Transcriptional Regulation of the Murine 3′ IgH Enhancer by OCT-2

Immunity, Vol. 11, 517–526, November, 1999, Copyright 1999 by Cell Press

Transcriptional Regulation of the Murine 39 IgH Enhancer by OCT-2 Hong Tang and Phillip A. Sharp* Center for Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge, Massachusetts 02139

Summary Targeted disruption of either of the B cell–specific transcription factors Oct-2 or OCA-B/BOB-1/OBF-1 dramatically affects B cell terminal differentiation. The 39 enhancer of immunoglobulin heavy chain (IgH) locus is important for transcription of the locus in terminal plasma cells. Allele-specific suppression of mutant Oct-2 binding sites in this enhancer by a variant Oct-2 protein revealed that in a mature B cell line this enhancer was specifically dependent upon Oct-2, as contrasted to the closely related Oct-1 transcription factor. Phosphorylation of the Oct-2 protein was important for this activation and was synergistic for coactivation by the OCA-B factor. These results indicate that Oct-2 and OCA-B interact with the 39 enhancer in regulation of the IgH locus during B cell activation.

Introduction Key regulatory elements for transcriptional control of the IgH locus include the 59 proximal promoter (59 VH), the intronic enhancer (Em), and the 39 IgH enhancer. The murine 39 IgH enhancer spans z30 kb and is located z4 kb downstream of the constant gene Ca. It consists of four DNase I hypersensitive segments, designated Ca39E (Matthias and Baltimore, 1993), HS1/2 (Pettersson et al., 1990; Dariavach et al., 1991; Lieberson et al., 1991), HS3, and HS4 (Madisen and Groudine, 1994). The importance of individual enhancer elements may vary during B cell differentiation, but they concert, together with Em, to exert their effects (Madisen and Groudine, 1994; Chauveau et al., 1998; Ong et al., 1998). Transfection experiments also indicate that HS1/2-HS3-HS4 functions as a locus control region (LCR) active during late stages of B cell development (Madisen and Groudine, 1994; Madisen et al., 1998). These elements may be redundant, as gene targeting of Ca39E or HS1/2 (Manis et al., 1998) or a naturally occurring deletion of Ca39E and HS1/2 (Saleque et al., 1999) does not affect IgH gene expression or class switching recombination (CSR), but a spontaneous deletion of the entire 39 enhancer region causes a severe reduction in IgH expression in a plasmacytoma cell line (Gregor and Morrison, 1986; Michaelson et al., 1995). A highly conserved octamer binding site, 59-ATGC AAAT-39 (octWT), is present in all promoters and enhancers of the IgH gene (Matthias, 1998). The octamer * To whom correspondence should be addressed (e-mail: sharppa@ mit.edu).

element itself can render B cell specificity to an unrelated core promoter in transcription assays both in vivo and in vitro (Dreyfus et al., 1987; Wirth et al., 1987; Annweiler et al., 1994). Indeed, transgenic experiments indicate that the octamer motif is the most critical regulatory element for B cell–specific activity of the 59 VH promoter (Jenuwein and Grosschedl, 1991). In B cells, the octamer element is recognized by the Oct-1 and Oct-2 proteins, which share a highly conserved bipartite POU domain, consisting of a homeodomain (POUH) and a POU-specific domain (POUS; Herr et al., 1988). As contrasted to the POU domain, the N and C termini of Oct-1 and Oct-2 are very divergent. These two proteins are thought to have distinct roles in the regulation of immunoglobulin gene expression. Oct-1 is a ubiquitous factor expressed in most cell types, while Oct-2 is predominantly B cell–specific and essential for terminal differentiation of B cells (Matthias, 1998). Reconstitution of SCID or RAG2/2 mice with Oct-22/2 fetal liver cells reveals that the development of B cells in the bone marrow is normal, yet the number of mature B cells is dramatically reduced in blood and lymphoid organs. These chimeras have reduced serum levels of IgM, IgG1, IgG3, and IgG2b (Corcoran and Karvelas, 1994; Humbert and Corcoran, 1997). The possibility that Oct-2 might be important for secretion of these Ig isotypes is supported by the concordant expression patterns of Oct-2 and Ig secretion in response to IL-6 during B cell terminal differentiation (Natkunam et al., 1994). OCA-B (OBF-1, Bob-1) is a B cell–specific cofactor of Oct-1 or Oct-2 that directly interacts with these proteins. It also makes specific protein-base contacts in the major groove of the conserved octamer element (Cepek et al., 1996). Like Oct-22/2 mice, early stages of B cell development in the bone marrow are not affected in OCA-B2/2 mice. Germinal center formation is completely abolished in OCA-B2/2 mice, with decreased serum titers of IgA, IgG1, IgG2a, IgG2b, IgG3, and IgE but not IgM (Kim et al., 1996; Nielsen et al., 1996; Schubart et al., 1996), although the development of plasma cells is intact (Qin et al., 1998). The molecular mechanisms by which Oct-2 exerts its transactivation are still vague, although its activation and repression domains have been mapped by using artificial promoters or enhancers (Tanaka and Herr, 1990; Tanaka et al., 1994; Friedl and Matthias, 1995). An increasing body of evidence indicates that Oct-2 is probably important for the 39 IgH enhancer activity. First, transfection into a WEHI 231 cell line deficient in Oct-2 indicates that this factor is not required for octamerspecific promoter function but is essential for activity from an artificial octamer-containing enhancer (Feldhaus et al., 1993). Second, DNase I footprinting experiments showed in vivo that the octamer motif within HS1/2 becomes protected in response to activation of B cells by either lipopolysaccharide (LPS) treatment, IgM crosslinking, or CD40 ligation (Arulampalam et al., 1994; Grant et al., 1995, 1996). Third, as mentioned above, Oct-22/2

Immunity 518

mice strains are defective in B cell terminal differentiation and in secretion of certain Ig isotypes, the cellular functions regulated by the 39 IgH enhancer. Cell culture experiments indicate that Oct-2 is also required for normal humoral responses to both T cell– dependent (TD) and T cell–independent (TI) antigens (Humbert and Corcoran, 1997). Therefore, Oct-2 may serve as a target for LPS and cytokine-driven signal transduction involved in B cell terminal differentiation (Coffman et al., 1993). During this transition, LPS induces both B cell differentiation and proliferation (Kearney and Lawton, 1975; Kearney et al., 1976). The protein kinase C (PKC) signaling pathway is activated by LPS (Rush and Waechter, 1987; Gupta et al., 1988; Li et al., 1992; Yuan et al., 1992) and may regulate Ig synthesis and secretion (Li et al., 1992; Yuan et al., 1992; Arulampalam et al., 1994). We have investigated the functional importance of the interactions of Oct-2 with the 39 IgH enhancer during B cell terminal differentiation. We establish that Oct-2 directly regulates 39 IgH enhancer activity and that phosphorylation of Oct-2 is an important aspect of this regulation. We also demonstrate a synergistic activation of Oct-2 by OCA-B when B cells are activated by LPS. Results Requirement of the Octamer Motif for the 39 IgH Enhancer Function The 39 IgH enhancer contains four highly conserved octamer sites, suggesting that a unique role of Oct-2 in B cell development might depend on its binding to these sites. To test the dependence on octamer sites in the 39 IgH enhancer, each of the four conserved octamer sites in the construct pGL3-VE was substituted with octGG (ATGCAAGG; Pomerantz and Sharp, 1994) to create pGL3-VE/1-4GG (Figure 1A). When these two constructs were transfected into a series of different B cell lines corresponding to different developmental stages of B cells, only the M12 line, a nonsecreting mature B cell line (Laskov et al., 1981), exhibited a clear dependence on the presence of the octamer sequences (Figure 1B). The construct containing the wild-type enhancer was consistently 2- to 3-fold more active than that containing the mutant octamer sites. This octamer dependence of the 39 IgH enhancer was neither observed in other mature, Ig-secreting plasmacytoma lines, for example, MPC 11, MOPC 31, or S194, nor in the pre-B cell line HAFTL or the B cell line WEHI 231 (Figure 1B). Moreover, the dependence of the enhancer on the octamer elements was partial because the mutant enhancer construct had 4-fold higher activity than enhancerless 59 VH construct (Figure 1C). This is not surprising, as the enhancer is known to bind other transactivating factors (Grant et al., 1995; Michaelson et al., 1996; Linderson et al., 1997). This suggests that the octamer sites within the enhancer might have a more critical and physiological role in transcription activity in the M12 cell line than many other B cell lines. Establishment of an Altered DNA-Binding Specificity System We have previously found that a double mutation of the homeodomain of Oct-1, V425R and N429R (Oct-1RR

Figure 1. Construction of 39 IgH Enhancer Reporter Vectors and Transient Transfection Analyses (A) The wild-type enhancer reporter (pGL3-VE) contains luciferase gene (gray oval), whose expression is driven by the 59 VH (hatched oval), and a combination of HS1/2 (dotted box), HS3 (gray box), and HS4 (open box). The conserved octamer motif within each enhancer segments (open circle) was mutagenized to octGG (cross) to yield mutant reporter pGL3-VE/1–4GG (see Experimental Procedures). The conserved octamer motif within 59 VH was kept intact in order to facilitate analysis of “cross-talk” between the promoter and the enhancer. The reference octamer-dependent promoter reporter pGL3-VH contains the 59 VH (hatched oval), and the octamer site was mutated to octGG (cross) analogously to yield pGL3-VH-GG. (B) Octamer dependence. pGL3-VE (3 mg; black bar) or pGL3-VE/ 1–4GG (3 mg; open bar) were transiently transfected into different cell lines representing developmental stages at the pre-B (HAFTL), B (WEHI 231), or mature B cell (M12, MOPC 31, MPC 11, and S194). Luciferase activities were measured 43 hr postelectroporation. Representative results were shown as the relative luciferase activity of mutant/wild-type reporter averaged from two independent transfections. (C) Comparison of the enhancer versus enhancerless reporter activity. M12 cells were transfected with 3 mg pGL3-Basic, pGL3-VH, pGL3-VE, and pGL3-VE/1–4GG, and luciferase activities were averaged from three independent assays with SD presented as error bars.

POU), specifically recognizes octGG with high affinity and specificity (Pomerantz and Sharp, 1994). In order to set up an enhancer reporter system that is responsive to exogenous Oct-2 protein, an altered DNA-binding specificity mutant of Oct-2 was constructed. Since the POU domain is highly conserved between Oct-1 and Oct-2, the corresponding mutations V343R/N347R of Oct-2 (Oct-2RR) should also bind with affinity and specificity to the same variant octamer sequence. To confirm this, both full-length octamer binding factors and arginine

Oct-2 and the 39 IgH enhancer 519

Figure 2. Gel Shift Analysis of Altered DNA-Binding Specificity Mutants of Oct-1RR and Oct-2RR Wild-type and RR mutant derivatives of Oct-1 and Oct-2 were produced as described (see Experimental Procedures). Lysates (4 ml) containing Oct-1 (lane 2) and Oct-1RR (lane 3) or Oct-2 (lane 4) and Oct-2RR (lane 5) were used in EMSA. The amount of Oct-1 or Oct-1RR was about two times less than Oct-2 or Oct-2RR as quantified by the incorporation efficiency of 35S-methionine in a separated in vitro translation reaction (data not shown). (A) 0.5–1 nM of octWT or (B) octGG DNA probe was used. Lane 1 was mock reactions with 4 ml reticulocyte lysates. The apparent Kd was measured in a separate experiment not shown here, and the midpoint of binding was shown.

mutant proteins were generated by translation in vitro and their DNA-binding activities at octWT or octGG site were assessed by electrophoretic mobility shift assays (EMSA; Figure 2). As expected, wild-type Oct-1 and Oct-2 proteins selectively bound to wild-type octamer probe with .25-fold higher affinity than the Oct-1RR and Oct-2RR proteins (Figure 2A, compare lanes 2 and 3 and lanes 4 and 5). Also as expected, Oct-1RR or Oct-2RR protein bound the variant octamer site octGG site with .15-fold or .20-fold higher affinity than wild-type Oct-1 or Oct-2 protein, respectively (Figure 2B, compare lanes 2 and 3 and lanes 4 and 5). Previous results have shown that Oct-1RR POU domain protein binds to the octGG site with 150-fold lower affinity than that of the Oct-1 POU domain protein for the octWT site (Pomerantz and Sharp, 1994). This difference is not apparent from the experiment shown in Figure 2B, where higher Oct-related protein concentrations were assayed in the presence of added nonspecific DNA. The important observation is that Oct-2RR exhibits allele-specific binding, which is consistent with our previous studies on DNA-binding activity of the Oct-1RR POU domain at the octGG site (Pomerantz and Sharp, 1994) and reminiscent of recent genetic screening results (Shah et al., 1997). Oct-2 but Not Oct-1 Is Active at the 39 IgH Enhancer DNA sequences encoding the FLAG epitope were inserted at the N terminus of the wild-type or arginine mutant Oct-2 proteins and the plasmids were transiently cotransfected into the M12 cell line with the reporter pGL3-VE/1-4GG. In this assay, cells were treated with LPS to increase the total stimulation of expression (see below). Overexpression of FLAG-Oct-2RR increased reporter activity by z4-fold compared to that with FLAGOct-2. However, overexpression of Oct-1RR did not dramatically increase expression of the reporter gene as

Figure 3. Differential Transcription Activity of Oct-1 and Oct-2 at the 39 IgH Enhancer (A) pGL3-VE/1–4GG (black bar) was transient transfected into M12 with pCG-FLAG-Oct-1 or pCG-FLAG-Oct-2 or with their suppressor mutants, pCG-FLAG-Oct-1RR or pCG-FLAG-Oct-2RR (hatched bars). Cells were treated with 50 mg/ml LPS overnight before being analyzed. Specific activity was derived by comparison of reporter activity of the alanine mutant proteins versus wild-type octamer binding proteins. The bottom panel represents the immunoblotting of each FLAG-tagged Oct proteins expressed under assay conditions normalized against b-galactosidase activities. (B) pGL3-VH (black bar) and pGL3-VH-GG (gray bar) were transient transfected analogously into M12, together with pCG-FLAG-Oct-1 or pCG-FLAG-Oct-2 or with their suppressor mutants, pCG-FLAGOct-1RR or pCG-FLAG-Oct-2RR (hatched bars). Data are presented as the relative luciferase activity of that with overexpressed Oct proteins versus with reporter vector alone.

compared with FLAG-Oct-1 (Figure 3A, compare lanes 4 and 5 and lanes 2 and 3). This stimulation was allele specific, as the enhancer reporter was not significantly stimulated by overexpression of either the wild-type Oct-1 or Oct-2 proteins (Figure 3A, lanes 2 and 4). The slight increase in the enhancer reporter activity may be due to increased 59 VH promoter activity caused by overexpressed wild-type Oct-1 or Oct-2 (Figure 3B). The protein expression levels were verified by Western blotting using the M5 anti-FLAG mAb (Figure 3A, bottom panel). Moreover, both the wild-type and arginine mutant variant Oct-1 or Oct-2 proteins were active when overexpressed in M12 cells. This was indicated by their

Immunity 520

Figure 4. Mitogenic Effects of LPS on M12 Cells (A) Induction of Blimp-1 expression verified by RT–PCR. M12 (lanes 1 and 2), MPC 11 (lanes 3 and 4), and S194 (lanes 5 and 6) cells were treated with 50 mg/ml LPS overnight. Blimp-1-specific cDNA (upper panel) was amplified by RT–PCR (primers: GGACTGGGTGGA CATGAGAGAG/GAAGTACCCCCGTCAGCGCCG). The gel loading was normalized by the control amplification of b-actin (lower panel). (B) Time course of Oct-2RR-dependent enhancer activity in response to LPS. M12 cells were transiently transfected with pGL3-VE/1–4GG alone (triangle) or cotransfected with pGL3-VE/1–4GG and pCGOct-2RR (circle). Luciferase activities with LPS (filled) or without LPS (open) were measured at different time points as indicated.

ability to transactivate an octamer-dependent reporter, pGL3-VH, or its octGG variant, pGL3-VH-GG (Figure 3B; for plasmid construction, see Figure 1). These results strongly indicate that Oct-2 has a unique function when interacting with the 39 IgH enhancer in the M12 cells. Oct-2 May be Modified by Protein Kinase C The activation of B cells by the T cell–independent stimulus LPS is defective in Oct-22/2 B cells in culture (Corcoran et al., 1994; Humbert and Corcoran, 1997). To first test whether M12 cells respond to LPS treatment for limited differentiation, RT–PCR was performed to verify the upregulation of B lymphocyte–induced maturation protein (Blimp-1) expression, a specific molecular marker of early plasma cells (Turner et al., 1994). As shown in Figure 4A, LPS treatment of M12 cells enhanced Blimp-1 expression by more than 5-fold, while the same stimulus failed to change the levels of the Blimp-1 transcript in MPC11 or S194 cells (upper panel). This result indicates that LPS can drive M12 cells to further differentiate into plasma cells, the transition phase essentially dependent upon Oct-2 protein activity. To determine whether LPS can potentiate Oct-2-dependent 39 IgH enhancer activity, M12 cells cotransfected with pGL3-VE/1–4GG and Oct-2RR were either treated or

not treated with LPS. LPS dramatically increased Oct2RR-dependent enhancer activity as contrasted to the much more modest stimulation when the mutant reporter was transfected alone (Figure 4B). The LPS enhancement was dose dependent (data not shown) and did not reach a plateau even after 24 hr. The most likely mechanism for LPS stimulation of B cell differentiation is through the PKC signaling pathway, which is independent of Ca21 mobilization and phosphoinositol turnover (Dearden-Badet and Revillard, 1993; Mey and Revillard, 1998). To test if this is the case, the levels of Oct-2RR-dependent enhancer activity were assayed when LPS treatment was performed in the presence of different kinase inhibitors: staurosporine (80 nM) for PKC, HA1004 (20 mg/ml) for protein kinase A (PKA), genestein (30 mM) for PTK, PB95058 (4 mM) for MAPKp42, and SB203580 (2 mM) for MAPKp38. Staurosporine inhibited the reporter activity by 6-fold, while the other inhibitors had marginal effects, indicating that LPS activation of Oct-2-dependent transcription might act through the PKC pathway. At this concentration, staurosporine was previously shown to specifically inhibit LPS stimulation of IgM production in B cells (Yuan et al., 1992). The LPS signaling pathway involves phosphorylation of target proteins by PKC. Optimal substrate sites for phosphorylation by PKC have been determined (Nishikawa et al., 1997) and were used to predict potential PKC phosphorylation targets within the Oct-2 protein. Thr-302 and Ser-303 of the Oct-2 POUH domain scored strongly as putative phosphorylation targets for PKCs (SP $ 3 and probability $ 75%; data not shown). The same sites are good substrates for protein kinase A (PKA), and the identical conserved serine residue of the Oct-1 POUH domain has been shown to be phosphorylated by PKA (Segil et al., 1991). To evaluate the contribution of T302 and S303 to phosphorylation of Oct-2, each or both of these sites were mutated to alanine in FLAG-Oct-2-T302A, FLAGOct-2-S303A, or FLAG-Oct-2-T302A/S303A. These constructs were transfected into M12 cells, which were then treated with LPS, and metabolically labeled with 32 P-orthorphosphate. Extracts prepared from these cells were immunoprecipitated with FLAG antibodies. The autoradiographs of the immunoprecipitates revealed that the T302A and S303A mutations diminished significantly the level of phosphorylation of Oct-2, suggesting that these two sites probably serve as the major phosphorylation targets for PKC in vivo (Figure 5A, upper panel). In parallel, the total amount of FLAG-Oct-2 proteins immunoprecipitated was determined by Western blotting with antisera specific to Oct-2 (Figure 5A, lower panel). All four transfections yielded similar levels of Oct-2 related polypeptides. The phosphorylation of Oct-2 by PKC in vitro was analyzed by two-dimensional phosphopeptide mapping using either recombinant Oct-2 POU domain protein or T302A, S303A mutant variants (see Experimental Procedures). The wild-type Oct-2 POU domain showed a distinct pattern of tryptic fragments (Figure 5B, solid arrows in panel I) of which two disappeared in T302A mutant derivative (Figure 5B, panel II) and one disappeared in S303A variant (Figure 5B, panel III). Because the phosphorylation was done with purified conventional PKC

Oct-2 and the 39 IgH enhancer 521

the potential tryptic fragment (amino acids 299–310) containing T302 and S303 was synthesized and subject to the analogous phosphorylation and two-dimensional mapping (see Experimental Procedures). Trypsin digestion of the phosphopeptide generated two fragments (Figure 5B, panel V) that comigrated with those from the trypsin digestion of the full-length Oct-2 POU domain when the two samples were mixed and run together (Figure 5B, panel IV). Thus, alanine mutation at T302 and S303 inactivates phosphorylation at these sites by PKC, consistent with a reduction in the level of phosphorylation in vivo with mutant analogs.

Figure 5. Characterization of Alanine Mutants at Potential PKC Sites on Oct-2RR-Dependent Enhancer Activities (A) In vivo 32P labeling to assess phosphorylation states of wild-type and alanine mutants of Oct-2. FLAG-tagged Oct-2 (20 mg; lane 2), Oct-2-T302A (lane 3), Oct-2-S303A (lane 4), and Oct-2-T302A/S303A (lane 5) were transfected into M12 (two of 100 mm dishes) with 50 mg/ml LPS for 23 hr before immunoprecipitation. Protein loading was normalized using rabbit anti-Oct-2 serum by a separate immunoblotting (lower panel), so that equal amounts of wild-type and mutant Oct-2 proteins were used to measure the intensity of 32P incorporation (upper panel). (B) Top panel: two-dimensional phosphopeptide mapping of Oct-2 POU domains phosphorylated by PKC. His-Oct-2 POU (I), His-Oct-2 POU/302A (II), and His-Oct-2 POU/303A (III) (z2000 cpm of each) were loaded for TLC (see Experimental Procedures). Solid arrows indicate tryptic peptides specific for T302 and/or S303; open arrows indicate those without T302 and/or S303 residues. Inserts indicate total phosphorylated proteins before TPCK-trypsin digestion and ovals indicate the loading origins. Bottom panel: 1000 cpm (IV) or 4000 cpm (V) of POU2 WT phosphopeptide was either mixed with trypsin-digested His-Oct-2 POU or loaded alone, respectively. (C) Analysis of transactivation by potential PKC target mutants of Oct-2 (top panel). Six micrograms of either pCG-FLAG-Oct-2RR, pCG-FLAG-Oct-2RR-T302A, pCG-FLAG-Oct-2RR-S303A, or pCGFLAG-Oct-2RR-T302A/S303A was transiently cotransfected with 3 mg of pGL3-VE/1–4GG into M12 cells in the presence of 50 mg/ml LPS for 23 hr before luciferase assays. The amount of FLAG-tagged Oct-2 proteins expressed was verified by immunoblotting with M5 anti-FLAG antibodies (bottom panel).

preparations (containing a, b, g, d, and other isozymes), the POU domain was significantly phosphorylated at sites other than those altered in the T302A or S303A variants (Figure 5B, open arrows). Phosphorylation at these sites did not vary among the three proteins and is considered nonspecific. A peptide corresponding to

Oct-2 May Contain a Novel Transactivation Domain Functioning at the 39 IgH Enhancer The roles of the two potential PKC target residues in regulation of the 39 IgH enhancer by Oct-2 were examined by cotransfecting M12 cells with the Oct-2RRdependent reporter and plasmids encoding FLAG-Oct-2RR containing the T302A, S303A, or T302A/S303A mutations. If reporter basal activity was subtracted, the reporter activity was reduced slightly with Oct-2RR-T302A compared to that of Oct-2RR, by 3-fold with Oct-2RRS303A, and almost vanished with double mutant Oct2RR-T302A/S303A (Figure 5C, upper panel). The mutations did not effect the stability of the Oct-2 proteins as Western blotting of extracts from the transfected M12 cells revealed comparable levels of Oct-2 proteins (Figure 5C, lower panel). These results suggest that phosphorylation of T302 and S303 of Oct-2 is critical for transactivation by Oct-2 at the 39 IgH enhancer. The reduction in reporter enhancer activity caused by the T302A and S303A mutations in Oct-2 could be due to defects in DNA binding. In the Oct-1 POU domain/ DNA complex, the equivalent threonine residue of Oct-1 makes a side-chain contact with the phosphosugar backbone (Klemm et al., 1994). To show whether the alanine mutation affects the DNA binding activity of Oct-2, EMSA was performed using nuclear extracts prepared from LPS-treated M12 transfectants containing overexpressed Oct-2RR or its alanine mutants. The probe containing octGG was used to detect DNA binding by the transfected Oct-2RR variants but not endogenous factors. Oct-2RR and the alanine mutant derivatives were able to bind to DNA with similar affinity (Figure 6A, lanes 5, 7, 9, and 11). The low level of complex formation by Oct-2RR-T302A (lane 7) and Oct-2RR-T302A/S303A (lane 11) were due to their relatively lower protein expression levels (data not shown). Moreover, the differences in transcriptional activation by Oct-2RR and its alanine mutant derivatives were not due to differences in their subcellular localization, as each protein had an identical nuclear localization when examined by fluorescence immunostaining against the FLAG epitope (data not shown). As mentioned above, previous studies have shown that PKA phosphorylation of Oct-1 at the site equivalent to S303 inactivated DNA binding. This apparent contradiction with the binding of phosphorylated Oct-2 was investigated using EMSA to assess DNA binding as a function of phosphorylation of Oct proteins. PKA specifically phosphorylated Oct-2 POU at T302 and S303 (Figure 6B, bottom panel; data not shown), which mimicked

Immunity 522

Figure 7. Effects of OCA-B at the 39 IgH Enhancer M12 was transiently cotransfected with pGL3-VE/1–4GG alone (black bar), 2 mg pCATCH-Bob-1/OCA-B (dotted bar), or pCG-Oct2RR alone (gray bar), or in combination with either 6 mg of pCG-Oct2RR or various alanine mutants of Oct-2RR (hatched bars). Enhancer reporter activities were measured 23 hr after electroporation in the presence of 10 mg/ml LPS.

Figure 6. Protein–Protein Interaction between Oct-2 and OCA-B (A) EMSA analysis of potential alanine mutants. Nuclear extracts were prepared from transfectants used in previous transfection experiments, and EMSA was performed using octGG as the probe (see Experimental Procedures). Equal amounts of total nuclear proteins, as judged by the Bradford assay, containing Oct-1RR (lanes 3 and 4), Oct-2RR (lanes 5 and 6), Oct-2RR-T302A (lanes 7 and 8), Oct-2RRS303A (lanes 9 and 10), or Oct-2RR-T302A/S303A (lanes 11 and 12) were used. Lanes 1 and 2 showed nuclear extracts from a mock transfection. GST-OCA-B (150 ng) was used in the supershift reactions (lanes 2, 4, 6, 8, 10, and 12). (B) Differential DNA binding by phosphorylated Oct protein. EMSA analysis of DNA binding by Oct-2 POU domains in the function of phosphorylation by PKA. Sixty nanograms of Oct-1 POU (lanes 3–5), Oct-2 POU (lanes 6–8), Oct-2 POU/302A (lanes 9–11), and Oct-2 POU/303A (lanes 12–14) from PKA kinase reaction were used (see Experimental Procedures). Reaction with the free probe (lane 1) and PKA alone (lane 2) was also shown.

closely the specific phosphorylation patterns of Oct-2 POU domain by PKC in vivo (Figure 5A). With increasing concentrations of PKA, the Oct-2 POU domain maintained its binding activity regardless of the level of protein phosphorylation (Figure 6B, top panel, lanes 6–8). A similar DNA-binding behavior was also observed with less-phosphorylated T302A and S303A Oct-2 POU domains (lanes 9–11 and 12–14). Strikingly, also in agreement with previous observations (Segil et al., 1991), increasing phosphorylation of the Oct-1 POU domain strongly inhibited its DNA binding (lanes 5). Synergy between Oct-2 and OCA-B at 39 IgH Enhancer The phenotypes of OCA-B2/2 mice partially overlap those of an Oct-2 null mutant, indicating that these two factors may interact for normal B cell development. To determine whether OCA-B is involved in the regulation

of the 39 IgH enhancer, a plasmid expressing OCA-B was transiently cotransfected with the plasmid expressing Oct-2RR into M12 cells. The M12 cells were treated for 24 hr with LPS. Coexpression of Oct-2RR with OCA-B stimulated the reporter activity by more than 25-fold as compared to that with OCA-B alone, or z6 fold if compared to that with Oct-2RR alone (Figure 7), indicating that OCA-B coactivates with Oct-2. This activation could reflect a synergism between Oct-2RR and OCA-B at the enhancer or interaction of overexpressed OCA-B with an octamer protein bound to the intact 59 VH. The OCA-B protein possesses activation domains (Babb et al., 1997) and its overexpression and recruitment to the 39 IgH enhancer by Oct-2 could potentially bypass the need for phosphorylation of Oct-2 in activation of the 39 IgH enhancer. To test this possibility, transient cotransfection analyses were performed with OCA-B and the alanine mutants of Oct-2RR. Overexpression of OCA-B failed to alleviate the defect resulting from alanine substitution of T302 or S303 of Oct-2RR, with S303 being more critical for such synergistic activation (Figure 7). It is unlikely that mutation of either these two residues would have direct effects on the binding of OCA-B to the Oct-2/octamer complex. This notion is supported by EMSA, in which addition of purified fusion protein GST-OCA-B generated a supershift of DNA complexes containing either Oct-2 or its alanine mutants (Figure 6A, lanes 6, 8, 10, and 12). Therefore, we conclude that phosphorylation of Oct-2 is required for activation of the 39 IgH enhancer by the coactivator OCA-B. Discussion Allele-specific interactions between a variant sequence of the octamer site, octGG, and a mutant Oct-2 protein with two arginine substitutions, Oct-2RR, has shown that the 39 IgH enhancer is dependent upon the Oct-2 protein

Oct-2 and the 39 IgH enhancer 523

in the plasmacytoma cell line M12. This dependence is specific for Oct-2 as contrasted to Oct-1, which has the same DNA-binding specificity. Activation of the 39 IgH enhancer by Oct-2 is stimulated by LPS treatment, probably due to phosphorylation of threonine and serine residues located in the linker segment between the two subdomains of the POU domain. Mutations of these sites to alanine inactivate Oct-2 in this transcriptional context. Furthermore, overexpression of the cofactor OCA-B in M12 cells synergistically potentiates activation by Oct-2 at the 39 IgH enhancer, suggesting that these two proteins coactivate this enhancer element. This coregulation is also inactivated if the threonine and serine residues in the linker region of Oct-2 are mutated to alanine. These results suggest that Oct-2 and OCA-B are critical for full activation of B cells and that their functions can be studied through their interactions with the 39 IgH enhancer. M12 cells are Ig nonsecreting (Laskov et al., 1981), Syndican-1 bearing (unpublished data) early plasma cells. This would be consistent with considering M12 cells as arrested at a very early stage in the development of terminal plasma cells, a transition that is crucially dependent upon Oct-2 (Humbert and Corcoran, 1997). LPSinducible expression of Blimp-1 reported here also supports this notion. Therefore, it should not be surprising that the M12 cell line, as compared to other tumor B cell lines, is unusually dependent for expression of the IgH promoter upon the interaction between Oct-2 and the 39 IgH enhancer and is responsive to expression of the Oct-2 and OCA-B proteins. Oct-22/2 mice exhibit abrogated B cell maturation, reduced secretion levels of certain Ig isotypes, and deficiency in response to TI and TD antigens (Corcoran et al., 1993; Humbert and Corcoran, 1997). It is likely that part of this phenotype of deficiency in IgH expression and perhaps class switching is due to Oct-2’s interaction with the 39 IgH enhancer. The 39 enhancer is uniquely active in late stage of B cells (Madisen and Groudine, 1994; Chauveau et al., 1998; Ong et al., 1998) and large deletions encompassing the whole sequence are defective for transcription of IgH genes. The activation of the 39 IgH enhancer by Oct-2 is also specific when compared to the lack of activity by Oct-1. Most previous transcription assays both in vivo (Pfisterer et al., 1994; Shah et al., 1997) and in vitro (Scheidereit et al., 1987; Pierani et al., 1990; Luo et al., 1992; Annweiler et al., 1993) are not specific for overexpression of Oct-2 versus Oct-1. A few studies have shown that some artificial reporter constructs could be activated more effectively by Oct-2 than by Oct-1, but these results were neither cell type– or cell stage–specific (Tanaka and Herr, 1990; Annweiler et al., 1994; Pfisterer et al., 1994) and the preference for Oct-2 versus Oct-1 appeared to reflect differences in the activation domains of the proteins. Oct-2-dependent 39 IgH enhancer activity is dramatically stimulated by LPS in M12 cells. This is consistent with the proposal that Oct-2 is a component of the signaling pathway used by LPS for normal activation of B cells (Corcoran and Karvelas, 1994; Humbert and Corcoran, 1997). The specific PKC inhibitor staurosporine reduces the bulk level of phosphorylation of Oct-2 protein

and abrogates LPS stimulation of Oct-2-dependent enhancer activity. These observations would be anticipated by the involvement of a PKC signaling pathway. Alanine mutation of the predicted PKC targets T302 and S303 both reduced the level of phosphorylation of the mutant Oct-2 proteins during B cell activation and reduced the potential of these proteins to activate the 39 IgH enhancer. The dependence of Oct-2 activity upon phosphorylation for gene activation is somewhat surprising because phosphorylation of Ser-385 of the Oct-1 POU domain by PKA, which corresponds to S303 of Oct-2, prevents binding of Oct-1 to DNA derived from the histone H3 promoter (Segil et al., 1991). In contrast, phosphorylation of Oct-2 at this site by PKA has no effect on DNA binding in vitro. Phosphorylation of Oct-2 correlates with its activation and most certainly binding to the 39 IgH enhancer. The binding of phosphorylated Oct-2 to the enhancer could be a signal for subsequent association of transcription coactivators similar to the interaction of CREB and CBP. This dependence might explain the decreased activities of variants of Oct-2, which are defective for phosphorylation in vivo. Although the S/T-rich C terminus of Oct-2 has been shown to be a target for phosphorylation in Hela cells (Tanaka and Herr, 1990), the functional importance of this modification has not been described. In contrast, phosphorylation at T302 and S303, with the side chain of S303 being most critical, is probably indispensable for activation of the 39 IgH enhancer during B cell activation. There are several precedents for PKC phosphorylation of specific transcriptional factors during B cell development. For example, CREB has been shown to be phosphorylated by PKC in response to cross-linking of surface Ig on B cells (Xie and Rothstein, 1995). The importance of PKC for normal B cell development is illustrated by targeted disruption of the PKCb gene in mice that exhibit phenotypes similar to X-linked immunodeficiency (xid; Leitges et al., 1996). Our results suggest another role for PKC in B cell activation: stimulation of phosphorylation of the B cell–differentiation factor Oct-2. OCA-B is required for the convergence of multiple signals during B cell activation (Qin et al., 1998). Mice that are OCA-B2/2 produce plasma cells but have reduced levels of circulating immunoglobulins and no germinal centers. The low levels of serum IgG would be consistent with a requirement for OCA-B in the full potentiation of the 39 IgH enhancer. Stimulation of transcription by OCA-B from the enhancer is dependent upon phosphorylation of Oct-2. Because OCA-B only associates with DNA with high affinity when it binds in conjunction with either Oct-1 or Oct-2, its synergistic activity in M12 cells indicates the formation of a multiprotein complex on this enhancer and/or potentially the promoter during B cell activation. These observations are also consistent with these two proteins having overlapping dependencies in B cell activation, with the Oct22/2 phenotype being more severe than the OCA-B2/2 phenotype. The structure of a ternary complex of the POU domain of Oct-1, a DNA segment containing the octamer motif and 44 residues of OCA-B protein, has been recently determined at the atomic level (Chasman et al., 1999).

Immunity 524

All the residues in the POU domain of Oct-1 contacting OCA-B are conserved in Oct-2, suggesting that Oct-2 POU/OCA-B/DNA complex should also adopt identical spatial arrangement. If this were the case, all of the sidechain contacts between Oct-2 and OCA-B would be on the opposite side of the DNA duplex from the T302 and S303 residues of Oct-2. Hence, the binding of OCA-B in this complex would not be expected to be dependent upon phosphorylation of these residues. Supporting evidence is obtained from formation of Oct-2/OCA-B/DNA complexes with the alanine mutants of Oct-2. However, synergistic activation of the enhancer by OCA-B and Oct-2 is inactivated by mutations of these residues to alanine. These observations would be explained if, as proposed above, phosphorylation of Oct-2 signals the binding of a coactivator, which synergistically acts with OCA-B to stimulate transcription. Experimental Procedures Plasmid Construction FLAG tag was inserted in-frame N-terminal to Oct-1, Oct-2, or their mutant variants in pCG-Oct-1 or pCG-Oct-2 (Tanaka and Herr, 1990) by add-on PCR. POU domains of Oct-1 and Oct-2 and its alanine mutants were subcloned in-frame downstream of hexa-His tag in pQE30 (Qiagen). The murine 39 IgH enhancer fragments (HS1/2, 4.3 kb; HS3, 1.2 kb; HS4, 1.4 kb) was isolated by digesting pHS1234 (Madisen and Groudine, 1994) with BssHII and blunt-ended ligated to the SalI site of “pGL-3 Basic” luciferase reporter vector (Promega). The orientation of the enhancer insert was verified by restriction digestions as identical to their genomic organization relative to the transcription start site. The 59 VH promoter region (2164 to 11) was subcloned by add-on PCR from the template pmD2 (Grosschedl and Baltimore, 1985), and inserted into pGL-3 Basic in between HindIII and BglII sites. Point mutagenesis was performed according to manufacturer’s protocol (QuickChange, Stratagene). Primers for mutagenesis (top/ bottom primers): Oct-1RR, GGTGATTCGTAGGTGGTTCTGTAGGCG CCGCCAG/CTGGCGGCGCCTACAGAACCACCTACGAATCACC; Oct-2RR, AGTGATCCGCAGGTGGTTCTGCAGGCGGCGCCAG/CTG GCGCCCCCTGCAGAACCACCTGCGGATCACT; HS1/2-oct-GG, GAA ACAAACATCCCCTTGCATGTGCCCTTGTGAG/CTCACAAGGGCA CATGCAAGGGGATGTTTGTTTC; HS3-oct-GG, CCACACCTGTAA TGCAAGGCTCCCCACACTGTTG/CAACAGTGTGGGGAGCCTTGCAT TACAGGTGTGG; HS4-oct-GG(598), GTAGCACAAACACTCCTTGC ATACATTTCTAAA/TTTAGAAATGTATGCAAGGAGTGTTTGTGCTAC; and HS4-oct-GG(717), CAGAACCGTAAGGAGCCTTGCATGGTGC TTGGG/CCCAGCACCATGCAAGGCTCCTTACGGTTCTG.

by the denaturing method exactly as described previously (Tang et al., 1996). Renatured proteins (200 ng) were phosphorylated in vitro by 8 U or 80 U of PKA in 10 ml with 5 mCi g-32P-ATP (6000 Ci/mmol, NEN) and 200 mM ATP at 308C for 5 min. Phosphorylated proteins (50–60 ng) were then added to the binding reaction and electrophoresis was done as described (Pomerantz and Sharp, 1994) except that additional 100 ng of herring sperm DNA (GIBCO) was added per reaction. EMSA using Oct-1 or Oct-2 overexpressing nuclear extracts was performed as described (Schreiber et al., 1989) but buffer C was supplemented with phosphatase/protease inhibitors (5 mM NaF, 5 mM b-phosphoglycerol, 10 mM Na3P2O7, 1 mM Okadaic acid, 1 mM EDTA, 1 mM EGTA, 1 mg/ml aprotinin, and 1 mg/ml leupeptin). For supershift experiments with OCA-B, nuclear extracts were incubated with DNA for 20 min at 228C; 150 ng recombinant GST-OCA-B fusion protein (Cepek et al., 1996) was then added and incubated for additional 20–30 min at 228C before electrophoresis. Two-Dimensional Phosphopeptide Mapping His-Oct-2 POU proteins (z60 ng) were reacted with 0.04 U PKC according to manufacturer’s manual (Promega) in the presence of 5 mCi g-32P-ATP (6000 Ci/mmol, NEN) and 200 mM ATP at 308C for 5–10 min. Phosphoproteins were then resolved in a 4%–20% SDSPAGE and the two-dimensional phosphopeptide mapping was performed essentially as described (van der Geer and Hunter, 1994), except that plastic cellulose TLC plates (EM Science) and a Multiphor II electrophoretic system were used (Pharmacia). Synthesized peptide (1.5 mg) corresponding to amino acids 299– 310 (POU2 WT, KKRTSIETNVR; AnaSpec) was phosphorylated by 0.04 U of PKC as above. The resulting phosphopeptide was purified by Sep-Pak C18 Light (Waters) and 5% was subject to trypsin digestion and two-dimensional phosphopeptide mapping analogously. Acknowledgments We thank Drs. D. Baltimore, W. Herr, R. Grosschedl, J. Chen, M. Groudine, and L. Cantley for providing various constructs and cell lines. We also thank Dr. K. Nishikawa for his assistance in prediction of PKC targets in Oct-2. For their critical reading of the manuscript, we are grateful to Drs. M. Groudine, D. Tantin, J. Chen, and J. O. Liu. H. T. was supported by a postdoctoral fellowship from Irvington Institute of Medical Science Foundation. This work was supported by United States Public Health Service grant PO1-CA42063 from the National Institutes of Health, by a cooperative agreement CDR8803014 from the National Science Foundation to P. A. S., and partially by National Cancer Institute Cancer Center Support (core) grant P30-CA14051. Received April 4, 1999; revised September 20, 1999. References

Transfection Assays About 4 3 106 cells in 0.4 ml of serum-free media were electroporated using Gene Pulser (BioRad; 4 mm cuvette, 220 V/960 mF). Various concentrations of plasmid DNA used were: 3 mg of promoter/ enhancer reporters, 6 mg of Oct expression vectors, 2 mg of pCATCH-Bob-1 (OCA-B; Cepek et al., 1996), and 1.5 mg of pCMVlacZ as internal control for the transfection efficiency. Variable amounts of herring sperm DNA (GIBCO) were used to keep total DNA (20 mg) constant. Luciferase activities were measured in a luminometer (MGM Instruments) and normalized against b-galactosidase units measured as described (Cepek et al., 1996). Metabolic labeling was performed as described previously (Tanaka and Herr, 1990). EMSA DNA probes (octWT, ACTATCATGCAAATGATCCGG, or octGG, ACTAT CATGCAAGGGATCCGG) were derived from the sequence used in Klemm et al. (1994). Oct-1, Oct-1RR, Oct-2, and Oct-2RR proteins were produced as described (Tanaka and Herr, 1990) but with modified reaction conditions (STP3; Novagen). For EMSA with PKA phosphorylated POU domains, His-tagged POU domain proteins were purified

Annweiler, A., Zwilling, S., Hipskind, R.A., and Wirth, T. (1993). Analysis of transcriptional stimulation by recombinant Oct proteins in a cell-free system. J. Biol. Chem. 268, 2525–2534. Annweiler, A., Zwilling, S., and Wirth, T. (1994). Functional differences between the Oct2 transactivation domains determine the transactivation potential of individual Oct2 isoforms. Nucleic Acids Res. 22, 4250–4258. Arulampalam, V., Grant, P.A., Samuelsson, A., Lendahl, U., and Pettersson, S. (1994). Lipopolysaccharide-dependent transactivation of the temporally regulated immunoglobulin heavy chain 39 enhancer. Eur. J. Immunol. 24, 1671–1677. Babb, R., Cleary, M.A., and Herr, W. (1997). OCA-B is a functional analog of VP16 but targets a separate surface of the Oct-1 POU domain. Mol. Cell. Biol. 17, 7295–7305. Cepek, K.L., Chasman, D.I., and Sharp, P.A. (1996). Sequence-specific DNA binding of the B cell–specific coactivator OCA-B. Genes Dev. 10, 2079–2088. Chasman, D., Cepek, K., Sharp, P.A., and Pabo, C.O. (1999). Crystal structure of a ternary complex containing an OCA-B peptide, Oct-1,

Oct-2 and the 39 IgH enhancer 525

and an octamer element:peptide recognition of a protein-DNA interface. Genes Dev., in press. Chauveau, C., Pinaud, E., and Cogne, M. (1998). Synergy between regulatory elements of the immunoglobulin heavy chain locus and its palindromic 39 locus control region. Eur. J. Immunol. 28, 3048–3056. Coffman, R.L., Lebman, D.A., and Rothman, P. (1993). Mechanism and regulation of immunoglobulin isotype switching. Adv. Immunol. 54, 229–270. Corcoran, L.M., and Karvelas, M. (1994). Oct-2 is required early in T cell–independent B cell activation for G1 progression and for proliferation. Immunity 1, 635–645. Corcoran, L.M., Karvelas, M., Nossal, G.J., Ye, Z.S., Jacks, T., and Baltimore, D. (1993). Oct-2, although not required for early B-cell development, is critical for later B-cell maturation and for postnatal survival. Genes Dev. 7, 570–582. Dariavach, P., Williams, G.T., Campbell, K., Pettersson, S., and Neuberger, M.S. (1991). The mouse IgH 39-enhancer. Eur. J. Immunol. 21, 1499–1504. Dearden-Badet, M.T., and Revillard, J.P. (1993). Requirement for tyrosine phosphorylation in lipopolysaccharide-induced murine B-cell proliferation. Immunology 80, 658–660. Dreyfus, M., Doyen, N., and Rougeon, F. (1987). The conserved decanucleotide from the immunoglobulin heavy chain promoter induces a very high transcriptional activity in B-cells when introduced into an heterologous promoter. EMBO J. 6, 1685–1690. Feldhaus, A.L., Klug, C.A., Arvin, K.L., and Singh, H. (1993). Targeted disruption of the Oct-2 locus in a B cell provides genetic evidence for two distinct cell type-specific pathways of octamer elementmediated gene activation. EMBO J. 12, 2763–2772. Friedl, E.M., and Matthias, P. (1995). Transcriptional activation and repression, two properties of the lymphoid-specific transcription factor Oct-2a. Eur. J. Biochem. 234, 308–316. Grant, P.A., Thompson, C.B., and Pettersson, S. (1995). IgM receptor-mediated transactivation of the IgH 39 enhancer couples a novel Elf-1-AP-1 protein complex to the developmental control of enhancer function. EMBO J. 14, 4501–4513. Grant, P.A., Andersson, T., Neurath, M.F., Arulampalam, V., Bauch, A., Muller, R., Reth, M., and Pettersson, S. (1996). A T cell controlled molecular pathway regulating the IgH locus: CD40-mediated activation of the IgH 39 enhancer. EMBO J. 15, 6691–6700. Gregor, P.D., and Morrison, S.L. (1986). Myeloma mutant with a novel 39 flanking region: loss of normal sequence and insertion of repetitive elements leads to decreased transcription but normal processing of the a heavy chain gene products. Mol. Cell. Biol. 6, 1903–1916. Grosschedl, R., and Baltimore, D. (1985). Cell-type specificity of immunoglobulin gene expression is regulated by at least three DNA sequence elements. Cell 41, 885–897.

Kim, U., Qin, X.F., Gong, S., Stevens, S., Luo, Y., Nussenzweig, M., and Roeder, R.G. (1996). The B-cell-specific transcription coactivator OCA-B/OBF-1/Bob-1 is essential for normal production of immunoglobulin isotypes. Nature 383, 542–547. Klemm, J.D., Rould, M.A., Aurora, R., Herr, W., and Pabo, C.O. (1994). Crystal structure of the Oct-1 POU domain bound to an octamer site: DNA recognition with tethered DNA-binding modules. Cell 77, 21–32. Laskov, R., Kim, J.K., Woods, V.L., McKeever, P.E., and Asofsky, R. (1981). Membrane immunoglobulins of spontaneous B lymphomas of aged BALB/c mice. Eur. J. Immunol. 11, 462–468. Leitges, M., Schmedt, C., Guinamard, R., Davoust, J., Schaal, S., Stabel, S., and Tarakhovsky, A. (1996). Immunodeficiency in protein kinase c b-deficient mice. Science 273, 788–791. Li, Y.S., Gimond, C., and Revillard, J.P. (1992). IL-5-induced IgA synthesis by LPS-stimulated mouse B cells is prevented by protein kinase C inhibitors. Eur. Cytokine Netw. 3, 103–107. Lieberson, R., Giannini, S.L., Birshtein, B.K., and Eckhardt, L.A. (1991). An enhancer at the 39 end of the mouse immunoglobulin heavy chain locus. Nucleic Acids Res. 19, 933–937. Linderson, Y., Cross, D., Neurath, M.F., and Pettersson, S. (1997). NFE, a new transcriptional actiavtor that facilitates p50 and c-Reldependent IgH 39 enhancer activity. Eur. J. Immunol. 27, 468–475. Luo, Y., Fujii, H., Gerster, T., and Roeder, R.G. (1992). A novel B cellderived coactivator potentiates the activation of immunoglobulin promoters by octamer-binding transcription factors. Cell 71, 231–241. Madisen, L., and Groudine, M. (1994). Identification of a locus control region in the immunoglobulin heavy- chain locus that deregulates c-myc expression in plasmacytoma and Burkitt’s lymphoma cells. Genes Dev. 8, 2212–2226. Madisen, L., Krumm, A., Hebbes, T.R., and Groudine, M. (1998). The immunoglobulin heavy chain locus control region increases histone acetylation along linked c-myc genes. Mol. Cell. Biol. 18, 6281–6292. Manis, J.P., van der Stoep, N., Tian, M., Ferrini, R., Davidson, L., Bottaro, A., and Alt, F.W. (1998). Class switching in B cells lacking 39 immunoglobulin heavy chain enhancers. J. Exp. Med. 188, 1421– 1431. Matthias, P. (1998). Lymphoid-specific transcription mediated by the conserved octamer site: who is doing what? Semin. Immunol. 10, 155–163. Matthias, P., and Baltimore, D. (1993). The immunoglobulin heavy chain locus contains another B-cell-specific 39 enhancer close to the a constant region. Mol. Cell. Biol. 13, 1547–1553. Mey, A., and Revillard, J.P. (1998). Mitogenic response of murine B lymphocytes to Salmonella typhimurium LPS requires protein kinase C-dependent late tyrosine phosphorylations. Infect. Immun. 66, 2547–2552.

Gupta, S., Gollapudi, S., and Vayuvegula, B. (1988). Lipopolysaccharide-induced murine B cell proliferation: a role of protein kinase C. Cell. Immunol. 117, 425–429.

Michaelson, J.S., Giannini, S.L., and Birshtein, B.K. (1995). Identification of 39 a-hs4, a novel Ig heavy chain enhancer element regulated at multiple stages of B cell differentiation. Nucleic Acids Res. 23, 975–981.

Herr, W., Sturm, R.A., Clerc, R.G., Corcoran, L.M., Baltimore, D., Sharp, P.A., Ingraham, H.A., Rosenfeld, M.G., Finney, M., and Ruvkun, G. (1988). The POU domain: a large conserved region in the mammalian pit-1, oct-1, oct-2, and Caenorhabditis elegans unc-86 gene products. Genes Dev. 2, 1513–1516.

Michaelson, J.S., Singh, M., Snapper, C.M., Sha, W.C., Baltimore, D., and Birshtein, B.K. (1996). Regulation of 39 enhancers by a common set of factors, including k B-binding proteins. J. Immunol. 156, 2828–2839.

Humbert, P.O., and Corcoran, L.M. (1997). oct-2 gene disruption eliminates the peritoneal B-1 lymphocyte lineage and attenuates B-2 cell maturation and function. J. Immunol. 159, 5273–5284. Jenuwein, T., and Grosschedl, R. (1991). Complex pattern of immunoglobulin m gene expression in normal and transgenic mice: nonoverlapping regulatory sequences govern distinct tissue specificity. Genes Dev. 5, 932–943. Kearney, J.F., Cooper, M.D., and Lawton, A.R. (1976). B lymphocyte differentiation induced by lipopolysaccharide. III. Suppression of B cell maturation by anti-mouse immunoglobulin antibodies. J. Immunol. 116, 1664–1668. Kearney, J.F., and Lawton, A.R. (1975). B lymphocyte differentiation induced by lipopolysaccharide. II. Response of fetal lymphocytes. J. Immunol. 115, 677–681.

Natkunam, Y., Zhang, X., Liu, Z., and Chen, K.S. (1994). Simultaneous activation of Ig and Oct-2 synthesis and reduction of surface MHC class II expression by IL-6. J. Immunol. 153, 3476–3484. Nielsen, P.J., Georgiev, O., Lorenz, B., and Schaffner, W. (1996). B lymphocytes are impaired in mice lacking the transcriptional coactivator Bob1/OCA-B/OBF1. Eur. J. Immunol. 26, 3214–3218. Nishikawa, K., Toker, A., Johannes, F.J., Songyang, Z., and Cantley, L.C. (1997). Determination of the specific substrate sequence motifs of protein kinase C isozymes. J. Biol. Chem. 272, 952–960. Ong, J., Stevens, S., Roeder, R.G., and Eckhardt, L.A. (1998). 39 IgH enhancer elements shift synergistic interactions during B cell development. J. Immunol. 160, 4896–4903. Pettersson, S., Cook, G.P., Bruggmann, M., Williams, G.T., and Neuberger, M.S. (1990). A second B cell–specific enhancer 39 of the immunoglobulin heavy-chain locus. Nature 344, 165–168.

Immunity 526

Pfisterer, P., Annweiler, A., Ullmer, C., Corcoran, L.M., and Wirth, T. (1994). Differential transactivation potential of Oct1 and Oct2 is determined by additional B cell–specific activities. EMBO J. 13, 1655–1663. Pierani, A., Heguy, A., Fujii, H., and Roeder, R.G. (1990). Activation of octamer-containing promoters by either octamer-binding transcription factor 1 (OTF-1) or OTF-2 and requirement of an additional B-cell-specific component for optimal transcription of immunoglobulin promoters. Mol. Cell. Biol. 10, 6204–6215. Pomerantz, J.L., and Sharp, P.A. (1994). Homeodomain determinants of major groove recognition. Biochemistry 33, 10851–10858. Qin, X.F., Reichlin, A., Luo, Y., Roeder, R.G., and Nussenzweig, M.C. (1998). OCA-B integrates B cell antigen receptor-, CD40L- and IL 4–mediated signals for the germinal center pathway of B cell development. EMBO J. 17, 5066–5075. Rush, J.S., and Waechter, C.J. (1987). Inhibitors of protein kinase C block activation of B lymphocytes by LPS. Biochem. Biophys. Res. Commun. 145, 1315–1320. Saleque, S., Singh, M., and Birshtein, B.K. (1999). Ig heavy chain expression and class switching in vitro from an allele lacking the 39 enhancers DNase I-hypersensitive hs3A and hs1,2. J. Immunol. 162, 2791–2803. Scheidereit, C., Heguy, A., and Roeder, R.G. (1987). Identification and purification of a human lymphoid-specific octamer-binding protein (OTF-2) that activates transcription of an Ig promoter in vitro. Cell 51, 783–793. Schreiber, E., Matthias, P., Muller, M.M., and Schaffner, W. (1989). Rapid detection of octamer binding proteins with “mini-extracts,” prepared from a small number of cells. Nucleic Acids Res. 17, 6419. Schubart, D.B., Rolink, A., Kosco, V.M., Botteri, F., and Matthias, P. (1996). B-cell-specific coactivator OBF-1/OCA-B/Bob1 required for immune response and germinal centre formation. Nature 383, 538–542. Segil, N., Roberts, S.B., and Heintz, N. (1991). Mitotic phosphorylation of the Oct-1 homeodomain and regulation of Oct-1 DNA binding activity. Science 254, 1814–1816. Shah, P.C., Bertolino, E., and Singh, H. (1997). Using altered specificity Oct-1 and Oct-2 mutants to analyze the regulation of immunoglobulin gene transcription. EMBO J. 16, 7105–7117. Tanaka, M., Clouston, W.M., and Herr, W. (1994). The Oct-2 glutamine-rich and proline-rich activation domains can synergize with each other or duplicates of themselves to activate transcription. Mol. Cell. Biol. 14, 6046–6055. Tanaka, M., and Herr, W. (1990). Differential transcriptional activation by Oct-1 and Oct-2: interdependent activation domains induce Oct-2 phosphorylation. Cell 60, 375–386. Tang, H., Sun, X., Reinberg, D., and Ebright, R.H. (1996). Protein– protein interactions in eukaryotic transcription initiation: structure of the preinitiation complex. Proc. Natl. Acad. Sci. USA 93, 1119–1124. Turner, C.A., Jr., Mack, D.H., and Davis, M.M. (1994). Blimp-1, a novel zinc finger–containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell 77, 297–306. van der Geer, P., and Hunter, T. (1994). Phosphopeptide mapping and phosphoamino acid analysis by electrophoresis and chromatography on thin-layer cellulose plates. Electrophoresis 15, 544–554. Wirth, T., Staudt, L., and Baltimore, D. (1987). An octamer oligonucleotide upstream of a TATA motif is sufficient for lymphoid-specific promoter activity. Nature 329, 174–177. Xie, H., and Rothstein, T.L. (1995). Protein kinase C mediates activation of nuclear cAMP response element-binding protein (CREB) in B lymphocytes stimulated through surface Ig. J. Immunol. 154, 1717–1723. Yuan, D., Wilder, J.A., Moore, B.B., and Dang, T. (1992). Mechanism of lipopolysaccharide-mediated transcriptional enhancement of the m gene. J. Immunol. 48, 3652–3657.