- Email: [email protected]
[10] Vector for enhanced translation of foreign genes in Escherichia coli
[ 10]
VECTOR FOR TRANSLATION OF FOREIGN GENES
1 15
[ 10] Vector for Enhanced Translation of Foreign Genes in Escherichia coli B y PETER O . OLINS a n d SHAUKAT H . RANGWALA
Introduction Although significant progress has been made in the design of vectors for expression of foreign genes in Escherichia coli, high-level expression is still not a routine accomplishment. The simple juxtaposition of prokaryotic transcriptional and translational signals upstream of a foreign coding region often gives unpredictable results. In order to compensate for poor expression, one major approach has been to increase m R N A levels, either by using strong promoters or by employing very high plasmid copy number. However, in our experience, the most c o m m o n block to efficient expression of foreign genes is poor translation initiation. The E. coli ribosome often does not recognize the chimeric junction between a prokaryotic ribosome binding site (RBS) and a foreign coding region. Here we describe the use of a generic RBS (the T7 bacteriophage gene 10 leader, or "glO-L"), which is highly effective for enhancing translation of a wide variety of foreign genes in E. coli. Plasmid pMON5743 was constructed as a versatile system for engineering and expression of foreign genes. It includes the inducible recA promoter, the glO-L RBS, and an origin of single-stranded DNA replication. Materials and M e t h o d s Materials
Reagents were purchased from Fisher Scientific (Springfield, NJ) or Sigma Chemical Co. (St. Louis, MO), and enzymes for DNA manipulation were from New England Biolabs (Beverly, MA) or Promega (Madison,
wi). Bacterial Strains
All recA + strains of E. coli that we have tested work well for induction of the recA promoter. Typically, strain JM 1011 was used as a convenient host both for cloning and expression. J J. Messing technical bulletin, "Recombinant DNA," NIH Publ. 79-99, Vol. 2, No. 2, p. 43. National Institutes of Health, Bethesda, Maryland.
METHODS IN ENZYMOLOGY,VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
EXPRESSION IN E. coli
116
[10]
Sal I
Ec~°RI Pvu~lH~i l nllld 1 .
.
.
.
.
.
AAATAATTTTGTTTAACTTTAAGAAGGAGATATATCCATGGAATTCGGCAGCTGAAGCTT ShineMetGluPheGlySerLeuSer
g l O-L
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
Dalgarno
FIG. 1. Physical map of plasmid pMON5743. The ampR and ori-327 regions are derived from the Sall to EcoRI fragment of pBR327. 3 The recA promoter, 4 glO-L, ~ and multilinker segments were constructed as synthetic DNAs, and the F1 phage origin of single-stranded DNA replication is derived from the 512-bp RsaI fragment of the phage? All restriction sites shown are unique. The map is not to scale.
P l a s m i d Construction
Plasmid constructions were performed according to Maniatis et al. 2 For expression of foreign genes in the plasmid system, the heterologous coding region was cloned either into the unique E c o R I site or by blunt-end ligation into the PvuII site ofpMON5473 (shown in Fig. 1).3-6 For precise expression of the coding region, unfused to any undesirable protein se2 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 3 X. Soberon, L. Covarrubias, and F. Bolivar, Gene 9, 287 (1980). 4 T. Horii, T. Ogawa, and H. Ogawa, Proc. NatL Acad. Sci. U.S.A. 77, 313 (1980). P. O. Olins, C. S. Devine, S. H. Rangwala, and K. S. Kavka, Gene73, 227 (1988). 6 D. A. Meade, E. Szezesna-Skapura, and B. Kemper, Nucleic Acids Res. 14, 1103 (1985).
[ 10]
VECTOR FOR TRANSLATION OF FOREIGN GENES
1 17
quences, the following procedure was used. Single-stranded plasmid DNA was prepared according to Meade et al. ~ using the helper phage M 13-KO7, and site-specific mutagenesis7 was then used to create unique NcoI and HindlII sites at the N and C termini of the heterologous coding regions, respectively. Finally, all extraneous DNA was removed by deletion between the two NcoI sites, and then deletion between the two HindlII sites. This resulted in expression plasmids having a unique NcoI site correctly positioned at the junction between the glO-L RBS and the heterologous coding region.
Growth and Induction of Strains Carrying Expression Plasmids Escherichia coli cells were transformed with the expression plasmids and selected at 37 ° on LB plates containing 200/~g/ml ampicillin. A single colony was picked into 2 ml of LB medium containing 200 pg/ml ampicillin and grown overnight at 37 °. A 100-fold dilution was then made into 20 ml of the following medium: M9 minimal salts2 supplemented with 0.8% (w/v) glucose, 1% (w/v) casamino acids (Difco), and 0.0005% (w/v) thiamin in distilled water. The culture was grown at 37 ° with vigorous aeration until it reached a density of approximately OD55o--0.5 (or 150 Klett units, using a Klett- Summerson meter), and the recA promoter was induced by the addition of 50/~g/ml nalidixic acid (using a fresh solution of nalidixic acid at 10 mg/ml in 0.1 M NaOH). Growth was continued for a further 4 hr, and the cells harvested by centrifugation. Results
Application of g l O-L Ribosome Binding Site for Expression in Escherichia coli As a consequence of a search for RBS sequences suitable for high-level expression of foreign genes, the RBS region from the highly expressed coat protein (gene 10) of phage T7 "glO-L'" was tested. 5,s This RBS gave surprisingly efficient expression of several different genes, with the protein product often accumulating to a level corresponding to a large proportion of cellular protein. The stimulatory effect of the glO-L was the same even when various promoters were tested. The experiments described here employ the recA promoter of E. coli. Although this promoter has only been
T. A. Kunkel, Proc. NatL Acad. Sci. U.S.A. 82, 488 (1985). s p. O. Olins and S. H. Rangwala, J. Biol. Chem. 264, 16973 (1989).
1 18
EXPRESSION IN E . coli
[ 10]
TABLE I EXPRESSION LEVELS OBTAINEDFOR DIFFERENT GENES, USINO EITHER gl0-L RBS OR "CONSENSUS" RBSa
Source of coding region
Coding region
Increase in expression (g/0-L/consensus RBS)
E. coli Maize Rat Agrobacterium
lacZ GST1 Atriopeptigen IPT 1
100 50 40 340
° Parental plasmids were constructed carrying the recA promoter and either the glO-L or consensus RBS. Various coding regions were cloned into these vectors, and expression levels were measured after induction of the recA promoter.
used occasionally for expression of foreign genes, 5,s-~2 it has a number of advantages which make it a convenient choice: it is well-regulated, even at high copy number; it can be induced simply by the addition of nalidixic acid; there are no restrictions on growth medium or temperature; and it is effective in most E. coli hosts except those with a recA- genotype. Several genes have been expressed using the combination of the recA promoter and the glO-L, from sources as diverse as bacteria, plants, and mammals, and, in almost all cases, efficient expression was observed.5,s,~l-13 Table I illustrates the efficacy of the glO-L RBS, compared with similar plasmid constructs containing a designed "consensus" RBS sequence. 5 As can be seen, the presence of the glO-L RBS caused a remarkable stimulation in expression, often 100-fold or more. Further experiments 5,s indicate that the effect of the glO-L is primarily at the level of translation initiation. Based on these results, a plasmid vector was designed which combined the glO-L RBS with a number of other desirable features, as described below.
9 S. I. Feinstein, Y. Chernajovsky, L. Chen, L. Maroteaux, and Y. Mory, Nucleic Acids Res. 11, 2927 (1983). to G. G. Krivi, M. L. Bittner, E. Rowold, E. Y. Wong, K. C. Glenn, K. S. Rose, and D. C. Tiemeier, J. Biol. Chem. 260, 10263 (1985). t t E. Y. Wong, R. Seetharam, C. E. Kotts, R. A. Heeren, B. K. Klein, S. B. Braford, K. J. Mathis, B. F. Bishop, N. R. Siegel, C. E. Smith, and W. C. Tacon, Genein press (1988). 12j. K. Gierse, P. O. Olins, C. S. Devine, J. D. Marlay, M. G. Obukowicz, L. H. Mortensen, E. G. McMahon, E. H. Blaine, and R. Seetharam, Biochim. Biophys. Acta (submitted). t3 R. J. Duronio, E. Jackson-Machelski, R. O. Heuckeroth, P. O. Olins, C. S. Devine, W. Yonemoto, L. W. Slice, S. S. Taylor, and J. I. Gordon, Proc. Natl. Acad. Sci. U.S.A. in press (1990).
[ 11 ]
MINIMIZING PROTEOLYSIS
1 19
Description of Plasmid pMO N5 743 Figure 1 is a schematic representation of pMON5743. This plasmid is based on pBR327, a In addition, the plasmid includes the following features: the E. coli recA promoter, which is inducible under conditions which induce the SOS response, ~4 such as the addition of nalidixic acidg; the glO-L RBS, 5 followed by an NcoI site which flanks a methionine initiator codon; multiple cloning sites for ease of insertion of various coding regions; and the origin of single-stranded replication from phage F 1,6 which permits the rapid preparation of single-stranded DNA for mutagenesis or DNA sequencing. Discussion One outstanding question remains. How does the glO-L function to stimulate translation of such a variety of heterologous genes in E. coli? The RBS is derived from a highly expressed phage coat protein, and has therefore probably evolved to optimize expression of that gene. Our recent studies on this question s indicate that the efficacy of the glO-L is due to a combination of increased mRNA stability with a potent enhancement of translation initiation. While studies of the precise mechanism continue, plasmid vectors containing this element provide a simple and valuable addition to the systems available for expression in E. coli. 14j. W. Little and D. W. Mount, Cell 29, 11 (1982).
[ 11 ] M i n i m i z i n g P r o t e o l y s i s i n E s c h e r i c h i a coli: G e n e t i c Solutions B y SUSAN G O T T E S M A N
Many proteins cloned in Escherichia coli on high-copy-number vectors fail to accumulate. In many cases, the explanation for this failure to accumulate is the rapid turnover of the protein. Both foreign and native E. coli proteins seem to be subject to this degradation. Presumably, part of the difficulty may reflect the normal presence of such proteins in particular cellular compartments, or as part of multiprotein structures ~-3 which may not have counterparts in E. coli. Produced on their own, these proteins ' P. P. Dennis, Mol. Gen. Genet. 134, 39 (1974). 2 K. Nishi and J. Schneir, Mol. Gen. Genet. 212, 177 (1988) 3 H. A. Nash, C. A. Robertson, E. Flamm, R. A. Weisberg, and H. I. Miller, J. Bacteriol. 169, 4124 (1987). METHODS IN ENZYMOLOGY, VOL. 185
VECTOR FOR TRANSLATION OF FOREIGN GENES
1 15
[ 10] Vector for Enhanced Translation of Foreign Genes in Escherichia coli B y PETER O . OLINS a n d SHAUKAT H . RANGWALA
Introduction Although significant progress has been made in the design of vectors for expression of foreign genes in Escherichia coli, high-level expression is still not a routine accomplishment. The simple juxtaposition of prokaryotic transcriptional and translational signals upstream of a foreign coding region often gives unpredictable results. In order to compensate for poor expression, one major approach has been to increase m R N A levels, either by using strong promoters or by employing very high plasmid copy number. However, in our experience, the most c o m m o n block to efficient expression of foreign genes is poor translation initiation. The E. coli ribosome often does not recognize the chimeric junction between a prokaryotic ribosome binding site (RBS) and a foreign coding region. Here we describe the use of a generic RBS (the T7 bacteriophage gene 10 leader, or "glO-L"), which is highly effective for enhancing translation of a wide variety of foreign genes in E. coli. Plasmid pMON5743 was constructed as a versatile system for engineering and expression of foreign genes. It includes the inducible recA promoter, the glO-L RBS, and an origin of single-stranded DNA replication. Materials and M e t h o d s Materials
Reagents were purchased from Fisher Scientific (Springfield, NJ) or Sigma Chemical Co. (St. Louis, MO), and enzymes for DNA manipulation were from New England Biolabs (Beverly, MA) or Promega (Madison,
wi). Bacterial Strains
All recA + strains of E. coli that we have tested work well for induction of the recA promoter. Typically, strain JM 1011 was used as a convenient host both for cloning and expression. J J. Messing technical bulletin, "Recombinant DNA," NIH Publ. 79-99, Vol. 2, No. 2, p. 43. National Institutes of Health, Bethesda, Maryland.
METHODS IN ENZYMOLOGY,VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
EXPRESSION IN E. coli
116
[10]
Sal I
Ec~°RI Pvu~lH~i l nllld 1 .
.
.
.
.
.
AAATAATTTTGTTTAACTTTAAGAAGGAGATATATCCATGGAATTCGGCAGCTGAAGCTT ShineMetGluPheGlySerLeuSer
g l O-L
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
Dalgarno
FIG. 1. Physical map of plasmid pMON5743. The ampR and ori-327 regions are derived from the Sall to EcoRI fragment of pBR327. 3 The recA promoter, 4 glO-L, ~ and multilinker segments were constructed as synthetic DNAs, and the F1 phage origin of single-stranded DNA replication is derived from the 512-bp RsaI fragment of the phage? All restriction sites shown are unique. The map is not to scale.
P l a s m i d Construction
Plasmid constructions were performed according to Maniatis et al. 2 For expression of foreign genes in the plasmid system, the heterologous coding region was cloned either into the unique E c o R I site or by blunt-end ligation into the PvuII site ofpMON5473 (shown in Fig. 1).3-6 For precise expression of the coding region, unfused to any undesirable protein se2 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 3 X. Soberon, L. Covarrubias, and F. Bolivar, Gene 9, 287 (1980). 4 T. Horii, T. Ogawa, and H. Ogawa, Proc. NatL Acad. Sci. U.S.A. 77, 313 (1980). P. O. Olins, C. S. Devine, S. H. Rangwala, and K. S. Kavka, Gene73, 227 (1988). 6 D. A. Meade, E. Szezesna-Skapura, and B. Kemper, Nucleic Acids Res. 14, 1103 (1985).
[ 10]
VECTOR FOR TRANSLATION OF FOREIGN GENES
1 17
quences, the following procedure was used. Single-stranded plasmid DNA was prepared according to Meade et al. ~ using the helper phage M 13-KO7, and site-specific mutagenesis7 was then used to create unique NcoI and HindlII sites at the N and C termini of the heterologous coding regions, respectively. Finally, all extraneous DNA was removed by deletion between the two NcoI sites, and then deletion between the two HindlII sites. This resulted in expression plasmids having a unique NcoI site correctly positioned at the junction between the glO-L RBS and the heterologous coding region.
Growth and Induction of Strains Carrying Expression Plasmids Escherichia coli cells were transformed with the expression plasmids and selected at 37 ° on LB plates containing 200/~g/ml ampicillin. A single colony was picked into 2 ml of LB medium containing 200 pg/ml ampicillin and grown overnight at 37 °. A 100-fold dilution was then made into 20 ml of the following medium: M9 minimal salts2 supplemented with 0.8% (w/v) glucose, 1% (w/v) casamino acids (Difco), and 0.0005% (w/v) thiamin in distilled water. The culture was grown at 37 ° with vigorous aeration until it reached a density of approximately OD55o--0.5 (or 150 Klett units, using a Klett- Summerson meter), and the recA promoter was induced by the addition of 50/~g/ml nalidixic acid (using a fresh solution of nalidixic acid at 10 mg/ml in 0.1 M NaOH). Growth was continued for a further 4 hr, and the cells harvested by centrifugation. Results
Application of g l O-L Ribosome Binding Site for Expression in Escherichia coli As a consequence of a search for RBS sequences suitable for high-level expression of foreign genes, the RBS region from the highly expressed coat protein (gene 10) of phage T7 "glO-L'" was tested. 5,s This RBS gave surprisingly efficient expression of several different genes, with the protein product often accumulating to a level corresponding to a large proportion of cellular protein. The stimulatory effect of the glO-L was the same even when various promoters were tested. The experiments described here employ the recA promoter of E. coli. Although this promoter has only been
T. A. Kunkel, Proc. NatL Acad. Sci. U.S.A. 82, 488 (1985). s p. O. Olins and S. H. Rangwala, J. Biol. Chem. 264, 16973 (1989).
1 18
EXPRESSION IN E . coli
[ 10]
TABLE I EXPRESSION LEVELS OBTAINEDFOR DIFFERENT GENES, USINO EITHER gl0-L RBS OR "CONSENSUS" RBSa
Source of coding region
Coding region
Increase in expression (g/0-L/consensus RBS)
E. coli Maize Rat Agrobacterium
lacZ GST1 Atriopeptigen IPT 1
100 50 40 340
° Parental plasmids were constructed carrying the recA promoter and either the glO-L or consensus RBS. Various coding regions were cloned into these vectors, and expression levels were measured after induction of the recA promoter.
used occasionally for expression of foreign genes, 5,s-~2 it has a number of advantages which make it a convenient choice: it is well-regulated, even at high copy number; it can be induced simply by the addition of nalidixic acid; there are no restrictions on growth medium or temperature; and it is effective in most E. coli hosts except those with a recA- genotype. Several genes have been expressed using the combination of the recA promoter and the glO-L, from sources as diverse as bacteria, plants, and mammals, and, in almost all cases, efficient expression was observed.5,s,~l-13 Table I illustrates the efficacy of the glO-L RBS, compared with similar plasmid constructs containing a designed "consensus" RBS sequence. 5 As can be seen, the presence of the glO-L RBS caused a remarkable stimulation in expression, often 100-fold or more. Further experiments 5,s indicate that the effect of the glO-L is primarily at the level of translation initiation. Based on these results, a plasmid vector was designed which combined the glO-L RBS with a number of other desirable features, as described below.
9 S. I. Feinstein, Y. Chernajovsky, L. Chen, L. Maroteaux, and Y. Mory, Nucleic Acids Res. 11, 2927 (1983). to G. G. Krivi, M. L. Bittner, E. Rowold, E. Y. Wong, K. C. Glenn, K. S. Rose, and D. C. Tiemeier, J. Biol. Chem. 260, 10263 (1985). t t E. Y. Wong, R. Seetharam, C. E. Kotts, R. A. Heeren, B. K. Klein, S. B. Braford, K. J. Mathis, B. F. Bishop, N. R. Siegel, C. E. Smith, and W. C. Tacon, Genein press (1988). 12j. K. Gierse, P. O. Olins, C. S. Devine, J. D. Marlay, M. G. Obukowicz, L. H. Mortensen, E. G. McMahon, E. H. Blaine, and R. Seetharam, Biochim. Biophys. Acta (submitted). t3 R. J. Duronio, E. Jackson-Machelski, R. O. Heuckeroth, P. O. Olins, C. S. Devine, W. Yonemoto, L. W. Slice, S. S. Taylor, and J. I. Gordon, Proc. Natl. Acad. Sci. U.S.A. in press (1990).
[ 11 ]
MINIMIZING PROTEOLYSIS
1 19
Description of Plasmid pMO N5 743 Figure 1 is a schematic representation of pMON5743. This plasmid is based on pBR327, a In addition, the plasmid includes the following features: the E. coli recA promoter, which is inducible under conditions which induce the SOS response, ~4 such as the addition of nalidixic acidg; the glO-L RBS, 5 followed by an NcoI site which flanks a methionine initiator codon; multiple cloning sites for ease of insertion of various coding regions; and the origin of single-stranded replication from phage F 1,6 which permits the rapid preparation of single-stranded DNA for mutagenesis or DNA sequencing. Discussion One outstanding question remains. How does the glO-L function to stimulate translation of such a variety of heterologous genes in E. coli? The RBS is derived from a highly expressed phage coat protein, and has therefore probably evolved to optimize expression of that gene. Our recent studies on this question s indicate that the efficacy of the glO-L is due to a combination of increased mRNA stability with a potent enhancement of translation initiation. While studies of the precise mechanism continue, plasmid vectors containing this element provide a simple and valuable addition to the systems available for expression in E. coli. 14j. W. Little and D. W. Mount, Cell 29, 11 (1982).
[ 11 ] M i n i m i z i n g P r o t e o l y s i s i n E s c h e r i c h i a coli: G e n e t i c Solutions B y SUSAN G O T T E S M A N
Many proteins cloned in Escherichia coli on high-copy-number vectors fail to accumulate. In many cases, the explanation for this failure to accumulate is the rapid turnover of the protein. Both foreign and native E. coli proteins seem to be subject to this degradation. Presumably, part of the difficulty may reflect the normal presence of such proteins in particular cellular compartments, or as part of multiprotein structures ~-3 which may not have counterparts in E. coli. Produced on their own, these proteins ' P. P. Dennis, Mol. Gen. Genet. 134, 39 (1974). 2 K. Nishi and J. Schneir, Mol. Gen. Genet. 212, 177 (1988) 3 H. A. Nash, C. A. Robertson, E. Flamm, R. A. Weisberg, and H. I. Miller, J. Bacteriol. 169, 4124 (1987). METHODS IN ENZYMOLOGY, VOL. 185