- Email: [email protected]
Transcription, expression and tissue binding in vivo of INGAP and INGAP-related peptide in normal hamsters
Regulatory Peptides 140 (2007) 192 – 197 www.elsevier.com/locate/regpep
Transcription, expression and tissue binding in vivo of INGAP and INGAP-related peptide in normal hamsters María I. Borelli a , Héctor Del Zotto a , Luis E. Flores a , María E. García a , Antonio C. Boschero b , Juan J. Gagliardino a,⁎ a
CENEXA, Centro de Endocrinología Experimental y Aplicada (UNLP-CONICET, Centro Colaborador de la OPS/OMS), Facultad de Ciencias Médicas Universidad Nacional de La Plata, 60 y 120 (1900) La Plata, Argentina Departamento de Fisiologia e Biofisica, Instituto de Biologia Universidade Estadual de Campinas, 13083-970, Campinas, SP, Brazil
b
Received 10 July 2006; received in revised form 12 December 2006; accepted 21 December 2006 Available online 19 January 2007
Abstract We studied islet neogenesis-associated protein (INGAP) transcription and its immunocytochemical presence in and binding in vivo of 125I-tyrosylated INGAP pentadecapeptide (125I-T-INGAP-PP) to different normal male hamster tissues. 125I-T-INGAP-PP was injected intraperitoneally with or without unlabeled T-INGAP-PP (0–1 mg/100 g bw), drawing blood samples at different times after injection; radioactivity was measured in serum, brain, skeletal muscle, dorsal root ganglia, liver, kidney, small intestine and pancreas samples, expressing results as organ:serum ratio. INGAP transcription (RT-PCR) and immunopositive cells were investigated in liver, kidney, brain, small intestine and pancreas. Total serum radioactivity increased progressively as a function of time; whereas 71% of this activity was displaced by unlabeled T-INGAP-PP at 5, 10 and 20 min, only 9% was at 60 min. Only liver, pancreas and small intestine specifically bound 125I-T-INGAP-PP. The pancreas tissue dose–response curve showed a 50% displacement at 3.9 × 104 ng/100 g bw, suggesting a low binding affinity of its receptor. INGAP-mRNA was only identified in pancreatic islets and exocrine tissue. Our results suggest that INGAP transcription/expression is probably restricted to pancreas cells exerting its effect in a paracrine fashion. INGAP would be released and circulate bound to a serum protein from where it is bound and inactivated by the liver. Tissue binding could also explain INGAP's immunocytochemical presence in small intestine, where it could affect epithelial cell turnover. © 2007 Published by Elsevier B.V. Keywords:
125
I-T-INGAP; INGAP expression; Tissue INGAP screening; INGAP transcription
1. Introduction Islet neogenesis-associated protein (INGAP) was originally found in the pancreas head of normal hamsters previously wrapped in cellophane, and identified as the active component of a protein complex (ilotropin) [1,2]. The INGAP gene was then cloned and its mRNA was found in duodenum and in exocrine pancreatic cells [3]. Using more sensitive techniques, INGAP transcription was also identified in ductal and islet non-β-cells [4]. Cells immunoreactive to an INGAP antibody have been identified in normal pancreases of hamsters, fetal mice [5], adult rats [6], humans [7] and insulin-producing tumor cells [8].
⁎ Corresponding author. Tel.: +54 221 423 6712; fax: +54 221 422 2081. E-mail address: [email protected] (J.J. Gagliardino). 0167-0115/$ - see front matter © 2007 Published by Elsevier B.V. doi:10.1016/j.regpep.2006.12.028
A pentadecapeptide having the 104–118 amino acid sequence of INGAP (INGAP-PP) reproduced the stimulatory effect of the intact molecule upon thymidine incorporation into ductal cells and a ductal cell line [3]; administration of pharmacological doses of INGAP-PP to streptozotocin-diabetic mice decreased significantly the percentage of diabetic animals [9] and increased their islet mass. Further, we have recently demonstrated that neonatal and adult normal rat islets cultured with INGAP-PP released significantly more insulin in response to glucose and amino acids, increased their β-cell size [10], and also induced the expression of several genes related to β-cell function [11]. It has also been reported that INGAP exerts an effect in peripheral neural tissue [12]. All these results suggest that INGAP is involved in the regulation of islet cell growth and differentiation and insulin secretion capacity probably through a paracrine rather than an endocrine mechanism [13].
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
Consequently, it could be a useful tool for the treatment of people with diabetes. Based on this latter assumption and in order to increase the current knowledge on the possible wide tissue effect of this peptide, we screened the transcription and immunocytochemical presence of INGAP and the in vivo binding of tyrosylated INGAP-PP to different normal hamster tissues.
193
2.4. Iodination of T-INGAP-PP T-INGAP-PP was iodinated with 125I (Perkin Elmer, Boston, MA, USA, 100 mCi/ml) according to Linde et al. [15] with a specific activity of 100 mCi/mg; the labeled peptide was purified by PAGE to obtain monoiodinated components. 2.5. Binding of
125
I-T-INGAP-PP in vivo
2. Materials and methods 2.1. Chemicals and drugs Collagenase was from Serva Feinbiochemica (Heidelberg, Germany); bovine serum albumin (BSA) fraction V and other reagents were from Sigma Chemical Co (St. Louis, MO, USA). INGAP antibody (1246) was kindly provided by Dr. A. Vinik (Strelitz Diabetes Institutes, The Research Institute at Eastern Virginia Medical School Norfolk, USA). 2.2. Experimental groups Adult male Syrian hamsters (90–110 g) were used. They were maintained in a temperature-controlled room (23 °C) with a fixed 12-h light/12-h dark cycle (06:00–18:00 h) and standard commercial food and water intake ad libitum. 2.3. Tyrosylation of INGAP-PP (T-INGAP-PP) As mentioned previously, a pentadecapeptide with the sequence 104–118 of INGAP (NH-Ile-Gly-Leu-His-Asp-ProSer-His-Gly-Thr-Leu-Pro-Asn-Gly-Ser-COOH) has similar biological effects than the intact molecule. This pentadecapeptide, however, does not include tyrosyl residues in its composition, a characteristic that limits its iodination. Therefore, we prepared an INGAP-PP derivative incorporating a tyrosyl residue (TINGAP-PP) into its original amino acid sequence. This procedure was done at the Laboratory of Peptide Synthesis, School of Pharmacy and Biochemistry, Buenos Aires University, Argentina. The synthesis was performed on a 431A Applied Biosystems peptide synthesizer using Fmoc solid-phase methodology on HMP (p-hydroxymethylphenoxymethyl polystyrene) resin [14]. Amino acids, previously activated with HOBt/DCC (1-hydroxybenzotriazole/dicyclohexyl-carbodiimide), were incorporated using trityl (Asn and His) and tert-butyl (Thr and Ser) as side-chain protecting groups. The peptide was cleaved off the resin with 2% ethanedithiol, 5% thioanisole, 5% phenol and 5% water in trifluoroacetic acid; it was then precipitated by adding cold diethyl ether, and finally lyophilized. Final purification was achieved by high-performance liquid-chromatography (HPLC) on a C18 Vydac 218TP 510 semi-preparative column eluted with an acetonitrile gradient (12 to 80%). The final T-INGAP-PP had three new additional residues (one of them tyrosine) showing the following sequence: NH-Tyr-IleTrp-Ile-Gly-Leu-His-Asp-Pro-Ser-His-Gly-Thr-Leu-Pro-AsnGly-Ser-COOH. Quality control of the T-INGAP-PP (amino acid analysis and mass spectrometry) indicated N 95% purity and a molecular weight of 2005.8.
Iodinated as well as unlabeled T-INGAP-PP was diluted in 0.15 M NaCl; aliquots of the 125I-T-INGAP-PP were injected intraperitoneally alone or together with unlabeled T-INGAP-PP (0 to 106 ng/100 g bw) in a final volume of 0.3 ml. Following the injection, the animals were maintained at room temperature and blood samples were drawn from the retroorbital plexus under light ether anesthesia at 5, 10, 20 and 60 min. At each selected timepoint the animals were killed by cervical dislocation and samples from different organs (brain, liver, kidney, skeletal muscle, dorsal root ganglia, small intestine and pancreas) were removed; slices of each organ were rinsed with 0.15 M NaCl, blotted with filter paper, individually placed in plastic tubes, and weighed. Blood was allowed to clot and two aliquots of the serum collected (1000 μl each) were placed into plastic tubes and weighed. The radioactivity present in organ slices and serum samples was measured in a well scintillator gamma counter and results expressed as cpm/g tissue (T) weight (organ or serum samples). From these values we then determined the organ:serum ratio (O:S ratio) as described by Turin and Dellacha [16]. We considered a positive specific binding when the addition of unlabeled TINGAP-PP (1 mg) produced a significant (≥50%) decrease in the cpm (tracer displacement) and the O:S ratio was above 1.0. 2.6. Immunocytochemical studies Samples from liver, kidney, brain, small intestine and pancreas were fixed in 4% formaldehyde and embedded in paraffin. Thin sections (5 μm) were mounted on silanized slides and incubated with INGAP antibody (final dilution, 1:600). Then each section was incubated for 30 min at room temperature with conjugated avidin peroxidase, revealed using carbazole as chromogen and further washed and mounted in aqueous medium (Dako, Glostrup, Denmark) [17]. Control samples were run in parallel omitting the primary INGAP antibody. 2.7. Isolation of total RNA and RT-PCR Total RNA was separately isolated from the different tissues using Trizol reagent (Gibco BRL, California, USA) [18]. In the case of the intestine, epithelium cells were obtained by scraping the dissected organ and immediately processed. To isolate pancreatic islets we used the collagenase digestion procedure [19]. Briefly, fresh samples of each tissue were conserved overnight at 4 °C in RNAlater® (Ambion Inc, Austin, TX, USA). The integrity of RNA was checked by agarose–formaldehyde gel electrophoresis [20] and possible contamination with protein or phenol was controlled by measuring the 260/280 nm absorbance ratio, while DNA contamination was avoided treating the
194
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
Fig. 1. Paraffin sections of pancreas (a–c) and small intestine (d) from 3 normal hamsters. INGAP-positive cells are seen at the periphery of the islets (a), in acinar cells (b), in the duct wall (c) and in the small intestine (d). Bars = 50 μm.
sample with DNAase I (Gibco BRL). RT-PCR was performed using the SuperScript III Reverse Transcriptase (Gibco BRL) and the same amount of total RNA (50 ng) from each sample as template. A specific pair of primers based on the INGAP cDNA sequence (GenBank accession no. GI:1514683) (sense primer, 5′aacctgtcctcaaggctctg3′; antisense primer, 5′tcagcacattggaactgctc3′) was used per reaction [3]. A pair of primers for β-actin (GenBank accession no. GI:55574) (sense primer, 5′ gtttgagaccttcaacacccca3′; antisense primer, 5′gatgtcaacgtcacacttca3′) was used for positive and negative controls [20]. RT-PCR cycling conditions were: 48 °C for 45 min; 94 °C for 2 min; 35 cycles of 94 °C for 15 s, 60 °C for 30 s, 72 °C for 1 min, and 72 °C for 10 min.
Fig. 2. RT-PCR of different tissue RNA extracts from 6 hamsters. Positive bands are seen only in pancreatic islets (line 9) and exocrine tissue (line 11). No bands could be seen in the other tissues tested (liver, kidney, brain and small intestine; lines 1, 3, 5 and 7, respectively).
PCR products were separated by gel electrophoresis on a 1.5% (w/v) agarose gel. Sample identities were confirmed by sequencing on an ABI 373A DNA sequencer system (Applied Biosystems, Foster City, CA, USA) [20]. 2.8. Statistical analysis Statistical significance among differences was tested using the paired t-test, settling significance at p values b 0.05. The tracer displacement regression curve was obtained and plotted using the dose–response function to fit logged data on a log
Fig. 3. Maximal in vivo tissue specific binding of 125I-T-INGAP-PP expressed as O:S ratio. Each value represents the mean of 6 hamsters from 3 different experiments at each period of time. Such binding was only present in liver, pancreas and small intestine, with maximum values at 5, 10 and 20 min, respectively, after tracer injection.
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
195
scale with the Origin program version 6.1 (OriginLab Corp, Northampton, MA, USA).
mainly bound to some serum protein fraction and undergoes degradation upon time.
3. Results
3.4. In vivo binding of
3.1. Immunocytochemical screening of INGAP
Fig. 3 shows the highest in vivo tissue specific binding of I-T-INGAP-PP expressed as O:S ratio (see Materials and methods). Although only liver, pancreas and small intestine showed such binding, the highest values were unevenly reached in these tissues at 5 (liver), 10 (pancreas) and 20 (small intestine) min after the tracer injection. The pancreas:serum ratio obtained after injection of 125I-TINGAP-PP alone or together with different amounts of unlabeled T-INGAP-PP (0, 103, 104, 105 and 106 ng/100 g bw) is represented in Fig. 4. Changes of this ratio (displacement) by the injection of the unlabeled peptide in the range of 103 to 104 ng/100 g bw were not significant, but it fell to 50% at a concentration of 3.9.104 ng/100 g bw. These data suggest a low binding affinity of the pancreas receptor to this peptide.
125
I-T-INGAP-PP to different tissues
125
The immunocytochemical screening showed the presence of INGAP-positive cells in pancreatic islet, acinar and duct cells (Fig. 1a, b and c, respectively) and in the small intestine (Fig. 1d). Negative reactivity was obtained in these tissues when normal rabbit serum was used instead of the INGAP antibody (data not shown). No INGAP-labeled cells could be seen in liver, brain and kidney (data not shown). 3.2. Presence of INGAP-mRNA in different tissues Screening of INGAP-mRNA in different tissues by RT-PCR showed a positive band of INGAP only when the cDNA of pancreatic islets and exocrine tissue was used as template (Fig. 2, lines 9 and 11); no bands could be seen in the other tissues tested (liver, kidney, brain and small intestine; Fig. 3, lines 1, 3, 5 and 7, respectively). Such failure was observed when we used either the optimum annealing temperature for our primers (60 °C), or when we decreased this temperature to 55 °C to favor their annealing at the risk of obtaining nonspecific bands. 3.3. Circulating
125
I-INGAPP-PP
Total radioactivity (expressed as cpm/g serum) measured in serum samples drawn at different times after injection of 125 IINGAPP-PP increased progressively from 0 (1952 cpm/g serum) to 60 min (36,566 cpm/g serum). The simultaneous administration of unlabeled T-INGAP-PP decreased this activity by an average of 71% at 5, 10 and 20 min but only by 9% at 60 min. These data suggest that the peptide circulates
Fig. 4. Tracer displacement regression curve. The pancreas:serum ratio (ordinates) was plotted as a function of the amount of unlabeled T-INGAP-PP (0, 103, 104, 105 and 106 ng/100 g bw) injected together with the tracer (IC50 = 3.9.104 ng/100 g bw; slope of the curve − 1.23743). The results show the mean of 6 hamsters from 3 different experiments at each dose analyzed.
4. Discussion Our results confirm the immunocytochemical presence of INGAP in ductal, acinar and peripheral islet cells of the pancreas [21], but also demonstrate for the first time its presence in the small intestine of adult normal hamsters. Conversely, no immunopositive INGAP cells were seen in liver, kidney and brain tissue. The INGAP amino acid sequence shows high homology with several proteins encoded by members of the Reg gene family: 58% with rat pancreatitis-associated protein (PAP)-I, 45% with PAP-II, 50% with PAP-III, 54% with hepatocarcinoma–intestine–pancreas/pancreatic-associated protein (HIP/ PAP) [22], and 72% identity and 82% positives with the mouse Reg III-δ protein. It has also been suggested that the mouse Reg III-δ gene exists not only in human and rat genomes but also in the hamster genome, and that INGAP would be the hamster Reg III-δ [23,24]. In our immunocytochemical studies we used an INGAP antibody directed against a 20 amino acid region (amino acids 20–39) with 75% identity and 90% of positives with Reg III-δ (amino acids 21–40). Therefore, it could be argued that this antibody reacted with INGAP and with the Reg III-δ peptide. However, there are some facts against such an assumption, namely, 1) the Reg III-δ peptide is expressed predominantly in the exocrine pancreas of the mouse, but not in normal islets [23]; 2) other members of the Reg gene family are expressed in regenerating islets — which was not our case — but they are exclusively seen in islet β-cells [24]; 3) we have consistently found that INGAP is present mainly in non-β-cells, and that most of these INGAP-positive cells did not stain with any of the other islet hormones [21]; 4) Taylor-Fischwick et al. postulated that INGAP and Reg III-δ binding sites to transcription factors are regulated differently [25]; 5) in a recent review Graf et al. reported that INGAP is expressed in hamsters as well as in mice and human beings [26]. Moreover, preliminary data obtained using antibodies raised against other portions of the INGAP molecule showed that they reacted
196
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
exclusively with β and acinar cells (Del Zotto and Gold, unpublished observations). Therefore, further evidence is needed to demonstrate whether INGAP and Reg III-δ are different proteins, or the same protein expressed in different cells. However, using our antibody, INGAP was immunocytochemically identified in endocrine and exocrine pancreatic cells and in the small intestine epithelial cells of normal hamsters. The presence of INGAP-mRNA showed a more restricted distribution pattern, only measurable in endocrine and exocrine pancreatic cells. Rafaeloff et al. have previously shown the presence of INGAP-mRNA in exocrine and duodenum tissue of hamsters with their pancreas wrapped in cellophane [3]. Sasahara et al. demonstrated INGAP gene expression in the stomach, duodenum, pancreas and skeletal muscle of normal mice using Northern blot analysis [23]. The apparent discrepancies between our results and those from other authors could be ascribed to differences in the sensitivity of the techniques used (in situ hybridization, RT-PCR and Northern blot analysis), in tissue collection (intestinal epithelial cells in our case vs. whole tissue in the other cases) and/or different animals and experimental conditions (normal vs. cellophanewrapped pancreas head hamsters and normal mice). It is accepted that binding to target cells is the first step in the mechanism of polypeptide endocrine/paracrine action; furthermore, a close relationship has been found between protein binding and protein biological activity [27,28]. On the other hand, peptide binding measured in vivo is a simple and suitable approach to screen possible target tissues for a given compound [16]. Using this procedure, we have seen specific binding (see definition in Materials and methods) of 125I-T-INGAP-PP to liver, pancreas and small intestine. Such binding was not measured in kidney, skeletal muscle, brain and dorsal root ganglia tissue, despite it has been reported that INGAP exerts an effect in peripheral neural tissue [12]. The discrepancy between our results and those reported by other authors could be ascribed to the different methodology used. Further, a clear dose– response displacement curve was obtained in these tissues (only shown in pancreas in this report) when different concentrations of unlabeled T-INGAP-PP were injected together with 125I-TINGAP-PP. Therefore, this binding had similar properties (specificity but low affinity) to those ascribed to in vitro techniques [29], which would support its proposed paracrine action mechanism [13]. The positive INGAP transcription and expression as well as the 125I-T-INGAP-PP binding to pancreas gives further support to the postulated regulatory role of INGAP in this organ [3,10]. Our data show that 125I-T-INGAP-PP apparently circulates bound to a serum protein fraction that assures a relatively long life before it becomes degraded probably by liver. This assumption is supported by T-INGAP-PP specific binding to liver tissue together with the lack of INGAP immunopositivity and INGAP-transcription in this organ. It can therefore be possible that INGAP or even some of its biological active fractions could be released into the circulation from the pancreas and taken up by some tissues. This fact could explain the strong immunocytochemical reactivity found in the small intestine without evidence of INGAP transcription. In this organ —
opposite to what occurs in the liver — the peptide would not be rapidly degraded, facilitating its deposit and immunocytochemical identification. Our design cannot explain the T-INGAP-PPbinding and INGAP immunopositivity found in small intestine cells; however, on account of INGAP's neogenic effect, it could play a role in the process of high cellular turnover of its epithelial cells as it does in the pancreas. Kobayashi et al. have shown the expression of Reg-receptor mRNA in liver, kidney, stomach, small intestine, colon, adrenal gland, pituitary gland and brain, but not in heart, suggesting the possible involvement of the Reg–Reg receptor signal system in a variety of cell types other than pancreatic β-cells [30]. They also transfected CHO cells with this receptor and measured its kinetics, reporting high affinity for rat Reg protein (Kd = 4.41 nM; Ki = 1.61 nM). The wider and different distributions and affinities of Reg receptors would suggest that Reg and INGAP (at least T-INGAP-PP) have different specific cell receptors. However, we cannot assure at the moment whether failure to demonstrate T-INGAP-PP binding and INGAP immunocytochemical presence and transcription in the tissues tested is not merely the consequence of the low sensitivity of the procedures used for their measurement. The question will remain unanswered until similar negative results are reproduced using more sensitive techniques than the currently employed. In summary, our results suggest that INGAP transcription/ expression is probably restricted to pancreas cells and that in this organ its effect would be exerted in a paracrine fashion. Probably, INGAP is released to the general circulation but not many tissues are furnished with receptors to put forward its biological action and/or inactivation. Acknowledgments This work was supported by grants from FONCYT and CICPBA of Argentina. The authors thank Dr. C. Peña (Laboratory of Peptide Synthesis, School of Pharmacy and Biochemistry, Buenos Aires University, Argentina) for TINGAP-PP synthesis, A. Diaz and C. Bianchi for technical assistance, E.E. Pérez for graphic design and A. Di Maggio for careful editing of the manuscript. References [1] Pittenger GL, Vinik AI, Rosenberg L. The partial isolation and characterization of ilotropin, a novel islet-specific growth factor. Adv Exp Med Biol 1992;321:123–30. [2] Vinik A, Rafaeloff R, Pittenger G, Rosenberg L, Duguid W. Induction of pancreatic islet neogenesis. Horm Metab Res 1997;29:278–93. [3] Rafaeloff R, Pittenger GL, Barlow SW, Qin XF, Yan B, Rosenberg L, Duguid WP, Vinik AI. Cloning and sequencing of the pancreatic islet neogenesis associated protein (INGAP) gene and its expression in islet neogenesis in hamsters. J Clin Invest 1997;99:2100–9. [4] Flores LE, García ME, Borelli MI, Del Zotto H, Alzugaray ME, Maiztegui B, Gagliardino JJ. Expression of islet neogenesis-associated protein (INGAP) in islets of normal hamsters. J Endocrinol 2003;177:243–8. [5] Rafaeloff-Phail R, Schmitt E, Edlund H, Gold G, Vinik AI. Expression of INGAP during ontogeny of the pancreas. Diabetes 1998;47(Suppl 1):A259 [Abstract]. [6] Del Zotto H, Borelli MI, Flores L, García ME, Gómez Dumm CL, Chicco A, Lombardo YB, Gagliardino JJ. Islet neogenesis: an apparent key
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14] [15]
[16] [17]
[18]
[19]
component of long-term pancreas adaptation to increased insulin demand. J Endocrinol 2004;183:321–30. Rafaeloff-Phail R, Schmitt E, Sandusky G, Rosenberg L, Gold G, Borts T, Duguid W, Vinik AI. INGAP is a human cytokine expressed only in the presence of islet neogenesis. Diabetes 1998;47(Suppl 1):A259 [Abstract]. Semakula C, Pambuccian S, Gruessner R, Kendall D, Pittenger G, Vinik A, Seaquist ER. Clinical case seminar: hypoglycemia after pancreas transplantation: association with allograft nesidiodysplasia and expression of islet neogenesis-associated peptide. J Clin Endocrinol Metab 2002;87:3548–54. Rosenberg L, Lipsett M, Yoon JW, Prentki M, Wang R, Jun HS, Pittenger GL, Taylor-Fishwick D, Vinik AI. A pentadecapeptide fragment of islet neogenesis-associated protein increases beta-cell mass and reverses diabetes in C57BL/6J mice. Ann Surg 2004;240:875–84. Borelli MI, Stoppiglia LF, Rezende LF, Flores LE, Del Zotto H, Boschero AC, Gagliardino JJ. INGAP-related pentadecapeptide: its modulatory effect upon insulin secretion. Regul Pept 2005;131:97–102. Barbosa H, Bordin S, Stoppiglia L, Silva K, Borelli M, Del Zotto H, Gagliardino J, Boschero A. Islet Neogenesis Associated Protein (INGAP) modulates gene expression in cultured neonatal rat islets. Regul Pept 2006;136(1–3):78–84. Tam J, Rosenberg L, Maysinger D. Islet-neogenesis-associated protein enhances neurite outgrowth from DRG neurons. Biochem Biophys Res Commun 2002;291:649–54. Rosenberg L, Kahlenberg M, Vinik AI, Duguid WP. Paracrine/autocrine regulation of pancreatic islet cell proliferation and differentiation in the hamster: studies using parabiosis. Clin Invest Med 1996;19:3–12. Stewart JM, Young JD. Solid phase peptide synthesis. 2nd edn. Rockford, Illinois: Pierce Chemical Co.; 1984. Linde S, Hansen B, Lernmark A. Stable iodinated polypeptide hormones prepared by polyacrylamide gel electrophoresis. Anal Biochem 1980;107:165–76. Turyn D, Dellacha JM. Specific binding of iodinated bovine growth hormone to rat liver in vivo. Endocrinology 1978;103:1190–5. Hsu SM, Raine L, Fanger H. Use of avidin–biotin–peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 1981;29:577–80. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–9. Lacy PE, Kostianovsky M. Method for the isolation of intact islets of Langerhans from the rat pancreas. Diabetes 1967;16:35–9.
197
[20] Sambrook J, Fritsch EF, Maniatis TE. Molecular cloning: a laboratory manual. 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory; 1989. [21] Del Zotto H, Massa L, Rafaeloff R, Pittenger GL, Vinik A, Gold G, ReifelMiller A, Gagliardino JJ. Possible relationship between changes in islet neogenesis and islet neogenesis-associated protein-positive cell mass induced by sucrose administration to normal hamsters. J Endocrinol 2000;165:725–33. [22] Abe M, Nata K, Akiyama T, Shervani NJ, Kobayashi S, TomiokaKumagai T, Ito S, Takasawa S, Okamoto H. Identification of a novel Reg family gene, RegIIIdelta, and mapping of all three types of Reg family gene in a 75 kilobase mouse genomic region. Gene 2000;246:111–22. [23] Sasahara K, Yamaoka T, Moritani M, Yoshimoto K, Kuroda Y, Itakura M. Molecular cloning and tissue-specific expression of a new member of the regenerating protein family, islet neogenesis-associated protein-related protein. Biochim Biophys Acta 2000;1500:142–6. [24] Terazono K, Uchiyama Y, Ide M, Watanabe T, Yonekura H, Yamamoto H, Okamoto H. Expression of reg protein in rat regenerating islets and its colocalization with insulin in the beta cell secretory granules. Diabetologia 1990;33:250–2. [25] Taylor-Fishwick DA, Rittman S, Kendall H, Roy L, Shi W, Cao Y, Pittenger GL, Vinik AI. Cloning genomic INGAP: a Reg-related family member with distinct transcriptional regulation sites. Biochim Biophys Acta 2003;1638:83–9. [26] Graf R, Schiesser M, Reding T, Appenzeller P, Sun LK, Fortunato F, Perren A, Bimmler D. Exocrine meets endocrine:pancreatic stone protein and regenerating protein—two sides of the same coin. J Surg Res 2006;133:113–20. [27] Roth J. Peptide hormone binding to receptors: a review of direct studies in vitro. Metabolism 1973;22:1059–73. [28] Kono T, Barham FW. The relationship between the insulin-binding capacity of fat cells and the cellular response to insulin. Studies with intact and trypsin-treated fat cells. J Biol Chem 1971;246:6210–6. [29] Freychet P. Interactions of polypeptide hormones with cell membrane specific receptors: studies with insulin and glucagon. Diabetologia 1976;12:83–100. [30] Kobayashi S, Akiyama T, Nata K, Abe M, Tajima M, Shervani NJ, Unno M, Matsuno S, Sasaki H, Takasawa S, Okamoto H. Identification of a receptor for reg (regenerating gene) protein, a pancreatic beta-cell regeneration factor. J Biol Chem 2000;275:10723–6.
Transcription, expression and tissue binding in vivo of INGAP and INGAP-related peptide in normal hamsters María I. Borelli a , Héctor Del Zotto a , Luis E. Flores a , María E. García a , Antonio C. Boschero b , Juan J. Gagliardino a,⁎ a
CENEXA, Centro de Endocrinología Experimental y Aplicada (UNLP-CONICET, Centro Colaborador de la OPS/OMS), Facultad de Ciencias Médicas Universidad Nacional de La Plata, 60 y 120 (1900) La Plata, Argentina Departamento de Fisiologia e Biofisica, Instituto de Biologia Universidade Estadual de Campinas, 13083-970, Campinas, SP, Brazil
b
Received 10 July 2006; received in revised form 12 December 2006; accepted 21 December 2006 Available online 19 January 2007
Abstract We studied islet neogenesis-associated protein (INGAP) transcription and its immunocytochemical presence in and binding in vivo of 125I-tyrosylated INGAP pentadecapeptide (125I-T-INGAP-PP) to different normal male hamster tissues. 125I-T-INGAP-PP was injected intraperitoneally with or without unlabeled T-INGAP-PP (0–1 mg/100 g bw), drawing blood samples at different times after injection; radioactivity was measured in serum, brain, skeletal muscle, dorsal root ganglia, liver, kidney, small intestine and pancreas samples, expressing results as organ:serum ratio. INGAP transcription (RT-PCR) and immunopositive cells were investigated in liver, kidney, brain, small intestine and pancreas. Total serum radioactivity increased progressively as a function of time; whereas 71% of this activity was displaced by unlabeled T-INGAP-PP at 5, 10 and 20 min, only 9% was at 60 min. Only liver, pancreas and small intestine specifically bound 125I-T-INGAP-PP. The pancreas tissue dose–response curve showed a 50% displacement at 3.9 × 104 ng/100 g bw, suggesting a low binding affinity of its receptor. INGAP-mRNA was only identified in pancreatic islets and exocrine tissue. Our results suggest that INGAP transcription/expression is probably restricted to pancreas cells exerting its effect in a paracrine fashion. INGAP would be released and circulate bound to a serum protein from where it is bound and inactivated by the liver. Tissue binding could also explain INGAP's immunocytochemical presence in small intestine, where it could affect epithelial cell turnover. © 2007 Published by Elsevier B.V. Keywords:
125
I-T-INGAP; INGAP expression; Tissue INGAP screening; INGAP transcription
1. Introduction Islet neogenesis-associated protein (INGAP) was originally found in the pancreas head of normal hamsters previously wrapped in cellophane, and identified as the active component of a protein complex (ilotropin) [1,2]. The INGAP gene was then cloned and its mRNA was found in duodenum and in exocrine pancreatic cells [3]. Using more sensitive techniques, INGAP transcription was also identified in ductal and islet non-β-cells [4]. Cells immunoreactive to an INGAP antibody have been identified in normal pancreases of hamsters, fetal mice [5], adult rats [6], humans [7] and insulin-producing tumor cells [8].
⁎ Corresponding author. Tel.: +54 221 423 6712; fax: +54 221 422 2081. E-mail address: [email protected] (J.J. Gagliardino). 0167-0115/$ - see front matter © 2007 Published by Elsevier B.V. doi:10.1016/j.regpep.2006.12.028
A pentadecapeptide having the 104–118 amino acid sequence of INGAP (INGAP-PP) reproduced the stimulatory effect of the intact molecule upon thymidine incorporation into ductal cells and a ductal cell line [3]; administration of pharmacological doses of INGAP-PP to streptozotocin-diabetic mice decreased significantly the percentage of diabetic animals [9] and increased their islet mass. Further, we have recently demonstrated that neonatal and adult normal rat islets cultured with INGAP-PP released significantly more insulin in response to glucose and amino acids, increased their β-cell size [10], and also induced the expression of several genes related to β-cell function [11]. It has also been reported that INGAP exerts an effect in peripheral neural tissue [12]. All these results suggest that INGAP is involved in the regulation of islet cell growth and differentiation and insulin secretion capacity probably through a paracrine rather than an endocrine mechanism [13].
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
Consequently, it could be a useful tool for the treatment of people with diabetes. Based on this latter assumption and in order to increase the current knowledge on the possible wide tissue effect of this peptide, we screened the transcription and immunocytochemical presence of INGAP and the in vivo binding of tyrosylated INGAP-PP to different normal hamster tissues.
193
2.4. Iodination of T-INGAP-PP T-INGAP-PP was iodinated with 125I (Perkin Elmer, Boston, MA, USA, 100 mCi/ml) according to Linde et al. [15] with a specific activity of 100 mCi/mg; the labeled peptide was purified by PAGE to obtain monoiodinated components. 2.5. Binding of
125
I-T-INGAP-PP in vivo
2. Materials and methods 2.1. Chemicals and drugs Collagenase was from Serva Feinbiochemica (Heidelberg, Germany); bovine serum albumin (BSA) fraction V and other reagents were from Sigma Chemical Co (St. Louis, MO, USA). INGAP antibody (1246) was kindly provided by Dr. A. Vinik (Strelitz Diabetes Institutes, The Research Institute at Eastern Virginia Medical School Norfolk, USA). 2.2. Experimental groups Adult male Syrian hamsters (90–110 g) were used. They were maintained in a temperature-controlled room (23 °C) with a fixed 12-h light/12-h dark cycle (06:00–18:00 h) and standard commercial food and water intake ad libitum. 2.3. Tyrosylation of INGAP-PP (T-INGAP-PP) As mentioned previously, a pentadecapeptide with the sequence 104–118 of INGAP (NH-Ile-Gly-Leu-His-Asp-ProSer-His-Gly-Thr-Leu-Pro-Asn-Gly-Ser-COOH) has similar biological effects than the intact molecule. This pentadecapeptide, however, does not include tyrosyl residues in its composition, a characteristic that limits its iodination. Therefore, we prepared an INGAP-PP derivative incorporating a tyrosyl residue (TINGAP-PP) into its original amino acid sequence. This procedure was done at the Laboratory of Peptide Synthesis, School of Pharmacy and Biochemistry, Buenos Aires University, Argentina. The synthesis was performed on a 431A Applied Biosystems peptide synthesizer using Fmoc solid-phase methodology on HMP (p-hydroxymethylphenoxymethyl polystyrene) resin [14]. Amino acids, previously activated with HOBt/DCC (1-hydroxybenzotriazole/dicyclohexyl-carbodiimide), were incorporated using trityl (Asn and His) and tert-butyl (Thr and Ser) as side-chain protecting groups. The peptide was cleaved off the resin with 2% ethanedithiol, 5% thioanisole, 5% phenol and 5% water in trifluoroacetic acid; it was then precipitated by adding cold diethyl ether, and finally lyophilized. Final purification was achieved by high-performance liquid-chromatography (HPLC) on a C18 Vydac 218TP 510 semi-preparative column eluted with an acetonitrile gradient (12 to 80%). The final T-INGAP-PP had three new additional residues (one of them tyrosine) showing the following sequence: NH-Tyr-IleTrp-Ile-Gly-Leu-His-Asp-Pro-Ser-His-Gly-Thr-Leu-Pro-AsnGly-Ser-COOH. Quality control of the T-INGAP-PP (amino acid analysis and mass spectrometry) indicated N 95% purity and a molecular weight of 2005.8.
Iodinated as well as unlabeled T-INGAP-PP was diluted in 0.15 M NaCl; aliquots of the 125I-T-INGAP-PP were injected intraperitoneally alone or together with unlabeled T-INGAP-PP (0 to 106 ng/100 g bw) in a final volume of 0.3 ml. Following the injection, the animals were maintained at room temperature and blood samples were drawn from the retroorbital plexus under light ether anesthesia at 5, 10, 20 and 60 min. At each selected timepoint the animals were killed by cervical dislocation and samples from different organs (brain, liver, kidney, skeletal muscle, dorsal root ganglia, small intestine and pancreas) were removed; slices of each organ were rinsed with 0.15 M NaCl, blotted with filter paper, individually placed in plastic tubes, and weighed. Blood was allowed to clot and two aliquots of the serum collected (1000 μl each) were placed into plastic tubes and weighed. The radioactivity present in organ slices and serum samples was measured in a well scintillator gamma counter and results expressed as cpm/g tissue (T) weight (organ or serum samples). From these values we then determined the organ:serum ratio (O:S ratio) as described by Turin and Dellacha [16]. We considered a positive specific binding when the addition of unlabeled TINGAP-PP (1 mg) produced a significant (≥50%) decrease in the cpm (tracer displacement) and the O:S ratio was above 1.0. 2.6. Immunocytochemical studies Samples from liver, kidney, brain, small intestine and pancreas were fixed in 4% formaldehyde and embedded in paraffin. Thin sections (5 μm) were mounted on silanized slides and incubated with INGAP antibody (final dilution, 1:600). Then each section was incubated for 30 min at room temperature with conjugated avidin peroxidase, revealed using carbazole as chromogen and further washed and mounted in aqueous medium (Dako, Glostrup, Denmark) [17]. Control samples were run in parallel omitting the primary INGAP antibody. 2.7. Isolation of total RNA and RT-PCR Total RNA was separately isolated from the different tissues using Trizol reagent (Gibco BRL, California, USA) [18]. In the case of the intestine, epithelium cells were obtained by scraping the dissected organ and immediately processed. To isolate pancreatic islets we used the collagenase digestion procedure [19]. Briefly, fresh samples of each tissue were conserved overnight at 4 °C in RNAlater® (Ambion Inc, Austin, TX, USA). The integrity of RNA was checked by agarose–formaldehyde gel electrophoresis [20] and possible contamination with protein or phenol was controlled by measuring the 260/280 nm absorbance ratio, while DNA contamination was avoided treating the
194
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
Fig. 1. Paraffin sections of pancreas (a–c) and small intestine (d) from 3 normal hamsters. INGAP-positive cells are seen at the periphery of the islets (a), in acinar cells (b), in the duct wall (c) and in the small intestine (d). Bars = 50 μm.
sample with DNAase I (Gibco BRL). RT-PCR was performed using the SuperScript III Reverse Transcriptase (Gibco BRL) and the same amount of total RNA (50 ng) from each sample as template. A specific pair of primers based on the INGAP cDNA sequence (GenBank accession no. GI:1514683) (sense primer, 5′aacctgtcctcaaggctctg3′; antisense primer, 5′tcagcacattggaactgctc3′) was used per reaction [3]. A pair of primers for β-actin (GenBank accession no. GI:55574) (sense primer, 5′ gtttgagaccttcaacacccca3′; antisense primer, 5′gatgtcaacgtcacacttca3′) was used for positive and negative controls [20]. RT-PCR cycling conditions were: 48 °C for 45 min; 94 °C for 2 min; 35 cycles of 94 °C for 15 s, 60 °C for 30 s, 72 °C for 1 min, and 72 °C for 10 min.
Fig. 2. RT-PCR of different tissue RNA extracts from 6 hamsters. Positive bands are seen only in pancreatic islets (line 9) and exocrine tissue (line 11). No bands could be seen in the other tissues tested (liver, kidney, brain and small intestine; lines 1, 3, 5 and 7, respectively).
PCR products were separated by gel electrophoresis on a 1.5% (w/v) agarose gel. Sample identities were confirmed by sequencing on an ABI 373A DNA sequencer system (Applied Biosystems, Foster City, CA, USA) [20]. 2.8. Statistical analysis Statistical significance among differences was tested using the paired t-test, settling significance at p values b 0.05. The tracer displacement regression curve was obtained and plotted using the dose–response function to fit logged data on a log
Fig. 3. Maximal in vivo tissue specific binding of 125I-T-INGAP-PP expressed as O:S ratio. Each value represents the mean of 6 hamsters from 3 different experiments at each period of time. Such binding was only present in liver, pancreas and small intestine, with maximum values at 5, 10 and 20 min, respectively, after tracer injection.
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
195
scale with the Origin program version 6.1 (OriginLab Corp, Northampton, MA, USA).
mainly bound to some serum protein fraction and undergoes degradation upon time.
3. Results
3.4. In vivo binding of
3.1. Immunocytochemical screening of INGAP
Fig. 3 shows the highest in vivo tissue specific binding of I-T-INGAP-PP expressed as O:S ratio (see Materials and methods). Although only liver, pancreas and small intestine showed such binding, the highest values were unevenly reached in these tissues at 5 (liver), 10 (pancreas) and 20 (small intestine) min after the tracer injection. The pancreas:serum ratio obtained after injection of 125I-TINGAP-PP alone or together with different amounts of unlabeled T-INGAP-PP (0, 103, 104, 105 and 106 ng/100 g bw) is represented in Fig. 4. Changes of this ratio (displacement) by the injection of the unlabeled peptide in the range of 103 to 104 ng/100 g bw were not significant, but it fell to 50% at a concentration of 3.9.104 ng/100 g bw. These data suggest a low binding affinity of the pancreas receptor to this peptide.
125
I-T-INGAP-PP to different tissues
125
The immunocytochemical screening showed the presence of INGAP-positive cells in pancreatic islet, acinar and duct cells (Fig. 1a, b and c, respectively) and in the small intestine (Fig. 1d). Negative reactivity was obtained in these tissues when normal rabbit serum was used instead of the INGAP antibody (data not shown). No INGAP-labeled cells could be seen in liver, brain and kidney (data not shown). 3.2. Presence of INGAP-mRNA in different tissues Screening of INGAP-mRNA in different tissues by RT-PCR showed a positive band of INGAP only when the cDNA of pancreatic islets and exocrine tissue was used as template (Fig. 2, lines 9 and 11); no bands could be seen in the other tissues tested (liver, kidney, brain and small intestine; Fig. 3, lines 1, 3, 5 and 7, respectively). Such failure was observed when we used either the optimum annealing temperature for our primers (60 °C), or when we decreased this temperature to 55 °C to favor their annealing at the risk of obtaining nonspecific bands. 3.3. Circulating
125
I-INGAPP-PP
Total radioactivity (expressed as cpm/g serum) measured in serum samples drawn at different times after injection of 125 IINGAPP-PP increased progressively from 0 (1952 cpm/g serum) to 60 min (36,566 cpm/g serum). The simultaneous administration of unlabeled T-INGAP-PP decreased this activity by an average of 71% at 5, 10 and 20 min but only by 9% at 60 min. These data suggest that the peptide circulates
Fig. 4. Tracer displacement regression curve. The pancreas:serum ratio (ordinates) was plotted as a function of the amount of unlabeled T-INGAP-PP (0, 103, 104, 105 and 106 ng/100 g bw) injected together with the tracer (IC50 = 3.9.104 ng/100 g bw; slope of the curve − 1.23743). The results show the mean of 6 hamsters from 3 different experiments at each dose analyzed.
4. Discussion Our results confirm the immunocytochemical presence of INGAP in ductal, acinar and peripheral islet cells of the pancreas [21], but also demonstrate for the first time its presence in the small intestine of adult normal hamsters. Conversely, no immunopositive INGAP cells were seen in liver, kidney and brain tissue. The INGAP amino acid sequence shows high homology with several proteins encoded by members of the Reg gene family: 58% with rat pancreatitis-associated protein (PAP)-I, 45% with PAP-II, 50% with PAP-III, 54% with hepatocarcinoma–intestine–pancreas/pancreatic-associated protein (HIP/ PAP) [22], and 72% identity and 82% positives with the mouse Reg III-δ protein. It has also been suggested that the mouse Reg III-δ gene exists not only in human and rat genomes but also in the hamster genome, and that INGAP would be the hamster Reg III-δ [23,24]. In our immunocytochemical studies we used an INGAP antibody directed against a 20 amino acid region (amino acids 20–39) with 75% identity and 90% of positives with Reg III-δ (amino acids 21–40). Therefore, it could be argued that this antibody reacted with INGAP and with the Reg III-δ peptide. However, there are some facts against such an assumption, namely, 1) the Reg III-δ peptide is expressed predominantly in the exocrine pancreas of the mouse, but not in normal islets [23]; 2) other members of the Reg gene family are expressed in regenerating islets — which was not our case — but they are exclusively seen in islet β-cells [24]; 3) we have consistently found that INGAP is present mainly in non-β-cells, and that most of these INGAP-positive cells did not stain with any of the other islet hormones [21]; 4) Taylor-Fischwick et al. postulated that INGAP and Reg III-δ binding sites to transcription factors are regulated differently [25]; 5) in a recent review Graf et al. reported that INGAP is expressed in hamsters as well as in mice and human beings [26]. Moreover, preliminary data obtained using antibodies raised against other portions of the INGAP molecule showed that they reacted
196
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
exclusively with β and acinar cells (Del Zotto and Gold, unpublished observations). Therefore, further evidence is needed to demonstrate whether INGAP and Reg III-δ are different proteins, or the same protein expressed in different cells. However, using our antibody, INGAP was immunocytochemically identified in endocrine and exocrine pancreatic cells and in the small intestine epithelial cells of normal hamsters. The presence of INGAP-mRNA showed a more restricted distribution pattern, only measurable in endocrine and exocrine pancreatic cells. Rafaeloff et al. have previously shown the presence of INGAP-mRNA in exocrine and duodenum tissue of hamsters with their pancreas wrapped in cellophane [3]. Sasahara et al. demonstrated INGAP gene expression in the stomach, duodenum, pancreas and skeletal muscle of normal mice using Northern blot analysis [23]. The apparent discrepancies between our results and those from other authors could be ascribed to differences in the sensitivity of the techniques used (in situ hybridization, RT-PCR and Northern blot analysis), in tissue collection (intestinal epithelial cells in our case vs. whole tissue in the other cases) and/or different animals and experimental conditions (normal vs. cellophanewrapped pancreas head hamsters and normal mice). It is accepted that binding to target cells is the first step in the mechanism of polypeptide endocrine/paracrine action; furthermore, a close relationship has been found between protein binding and protein biological activity [27,28]. On the other hand, peptide binding measured in vivo is a simple and suitable approach to screen possible target tissues for a given compound [16]. Using this procedure, we have seen specific binding (see definition in Materials and methods) of 125I-T-INGAP-PP to liver, pancreas and small intestine. Such binding was not measured in kidney, skeletal muscle, brain and dorsal root ganglia tissue, despite it has been reported that INGAP exerts an effect in peripheral neural tissue [12]. The discrepancy between our results and those reported by other authors could be ascribed to the different methodology used. Further, a clear dose– response displacement curve was obtained in these tissues (only shown in pancreas in this report) when different concentrations of unlabeled T-INGAP-PP were injected together with 125I-TINGAP-PP. Therefore, this binding had similar properties (specificity but low affinity) to those ascribed to in vitro techniques [29], which would support its proposed paracrine action mechanism [13]. The positive INGAP transcription and expression as well as the 125I-T-INGAP-PP binding to pancreas gives further support to the postulated regulatory role of INGAP in this organ [3,10]. Our data show that 125I-T-INGAP-PP apparently circulates bound to a serum protein fraction that assures a relatively long life before it becomes degraded probably by liver. This assumption is supported by T-INGAP-PP specific binding to liver tissue together with the lack of INGAP immunopositivity and INGAP-transcription in this organ. It can therefore be possible that INGAP or even some of its biological active fractions could be released into the circulation from the pancreas and taken up by some tissues. This fact could explain the strong immunocytochemical reactivity found in the small intestine without evidence of INGAP transcription. In this organ —
opposite to what occurs in the liver — the peptide would not be rapidly degraded, facilitating its deposit and immunocytochemical identification. Our design cannot explain the T-INGAP-PPbinding and INGAP immunopositivity found in small intestine cells; however, on account of INGAP's neogenic effect, it could play a role in the process of high cellular turnover of its epithelial cells as it does in the pancreas. Kobayashi et al. have shown the expression of Reg-receptor mRNA in liver, kidney, stomach, small intestine, colon, adrenal gland, pituitary gland and brain, but not in heart, suggesting the possible involvement of the Reg–Reg receptor signal system in a variety of cell types other than pancreatic β-cells [30]. They also transfected CHO cells with this receptor and measured its kinetics, reporting high affinity for rat Reg protein (Kd = 4.41 nM; Ki = 1.61 nM). The wider and different distributions and affinities of Reg receptors would suggest that Reg and INGAP (at least T-INGAP-PP) have different specific cell receptors. However, we cannot assure at the moment whether failure to demonstrate T-INGAP-PP binding and INGAP immunocytochemical presence and transcription in the tissues tested is not merely the consequence of the low sensitivity of the procedures used for their measurement. The question will remain unanswered until similar negative results are reproduced using more sensitive techniques than the currently employed. In summary, our results suggest that INGAP transcription/ expression is probably restricted to pancreas cells and that in this organ its effect would be exerted in a paracrine fashion. Probably, INGAP is released to the general circulation but not many tissues are furnished with receptors to put forward its biological action and/or inactivation. Acknowledgments This work was supported by grants from FONCYT and CICPBA of Argentina. The authors thank Dr. C. Peña (Laboratory of Peptide Synthesis, School of Pharmacy and Biochemistry, Buenos Aires University, Argentina) for TINGAP-PP synthesis, A. Diaz and C. Bianchi for technical assistance, E.E. Pérez for graphic design and A. Di Maggio for careful editing of the manuscript. References [1] Pittenger GL, Vinik AI, Rosenberg L. The partial isolation and characterization of ilotropin, a novel islet-specific growth factor. Adv Exp Med Biol 1992;321:123–30. [2] Vinik A, Rafaeloff R, Pittenger G, Rosenberg L, Duguid W. Induction of pancreatic islet neogenesis. Horm Metab Res 1997;29:278–93. [3] Rafaeloff R, Pittenger GL, Barlow SW, Qin XF, Yan B, Rosenberg L, Duguid WP, Vinik AI. Cloning and sequencing of the pancreatic islet neogenesis associated protein (INGAP) gene and its expression in islet neogenesis in hamsters. J Clin Invest 1997;99:2100–9. [4] Flores LE, García ME, Borelli MI, Del Zotto H, Alzugaray ME, Maiztegui B, Gagliardino JJ. Expression of islet neogenesis-associated protein (INGAP) in islets of normal hamsters. J Endocrinol 2003;177:243–8. [5] Rafaeloff-Phail R, Schmitt E, Edlund H, Gold G, Vinik AI. Expression of INGAP during ontogeny of the pancreas. Diabetes 1998;47(Suppl 1):A259 [Abstract]. [6] Del Zotto H, Borelli MI, Flores L, García ME, Gómez Dumm CL, Chicco A, Lombardo YB, Gagliardino JJ. Islet neogenesis: an apparent key
M.I. Borelli et al. / Regulatory Peptides 140 (2007) 192–197
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14] [15]
[16] [17]
[18]
[19]
component of long-term pancreas adaptation to increased insulin demand. J Endocrinol 2004;183:321–30. Rafaeloff-Phail R, Schmitt E, Sandusky G, Rosenberg L, Gold G, Borts T, Duguid W, Vinik AI. INGAP is a human cytokine expressed only in the presence of islet neogenesis. Diabetes 1998;47(Suppl 1):A259 [Abstract]. Semakula C, Pambuccian S, Gruessner R, Kendall D, Pittenger G, Vinik A, Seaquist ER. Clinical case seminar: hypoglycemia after pancreas transplantation: association with allograft nesidiodysplasia and expression of islet neogenesis-associated peptide. J Clin Endocrinol Metab 2002;87:3548–54. Rosenberg L, Lipsett M, Yoon JW, Prentki M, Wang R, Jun HS, Pittenger GL, Taylor-Fishwick D, Vinik AI. A pentadecapeptide fragment of islet neogenesis-associated protein increases beta-cell mass and reverses diabetes in C57BL/6J mice. Ann Surg 2004;240:875–84. Borelli MI, Stoppiglia LF, Rezende LF, Flores LE, Del Zotto H, Boschero AC, Gagliardino JJ. INGAP-related pentadecapeptide: its modulatory effect upon insulin secretion. Regul Pept 2005;131:97–102. Barbosa H, Bordin S, Stoppiglia L, Silva K, Borelli M, Del Zotto H, Gagliardino J, Boschero A. Islet Neogenesis Associated Protein (INGAP) modulates gene expression in cultured neonatal rat islets. Regul Pept 2006;136(1–3):78–84. Tam J, Rosenberg L, Maysinger D. Islet-neogenesis-associated protein enhances neurite outgrowth from DRG neurons. Biochem Biophys Res Commun 2002;291:649–54. Rosenberg L, Kahlenberg M, Vinik AI, Duguid WP. Paracrine/autocrine regulation of pancreatic islet cell proliferation and differentiation in the hamster: studies using parabiosis. Clin Invest Med 1996;19:3–12. Stewart JM, Young JD. Solid phase peptide synthesis. 2nd edn. Rockford, Illinois: Pierce Chemical Co.; 1984. Linde S, Hansen B, Lernmark A. Stable iodinated polypeptide hormones prepared by polyacrylamide gel electrophoresis. Anal Biochem 1980;107:165–76. Turyn D, Dellacha JM. Specific binding of iodinated bovine growth hormone to rat liver in vivo. Endocrinology 1978;103:1190–5. Hsu SM, Raine L, Fanger H. Use of avidin–biotin–peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 1981;29:577–80. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–9. Lacy PE, Kostianovsky M. Method for the isolation of intact islets of Langerhans from the rat pancreas. Diabetes 1967;16:35–9.
197
[20] Sambrook J, Fritsch EF, Maniatis TE. Molecular cloning: a laboratory manual. 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory; 1989. [21] Del Zotto H, Massa L, Rafaeloff R, Pittenger GL, Vinik A, Gold G, ReifelMiller A, Gagliardino JJ. Possible relationship between changes in islet neogenesis and islet neogenesis-associated protein-positive cell mass induced by sucrose administration to normal hamsters. J Endocrinol 2000;165:725–33. [22] Abe M, Nata K, Akiyama T, Shervani NJ, Kobayashi S, TomiokaKumagai T, Ito S, Takasawa S, Okamoto H. Identification of a novel Reg family gene, RegIIIdelta, and mapping of all three types of Reg family gene in a 75 kilobase mouse genomic region. Gene 2000;246:111–22. [23] Sasahara K, Yamaoka T, Moritani M, Yoshimoto K, Kuroda Y, Itakura M. Molecular cloning and tissue-specific expression of a new member of the regenerating protein family, islet neogenesis-associated protein-related protein. Biochim Biophys Acta 2000;1500:142–6. [24] Terazono K, Uchiyama Y, Ide M, Watanabe T, Yonekura H, Yamamoto H, Okamoto H. Expression of reg protein in rat regenerating islets and its colocalization with insulin in the beta cell secretory granules. Diabetologia 1990;33:250–2. [25] Taylor-Fishwick DA, Rittman S, Kendall H, Roy L, Shi W, Cao Y, Pittenger GL, Vinik AI. Cloning genomic INGAP: a Reg-related family member with distinct transcriptional regulation sites. Biochim Biophys Acta 2003;1638:83–9. [26] Graf R, Schiesser M, Reding T, Appenzeller P, Sun LK, Fortunato F, Perren A, Bimmler D. Exocrine meets endocrine:pancreatic stone protein and regenerating protein—two sides of the same coin. J Surg Res 2006;133:113–20. [27] Roth J. Peptide hormone binding to receptors: a review of direct studies in vitro. Metabolism 1973;22:1059–73. [28] Kono T, Barham FW. The relationship between the insulin-binding capacity of fat cells and the cellular response to insulin. Studies with intact and trypsin-treated fat cells. J Biol Chem 1971;246:6210–6. [29] Freychet P. Interactions of polypeptide hormones with cell membrane specific receptors: studies with insulin and glucagon. Diabetologia 1976;12:83–100. [30] Kobayashi S, Akiyama T, Nata K, Abe M, Tajima M, Shervani NJ, Unno M, Matsuno S, Sasaki H, Takasawa S, Okamoto H. Identification of a receptor for reg (regenerating gene) protein, a pancreatic beta-cell regeneration factor. J Biol Chem 2000;275:10723–6.