C., Roche, A., Nufer, O., Hauri, H.P., 2004. PH-induced conversion of the transport Lectin ERGIC-53 triggers glycoprotein release. Biol. Chem. 279, 12943–12950. Huang, Y., Tan, J., Wang, Z., Yin, S., Huang, X., Wang, W., Ren, Q., 2014. Cloning and characterization of two different L-type lectin genes from the Chinese mitten crab Eriocheirs inensis. Dev. Comp. Immunol. 46, 255–266. Jiang, K.J., Zhang, D., Zhang, F.Y., Sun, M.M., Qi, L., Zhang, S.F., Qiao, Z.G., Ma, L.B., 2012. Isolation of the C-type lectin like-domain cDNAs from the mud crab Scylla paramamosain and its expression profiles in various tissues, during larval development, and under Vibrio challenge. Crustaceana 85, 817–834. Jin, X.K., Li, S., Guo, X.N., Cheng, L., Wu, M.H., et al., 2013. Two antibacterial C-type lectins from crustacean, Eriocheirs inensis, stimulated cellular encapsulation in vitro. Dev. Comp. Immunol. 41, 544–552. Kamiya, Y., Kamiya, D., Yamamoto, K., Nyfeler, B., Hauri, H.P., Kato, K., 2008. Molecular basis of sugar recognition by the human L-type lectins ERGIC-53, VIPL, and VIP36. J. Biol. Chem. 283, 1857–1861. Kuge, H., Ohkura, S., Seko, T., Yamashita, A., 1999. Vesicular-integralmembrane protein, VIP36, recognizes high-mannose type glycans containingalpha1 → 2 mannosyl residues in MDCK cells. Glycobiology 9, 833–839. Liu, Q., 2007. Identification and phylogenetic analysis of a strain of Vibrio alginolyticus, a pathogen in Portunus trituberculatus with toothpaste disease. Fish. Res. 28, 9–13. Liu, Y., Li, N.Q., Zhao, X.P., Yue, B., He, S.W., Gao, Z.X., Zhou, S., Zhang, M., 2016. A Ctype lectin that inhibits bacterial infection and facilitates viral invasion in black rockfish, Sebastes schlegelii. Fish Shellfish Immunol. 57, 309–317. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lu, J.K., Yu, Z.B., Mu, C.K., Li, R.H., Wang, C.L., 2017. Characterization and functional analysis of a novel C-type lectin from the swimming crab Portunustrituberculatus. Fish Shellfish Immunol. 64, 185–192. Ma, T.H.T., Benzie, J.A.H., He, J.G., Chan, S.M., 2008. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J. Invertebr. Pathol. 99, 332–341. Medzhitov, R., Janeway Jr., C.A., 2002. Decoding the patterns of self and nonself by the innate immune system. Science 296, 298–300. Moussalli, M., Pipe, S.W., Hauri, H.P., Nichols, W.C., Ginsburg, D., Kaufman, R.J., 1999. Mannose-dependent endoplasmic reticulum (ER)-Golgi intermediate compartment53-mediated ER to Golgi trafficking of coagulation factors V and VIII. J. Biol. Chem. 274, 32539–32542. Mu, C.K., Song, X.Y., Zhao, J.M., Wang, L.L., Qiu, L.M., Zhang, H., Zhou, Z., Wang, M.Q., Song, L.S., Wang, C.L., 2012. A scallop C-type lectin from Argopecten irradians (AiCTL5) with activities of lip polysaccharide binding and Gram-negative bacteria agglutination. Fish Shellfish Immunol. 32, 716–723. Neve, E.P., Svensson, K., Fuxe, J., Pettersson, R.F., 2003. VIPL, a VIP36-like membrane protein with a putative function in the export of glycoproteins from the endoplasmic reticulum. Exp. Cell Res. 288, 70–83. Nichols, W.C., Seligsohn, U., Zivelin, A., Terry, V.H., Hertel, C.E., Wheatley, M.A., 1998. Mutations in the ER–golgi intermediate compartment protein ERGIC-53 cause combined deficiency of coagulation factors V and VIII. Cell 93, 61–70.
35
Gene 664 (2018) 27–36
Z. Lu et al.
Biochem. Physiol. B Biochem. Mol. Med. 149, 168–175. Zhang, J., 2007. Disulfide-bond reshuffling in the evolution of an ape placental ribonuclease. Mol. Biol. Evol. 24, 505–512. Zhang, B., 2009. Recent developments in the understanding of the combined deficiency of FV and FVIII. Haematologica 145, 15–23. Zhang, H., Robison, B., Thorgaard, G.H., Ristow, S.S., 2000. Cloning, mapping and genomic organization of a fish C-type lectin gene from homozygous clones of rainbow trout (Oncorhyn chusmykiss). Biochim. Biophys. Acta 1494, 14–22. Zhang, H., Wang, H., Wang, L.L., Song, L.S., Song, X.Y., Zhao, J.M., Li, L., Qiu, L.M., 2009. Cflec-4, a multidomain c-type lectin involved in immune defense of zhikong scallop Chlamys farreri. Dev. Comp. Immunol. 33, 780. Zhang, H., Peatman, E., Liu, H., Feng, T.T., Chen, L.Q., Liu, Z.J., 2012. Molecular characterization of three L-type lectin genes from channel catfish, Ictalurus punctatus and their responses to Edwardsiella ictaluri challenge. Fish Shellfish Immunol. 32, 598–608. Zhu, H.X., Du, J., Hui, K.M., Liu, P., Chen, J., Xiu, Y.J., Yao, W., Wu, T., Meng, Q.G., Gu, W., Ren, Q., Wang, W., 2013. Diversity of lectins in Macrobrachium rosenbergii and their expression patterns under spiroplasma MR-1008 stimulation. Fish Shellfish Immunol. 35, 300–309.
Sarnataro, S., Caporaso, M.G., Bonatti, S., Remondelli, P., 1999. Sequence and expression of the monkey homologue of the ER–golgi intermediate compartment lectin, ERGIC53. Biochim. Biophys. Acta 1447, 334–340. Sharon, N., Lis, H., 2002. How proteins bind carbohydrates: lessons from legume lectins. Agric. Food Chem. 50, 6586–6591. Singh, R.S., Tiwary, A.K., Kennedy, J.F., 1999. Lectins: sources, activities and applications. Crit. Rev. Biotechnol. 19, 145–178. Suttisrisung, S., Senapin, S., Withyachumnarnkul, B., Wongprasert, K., 2011. Identification and characterization of a novel legume-like lectin cDNA sequence from the red marine algae Gracilaria fisheri. J. Biosci. 36, 833–843. Wang, X.W., Wang, J.X., 2013. Diversity and multiple functions of lectins in shrimp immunity. Dev. Comp. Immunol. 39, 27–38. Wang, H., Song, L.S., Li, C.H., Zhao, J.M., Zhang, H., Ni, Duojiao, Xu, Wei, 2007. Cloning and characterization of a novel C-type lectin from Zhikong scallop Chlamys farreri. Mol. Immunol. 44, 722–731. Xu, S., Wang, L., Wang, X.W., Zhao, Y.R., Bi, W.J., Zhao, X.F., Wang, J.X., 2014. L-type lectin from the kuruma shrimp Marsupenaeus japonicus promotes hemocyte phagocytosis. Dev. Comp. Immunol. 44, 397–405. Yamaura, K., Takahashi, K.G., Suzuki, T., 2008. Identification and tissue expression analysis of C-type lectin and galectin in the Pacific oyster, Crassostreagigas. Comp.
36