- Email: [email protected]
[5] Stable high-level gene expression in mammalian cells by T7 phage RNA polymerase
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 RNA POLYMERASE
47
and C219 is not entirely specific for P-glycoprotein.31 A series of antibodies directed against human P170 peptides has been described. 32Most of these antibodies, except for MRK-16, can be used on Western blots. 3. After resuspending immunoprecipitated material in sodium dodecylsulfate (SDS)-sample buffer for a Laemmli-type gel,33 elute antibody-P170 conjugate at room temperature for 15 min. Boiling will cause P170 to aggregate and it will not enter an SDS-polyacrylamide (PAGE) gel. 4. The MDRI gene product will migrate on SDS-PAGE as a diffuse band of approximately 170K. Apparent molecular weight will vary depending on the cell type being used for expression, probably due to differential glycosylation patterns. Cell lines expressing P-glycoprotein on their surfaces can also be detected by indirect immunofluorescence as described by Willingham et al.34 Positive cells can also be detected and sorted by FACS. For this purpose, we use 10/xg MRK-16/106 cells 29 with 85 /zg fluorescein isothiocyanate (FITC) goat anti-mouse IgG per 10 6 cells as a second antibody for fluorescence detection. 3~ F. Thiebaut, T. Tsuruo, H. Hamada, M. M. Gottesman, I. Pastan, and M. C. Willingham. J, Histochem. Cytochem. 37, 159 (1989). 3: E. P. Bruggemann, V. Chaudhary, M. M. Gottesman, and I. Pastan, BioTechniques 10, 202 (1991). 33 U. K. Laemmli, Nature (London) 227, 680 (1970). 34 M. C. Willingharn, N. D. Richert, M. M. Cornwel|, T. Tsuruo, H. Hamada, M. M. Gottesman, and I. Pastan, J. Histochem. Cytochem. 35, 1451 (1987).
[5] S t a b l e H i g h - L e v e l G e n e E x p r e s s i o n in M a m m a l i a n by T7 Phage RNA Polymerase
Cells
By A N D R E LIEBER, VOLKER SANDIG, WOLFGANG SOMMER, SILVIA BAHRING, and MICHAEL STRAUSS Introduction Various routes for high-level foreign gene expression in mammalian cells have been explored over the years) '2 However, there are not that many different principles to choose from; the choice is between transient and stable expression systems. Expression vectors for the first kind of I M. Strauss, U. Kiessling, and M. Platzer, Biol. Zentralbl. 105, 209 (1986). 2 j. Sambrook and M.-J. Gething, Focus 10, 41 (1987).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
48
VECTORS FOR EXPRESSING CLONED GENES
[5]
systems are mainly derived from viruses, such as vaccinia virus, 3-5 baculovirus, 6'7 simian virus 40 (SV40), 8'9 and others. Some of these systems
allow for very high expression levels, but only for the short period of 1-3 days.2,5,7 High-level transient expression is therefore useful for producing large amounts of a particular protein for further biochemical studies. However, under certain demanding conditions, it is desirable to express foreign genes continuously at a relatively high level. Stable expression of foreign genes can be achieved using constructs that either integrate into the host cell genome or have the ability to replicate at a moderate level. Vectors of the second type are preferentially derived from bovine papilloma virus (BPV) 1°-12 and from Epstein-Barr virus (EBV). 13 Integrating plasmid vectors can be amplified by linkage to genes such as that for dihydrofolate reductase (DHFR) 14A5or metallothionein 16 and subsequent selection with increasing drug concentrations. However, when genes are amplified by more than 100-fold the increase in the expression level is often less than 10-fold. 1~Additionally, differences in the level of expression achieved with various strong viral or mammalian promoters are within one order of magnitude when analyzed in transient expression assays.~7 Differences in the expression levels between individual clones derived from one and the same transfection can be enormous, ranging between only a few nanograms and several micrograms per 106 cells/ml/day. N,15 In searching for a stable expression system that is not restricted by the availability of host cell transcription factors and RNA polymerase, we became interested in the use of a bacteriophage promoter/polymerase system for which a highly selective function in prokaryotic host cells was 3 D. Panicalli and E, Paoletti, Proc. Natl. Acad. Sci. U.S.A. 79, 4927 (1982). 4 M. Mackett, G. L. Smith, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 79, 7415 (1982). 5 T. R. Fuerst and B. Moss, J. Mol. Biol. 206, 333 (1989). 6 G. E. Smith, M. J. Fraser, and M. D. Summers, J. Virol. 46, 584 (1983). 7 V. A. Luckow and M. D. Summers, Bio/Technology 6, 47 (1988). 8 M.-J. Gething and J. Sambrook, Nature (London) 293, 620 (1981). 9 j. T. Elder, R. A. Spritz, and S. M. Weissman, Annu. Rev. Genet. 15, 295 (1981). 10N. Sarver, P. Gruss, M.-F. Law, G. Khoury, and P. M. Howley, Mol. Cell. Biol, 1, 486 (1981). ii N. Hsiung, R. Fitts, S. Wilson, A. Milne, and D. Hamer, J. Mol. Appl. Genet. 2, 497 (1984). 12 D. DiMaio, in "The Papillomaviruses," p. 293. Plenum, New York, 1987. 13 p. B. G. M. Belt, H. Groeneveld, W. J. Teubel, P. van de Putte, and C. Backendorf, Gene 84, 407 (1989). 14 R. J. Kaufman and P. A. Sharp, J. Mol. Biol. 159, 601 (1982). 15 R. J. Kaufman, L. C. Wasley, A. J. Spiliotes, S. D. Gossels, S. A. Latt, G. R. Larsen, and R. M. Kay, Mol. Cell. Biol. 5, 1750 (1985). 16 G. N. Pavlakis and D. Hamer, Proc. Natl. Acad. Sci. U.S.A. 80, 397 (1983). 17 D. R. Hurwitz, R. Hodges, W. Drohan, and N. Sarver, Nucleic Acids Res. 15, 7137 (1987).
[5]
HIGH-LEVEL GENE EXPRESSION BY
T7 R N A POLYMERASE
49
known. Like other uneven T phages, the T7 phage codes for an RNA polymerase that is selective for phage promoters.~8-2° The latter, in turn, are so different in sequence from bacterial promoters that they cannot be transcribed by the bacterial RNA polymerase. ~8Moss and co-workers 2~'20were first in using this principle for the short-term vaccinia expression system. In this chapter we describe the adaptation of the transcriptional machinery of phage T7 to the mammalian cell system for highly selective stable gene expression. Principle In our original publication of T7 RNA polymerase-dependent gene expression in mammalian cells 23 we showed that the expression of the T7 RNA polymerase gene leads to cytoplasmic localization of the polymerase. This, in fact, is potentially useful for efficient transient expression from transfected plasmids and it is an ideal prerequisite for expression using vaccinia vectors. 24 For stable foreign gene expression a nuclear localization of the T7 polymerase is required. This has been achieved by fusion of a nuclear location signal to the amino terminus of the polymerase 25 or by substituting the nuclear location signal for the N-terminal 5% of the polymerase. 23 Cell lines can be established with this modified gene that harbor the T7 polymerase exclusively in the nucleus. Transfection of a foreign gene under control of a T7 promoter into such cells should result in transient as well as stable expression of the particular gene driven by the T7 polymerase. In fact, using chloramphenicol acetyl transferase (cat) 23 and other reporter genes we could demonstrate efficient expression within the range obtained with the strong Rous sarcoma virus (RSV) and cytomegalovirus (CMV) promoters. Human growth hormone has been expressed stably at levels of 20-30/zg/ml/106 cells/day. 26 However, we verified an effect that has been noticed before by ourselves and by other 18 j. j. Dunn and F. W. Studier, J. Mol. Biol. 166, 477 (1983). 19 p. Davanloo, A. H. Rosenberg, J. J. Dunn, and F. W. Studier, Proc. Natl. Acad. Sci. U.S.A. 81, 2035 (1984). 20 B. A. Moffat, J. J. Dunn, and F. W. Studier, J. Mol. Biol. 173, 265 (1984). 21 T. R. Fuerst, E. G. Niles, F. W. Studier, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 83, 8122 (1986). 22 B. Moss, O. Elroy-Stein, T. Mizukami, W. A. Alexander, and T. R. Fuerst, Nature (London) 348, 91 (1990). 23 A. Lieber, U. Kiessling, and M. Strauss, Nucleic Acids Res. 17, 8485 (1989). 24 O. Elroy-Stein and B. Moss, Proc. Natl. Acad. Sci. U,S.A. 87, 6743 (1990). 25 j. j. Dunn, B. Krippl, K. E. Bernstein, H. Westphal, and F. W. Studier, Gene 68, 259 (1988). 26 A. Lieber and M. Strauss, unpublished observations (1990).
50
VECTORS FOR EXPRESSING CLONED GENES
[5]
users of the system. It turned out that the T7 promoter can be transcribed by a cellular polymerase (probably polymerase II) quite efficiently if present in the context of a pGEM plasmid. This background expression level amounts to 10-50%, depending on the cell type. Thus, the T7 promoter in pGEM is actually a reasonably efficient promoter in mammalian cells, which allows the use of one and the same construct for expression in prokaryotic and eukaryotic cells as well as in a cell-free system. We will describe this interesting aspect elsewhere. 27 To establish an exclusive expression system for mammalian cells it was necessary to generate a modified T7 promoter that does not function with the cellular RNA polymerases and is still active with the T7 polymerase. Because we have succeeded in isolating several mutant promoters fulfilling these requirements we will describe the procedure in the first part of the experimental section (cloning and isolation of mutant T7 promoters). The strategy involves the synthesis of randomly mutagenized promoter oligonucleotides, their repeated incubation with HeLa cell nuclear extracts, the incubation of the unbound fraction with purified T7 polymerase, and amplification and cloning of the polymerase-bound fraction. Individual clones are assayed for function with T7 polymerase in vitro and within the cell using human growth hormone (hGH) as the test gene. The second part of the method to be outlined concerns gene transfer and the selection of clones expressing foreign genes under control of modified T7 promoters. The preferred protocol involves the use of a selectable marker also under control of a T7 promoter. There are three general variants of the procedure: (1) transfer of the gene of interest into cells already expressing the polymerase gene, (2) cotransfer of test gene, polymerase gene, and selectable marker, and (3) establishment of cells carrying a silent T7 promoter/test gene construct with subsequent gene activation by retroviral transfer of the polymerase gene. All three variants have their advantages and disadvantages. Finally, we will describe applications of the T7 expression system for purposes where this system is unique. Besides high-level expression of proteins from cDNA or genomic DNA it is exceptionally useful for expressing polycistronic mRNA and antisense RNA. Materials
Cell Lines
Mouse L t k - cells, Chinese hamster ovary (CHO) cells, and mouse myeloma cell line Sp2/0 Ag 14 are used as recipient cells for the polymerase gene and for cotransfections. 27 V. Sandig, A. Lieber, S. B~ihring, and M. Strauss, Gene, submitted (1992).
[5]
HIGH-LEVEL GENE EXPRESSION BY T 7 R N A POLYMERASE ~
I
1
f
r "Ec° R1369
\
I
51
f
-
/
I"7R N A !~ymemse ~
II T7 P.NA ! ~
~n~
1 ¢,, BsmHl --_ ~,_ ~ . . . ~ T R • Pat 11019
i LTR1 Pvu
M6SVTTN ~ 1 bp I12392 a 12467
rCLS/•x.bBtt
I
tit Pol
I"7R N A ~ y n ~ r a ~
FIG. 1. M a p s of plasmid v e c t o r s carrying the gene for a nuclear T7 R N A polymerase.
PMN clone A5 is a derivative of Ltk- cells expressing T7 RNA polymerase at a high level from the construct pMTT7N (Fig. 1) and has been selected with cadmium for the presence of the mouse metallothionein gene. 23 CHO185 is a clone of CHO cells that has been selected for the presence of pMTT7N. Ltk- cells, CHO cells, and their derivatives are grown in Dulbecco's modified Eagle's medium (DMEM) with 5% (v/v) fetal calf serum (GIBCO, Grand Island, NY) at 5% COz. Myeloma cells are grown in RPMI 1640 medium with 10% (v/v) fetal calf serum and 1 mg/ml of gentamycin.
Vectors and Oligonucleotides The vector family pGEM (Promega Madison, WI) was used originally for cloning and expression of reporter and selectable marker genes. In the studies described here only pT7neo is used from this series. For cloning
VECTORSFOR EXPRESSINGCLONEDGENES
52
HindI11.1~LHine!1.XImi ~ . _ ~_~Bam/~Bgm74
j
IS]
modit-a~l"l'7/a,omo~ !'''~Hindll125
"\
#
F,r.oR1396 BarnHI414 ~ / ~Xho!445 modit'l~lT7~ ~ ~ S p h 1445
hl~
7881~H~
~H
poly(A)signal Sph12640
Sph17.320
FIG. 2. Maps of plasmid vectors with marker genes driven from wild-type or mutant T7 promoters.
of the modified (mutant) T7 promoters pUC 19 is used. The standard vector with the most suitable promoter mutation (No. 86) is named pT7 m. Reporter and test genes are cloned into this vector and named accordingly pT7mhGH, pT7mluc, etc. (Fig. 2). The sequence of the synthetic T7 promoter is as follows: Wild type: Mutant 86:
5'-TTAATACGACTCACTATAGGGAGATA-3' ..... T ............ C .......
pMTT7N is derived from pMTT7 by replacing the BgllI/NarI fragment with a synthetic sequence coding for the nuclear location signal of SV40 large T antigen (Fig. 1). Because the sequence given in the original article 23 mistakenly contained two additional nucleotides, we give the correct sequence here (bold: sequence of the SV40 nuclear location signal):
[5]
HIGH-LEVEL GENE EXPRESSION BY T 7 R N A POLYMERASE
53
5'-AGATCTTTGCAAAAAGC T TTGC AAG A TGGATAAAGTT T TTAGAAAC TCCAGTAGG Me t A s pLy s V a 1 P h e A r g A s n S e r S e t A r g ACT
CCT CCA
A A A AAG AAG A G A AAG G T A GAA C G T C T A G A T C - 3 '
Thr-Pro-Pro-Ly
s -Ly s-Ly
s -Ar g-Ly
s -Va I -GI u ArgLeuAsp
pCMVT7N is constructed by inserting the 3.3-kbp BgllI/PvulI fragment of pMTT7N between the BgllI and SmaI sites of pCMVLT2. 28 pM6SVT7N contains the BgllI/PvulI fragment of pMTT7N inserted into the BgllI site of the retroviral vector construct pM6pac 29 (Fig. I).
Reagents All reagents should be of the highest purity available. The main compounds and enzymes used in our laboratory are from the following suppliers: Geneticin: GIBCO/BRL (Grand Island, NY)/Bethesda Research Laboratories (Gaithersburg, MD), Life Sciences Puromycin: Sigma (St. Louis, MO) DEAE-dextran (Mr 500,000): Pharmacia (Uppsala, Sweden) T7 RNA polymerase: New England BioLabs (Beverly, MA) Restriction enzymes: Boehringer Mannheim (Mannheim, Germany), Bethesda Research Laboratories, New England BioLabs Salts: Sigma BD-cellulose: Serva Feinchemica (Heidelberg, Germany)
Equipment Oligonucleotide synthesis: Performed using an Applied Biosystems (Foster City, CA) DNA synthesizer model 380 on the basis of methoxyamidites Electroporation experiments: Performed using the GenePulser (BioRad, Richmond, CA) Luciferase assays: Performed using a liquid scintillation counter PW 4700 (Philips, The Netherlands) or a luminometer LB 9501-1 Lumat (Berthold, Germany) General Methods
Purification of Plasmids for Transfection Plasmids are purified by two rounds of cesium chloride gradient centrifugation or, preferentially, superior purity is achieved by column z8 M. Strauss, S. Hering, L. Lfibbe, and B. E. Griffin, Oncogene 5, 1223 (1990). z9 M. Wirth, R. G r a n n e m a n n , and H. H a u s e r , J. Virol. submitted.
54
VECTORS FOR EXPRESSING CLONED GENES
[5]
chromatography on BD-cellulose as follows: A cleared alkaline lysate is neutralized, phenol treated, and precipitated with ethanol as in the standard procedure. The pellet is dissolved in TE buffer [10 mM TrisHCI, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.6]; RNA and protein are selectively precipitated by addition of ammonium acetate to a final concentration of 2.3 M. The precipitate is removed by centrifugation at 6000 rpm/min for 10 min at 4°. The DNA is precipitated from the supernatant with 70% (v/v) ethanol. After centrifugation the pellet is dissolved in 3 ml TE buffer with 0.3 M NaCI (pH 8). Two milliliters of BD-cellulose in TE buffer plus 0.3 M NaCI is filled into a 4- to 5-ml plastic column or syringe and the DNA solution is applied. The column can be spun; however, for maximal yields it should be run by gravity and the flow-through should be applied a second time. After washing with five column volumes of the same buffer the plasmid DNA is eluted with TE buffer plus 1 M NaCI and precipitated with 70% (v/v) ethanol.
Transfection Procedures For transfection of fibroblasts we generally use a modification of the standard calcium phosphate coprecipitation method. 23'3° The highest efficiencies (approximately 10 -3) a r e obtained as follows: 10 /zg of plasmid DNA in 220/xl of TE buffer plus 30/zl of 2 M CaCI2 are mixed in a test tube, and 250 t-d of 2 × HBS [50 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), 280 mM NaCI, 1.5 mM sodium phosphate (equal amounts of mono- and dibasic), pH 6.96] is added dropwise with simultaneous vortexing. The precipitate is directly added to 5 ml of culture medium containing 10% (v/v) fetal calf serum in 25cm 2 tissue culture flasks with cells that have been seeded the day before. For transfection of myeloma cells 31 8/xg of plasmid DNA is precipitated with ethanol, resuspended in 250 ~1 of RPMI 1640-25 mM HEPES (pH 7.15), 250 /zl of RPMI 1640/HEPES containing 1 mg/ml DEAEdextran is added to the DNA with vortexing, and the mixture is incubated with the cells on 10-cm petri dishes for 30 min. After washing with RPMI 1640, 7 ml of medium with serum plus 0.1 mM chloroquine are added for 3.5 hr. Cells are washed again and supplied with fresh medium. Electroporation of 10 7 cells/ml in culture medium with 10% (v/v) fetal calf serum is generally performed on ice with 10-50/xg of linear DNA using the following conditions for different cell types: 1.5 kV/cm 30 F, L. Graham and A. van der Eb, Virology 52, 456 (1973). sl A. Lieber, M. Teppke, G. Herrmann, and M. Strauss, FEBS Lett. 282, 225 (1991).
[5l
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
55
for 3.5 msec with Sp2/0 and 3.0 kV/cm for 3.5 msec with CHO or Ltkcells.
Reporter Gene Assays Chloramphenicol Acetyltransferase Activity. Our assay is a modification of the original procedure of Gorman et al. 32 as described previously .23 Luciferase Activity. Cells are trypsinized and incubated with medium plus 10% (v/v) calf serum for 30 min and are subsequently washed with phosphate-buffered saline (PBS). Then 106 cells are lysed in 1 ml buffer containing 25 mM Tris-phosphate (pH 7.8)/8 mM MgC12/1 mM dithiothreitol (DTT)/I% (v/v) Triton X-100/I% (v/v) bovine serum albumin/15% (v/v) glycerol/0.4 mM phenylmethylsulfonyl fluoride (PMSF). Cell debris is removed by centrifugation. The enzyme reaction mixture contains 50/xl lysate, 2.5 ~1 of 10 mM ATP, and 5 p~l of 1 mM luciferin. The latter is added 10 sec before introducing the reaction tube into the scintillation counter. Photon emission is counted for 10 sec. Photon emission is counted immediately with the luminometer. Between 10 sec and 5 min after addition of luciferin the photon emission does not decrease significantly. There is a linear dependence of emission from the enzyme concentration between 102 and 10 7 counts. Growth Hormone Detection. An enzyme-linked immunosorbent assay (ELISA) is used in which a monoclonal anti-hGH antibody (1:2000 in PBS) is fixed to a microtiter plate by overnight incubation at 4°. After washing three times with water and with PBS plus 0.05% (v/v) Tween 20 the cavities are blocked with 150 /~i of 0.5% (v/v) bovine serum albumin in PBS at 37° for 1 hr. Then 50 /~1 of cell culture supernatant is added to the coated cavities, incubated at 37° for I hr, and washed off with PBS plus 0.05% (v/v) Tween 20. After adding 50 /~I of a rabbit anti-hGH antiserum (1 : 5000), incubating at 37° for 1 hr, and washing, 50/~1 of peroxidase-conjugated goat anti-rabbit antibodies is added. Following incubation at 37° for 1 hr and extensive washing with water, 100 p,l of the staining solution is added containing 25 mg/ml o-phenyldiamine (OPD) in 0.1 M phosphate-citrate buffer (pH 5.0). The color intensity is measured in a photometer. A commercial hGH (Serono, Switzerland) is used as a standard. Linear response is observed between 0.5 and 10 ng/ml. Detection of Tissue Plasminogen Activator. The tissue plasminogen activator (tPA) protein was determined using an ELISA exactly as described for hGH. 32 C. Gorman, L. F. Moffat, and B. Howard, Mol. Cell. Biol. 2, 1044 (1982).
56
VECTORS FOR EXPRESSING CLONED GENES
[5]
Experimental Procedures Cloning and Isolation of Mutant 77 Promoters Mutant Oligonucleotide Synthesis. The sequence of the T7 promoter with additional flanking restriction sites is synthesized using a modification of the mutagenic procedure published previously. 31 To 2.9 ml of the main phosphoamidite solution (0.13 M) in each position 78/xl of each of the other three amidite solutions is added, resulting in an impurity of 8% for each solution. The oligonucleotide mixture is vacuum dried and dissolved in TE buffer. One microgram of the oligonucleotide mixture is annealed to 1/xg of a 18-mer primer completely complementary to the 3' end of the promoter/linker sequence in 10/.tl of TE by heating to 95 ° and slow cooling to room temperature. The tube is briefly centrifuged. Double-strand synthesis is performed in a total volume of 25/zl with I0 U of Klenow fragment of DNA polymerase in the presence of a 0.4 mM concentration of all four deoxynucleotide triphosphates and 1 /zCi of [32p]ATP for 1 hr at room temperature. Double strands are purified by gel electrophoresis in a 6% (w/v) polyacrylamide gel, excission of the top band, maceration, and elution in 0.5 M ammonium acetate at 37° overnight. The eluate is applied to a C18 column (SepPak; Waters Chromatography Division, Millipore, Milford, MA), the latter is washed with water, and elution is done with I vol of 60% (v/v) methanol. The eluate is dried in a vacuum centrifuge (SpeedVac) and redissolved in TE buffer. HeLa Nuclear Extracts. HeLa cells are grown in roller bottles to a total of 101° cells. Extracts are prepared according to the procedure described by Manley, 33 which is not outlined here. Following precipitation with (NH4)zSO 2 the extract is dialyzed against a 1000-fold volume of 20 mM Tris-HCl (pH 7.9)-20% (v/v) glycerol-0.2 mM EDTA-10 mM 2-mercaptoethanol-0. I M KC1-0.5 mM PMSF. Extracts with a protein concentration of 15 mg/ml are stored in aliquots in liquid nitrogen. Promoter Adsorption to Nuclear Proteins. Salt conditions must be optimized. From our experience we recommend the following composition: Tris-HCl (pH 7.9), 12 mM KCI, 50 mM MgClz, 10 mM 2-Mercaptoethanol, 10 mM EDTA, 0.2 mM Glycerol (15%, v/v) 33 j. L. Manley, in "Transcription and Translation: A Practical Approach" (B. D. Hames and S. J. Higgins, eds.), p. 91. 1RL Press, Oxford, England, 1987.
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
57
The incubation mixture contains this buffer and the following additives in a total of 20 txl: H e L a extract (10-20/xg) diluted in dialysis buffer Escherichia coli DNA (2/xg) and 1 /xg hDNA After preincubation at room temperature for 5 min, 20 ng of end-labeled double-stranded mutant oligonucleotides is added. Following incubation at room temperature for 20 min and addition of 2/xl electrophoresis sample buffer the sample is run in a 5% (w/v) nondenaturing polyacrylamide gel at low ionic strength (6.8 mM Tris-HC1, pH 7.9/1 mM EDTA/3.3 mM sodium acetate) with buffer circulation. The wet gel is exposed to X-ray film for 30 min and the band corresponding to unbound oligonucleotides is excised. After elution with 0.5 M ammonium acetate (1.5 ml) at 37° overnight and purification over a C18 column, 50/zg of proteinase K and 1 mM CaC12 are added. The treatment is stopped after 15 min at 37° by addition of 5 mM EDTA and an equal volume of phenol. The oligonucleotides are precipitated with 10 vol of ethanol in the presence of 5 /xg dextran T-500. After amplification by polymerase chain reaction (PCR) the incubation with HeLa extract is repeated three times. Amplification by Polymerase Chain Reaction. The oligonucleotides are redissolved in 30/xl H20 and 300/zg total of both primers corresponding to the nonmutated flanking sequences of the T7 promoter is added together with 12.5 ~1 of a 20% (v/v) Chelex 10034solution. After heating to 95 ° for 5 min and cooling on ice, Taq buffer, 2 mM concentrations of all four deoxynucleotides, and I U Taq polymerase are added. Thirty cycles (1 min at 94 °, 45 sec at 50 °, 30 sec at 74 °) are performed with a 10-rain postincubation at 74 °. After estimation of the amount of oligonucleotides, 20 ng is treated again with HeLa extracts as above. Binding to T7 RNA Polymerase. Conditions for incubation of oligonucleotides with T7 RNA polymerase are exactly as described above for HeLa extracts, using 250 U of enzyme instead of extract. Following electrophoresis the retarded band was excised, purified, and amplified as described. Cloning of Mutant Promoters. One microgram of the polymerasebinding mutant oligonucleotides is cleaved with 100 U of both restriction endonucleases having sites in the flanking sequences (EcoRI and XbaI in our case) and ligated to the human growth hormone gene in pUC19. Following transformation bacterial colonies are screened for inserts by using end-labeled PCR primers. Transcription in Vitro. Plasmid minipreparations can be used after 34 j. Singer-Sam, R. L. Tanguay, and A. D. Riggs, Amplifications 3, 11 (1989).
58
VECTORS FOR EXPRESSING CLONED GENES
[5]
extensive RNase treatment. Individual mutant promoter plasmids are tested for transcription with T7 polymerase in the presence or absence of HeLa cell extract by incubating in the following reaction mixture (25/A): HeLa extract (8 mg/ml) or dialysis buffer, 12.5/xl MgC1z, 10 mM RNasin, 2 U ATP, GTP, and UTP, 500/zM [32p]CTP (0.5/zCi), 50/xM T7 RNA polymerase, 50 U Plasmid DNA, 1/~g After incubation at 30 ° for I hr, samples are applied to Whatman (Clifton, NJ) GF/C filters, precipitated with 10% trichloroacetic acid (TCA), washed with TCA, ethanol, and acetone, and measured in a liquid scintillation counter. Cellular Expression Assay. Both CHO and CHO185 cells are transfected with a mixture of 20/zg test plasmid, 2/xg pRSVLuc, 35 and 1 /~g pT7neo using the protocol described above. Assays for hGH secretion and luciferase (transfection standard) are performed after 3 days and one-tenth of the cells are subjected to selection with 600/zg/ml G418 (Geneticin) to generate pools of about 100 colonies for testing stable expression levels. We have analyzed 61 mutant promoters) 6 The expression levels obtained for some of them are given in Table I. The higher transcription of the mutants in vitro in the presence of HeLa extracts reflects the reduced binding of inhibitory factors whereas the reduced expression in CHO cells in vivo is probably due to loss of polymerase II binding. Selection of Cell Clones Carrying T7 R N A Polymerase Several selectable marker genes were cloned downstream of the wildtype or mutant T7 promoter and have been tested for selectability in both CHO and CHO185 cells as well as after cotransfer with pMTT7N. From our experience we recommend using the neo gene. It is actually expressed from the wild-type T7 promoter only in cells expressing T7 polymerase. In contrast, other selectable marker genes can be expressed at a functional level by cellular RNA polymerases from the wild-type T7 promoter. Data of two experiments using the neo gene and selection with Geneticin are given in Table II. In cases in which the rapid establishment of the T7 expression system 35 j. R. de Wet, K. V. Wood, M. DeLuca, D. R. Helinski, and S. Subramani, Mol. Cell. Biol. 7~ 725 (1987). 36 A. Lieber, V. Sandig, and M. Strauss, Eur. J. Biochem. submitted (1992).
[5]
H I G H - L E V E L G E N E EXPRESSION BY TABLE
T7
RNA
59
POLYMERASE
I
PROPERTIES OF MUTANT T 7 PROMOTERS
Promoter
Sequence -18
Wild type Mutant 13 Mutant 44 Mutant 57 Mutant 68 Mutant 86
-10
+1
Transcription"
Expression ~'
in vitro (%)
in vioo I%)
-HeLa
+HeLa
CHO185
CHO
100 70 82 73
10 46 40 46
115 64 70 54
100 6 20 4
50 80
43 55
37 67
8 4
+8
TTAATACGACTCACTATAGGGAGATA ........ G ............ G .... -C - C ................... T- ..... T ............ C - T ..... ...... T ..... C ........ TT- - ..... T ............ C .......
" Transcription by T7 polymerase in vitro was done in the absence or presence of H e L a nuclear extracts. Counts obtained for the wild-type promoter in the absence of extract were taken as 100c;~. h Stable expression of human growth hormone was determined in populations of 100-200 colonies obtained after cotransfer with pT7neo and selection with Geneticin. The level obtained for the wildtype promoter in CHO cells is the 100% value.
in a particular cell type is required we suggest a cotransfer of the gene of interest under control of the mutant T7 promoter together with pMTT7N and pT7neo at a ratio of 20 : ! : 1. In this case 100% of the resulting colonies express T7 polymerase and more than 90% will express the gene of interest. Physical linkage of the gene of interest to pT7neo would guarantee
T A B L E II T 7 R N A POLYMERASE-DEPENDENT SELECTION FOR neo GENE EXPRESSION Colonies a Plasmid pUCII8
pT7neo pT7neo + pMTT7N
C H O cells
C H O 1 8 5 cells
0/0 2/0 100/60
0/1 200/300 ND
T w o d a y s a f t e r t r a n s f e c t i o n w i t h 6 / . t g o f the respective plasmid, the calcium phosphate techn i q u e w a s u s e d to s e e d 1 × 105 cells into 10-cm d i s h e s w i t h D M E M plus 5% ( v / v ) fetal c a l f s e r u m plus 600 p . g / m l G e n e t i c i n . S e l e c t i o n w a s f o r 2 weeks, with medium changes and colony counts m a d e e v e r y third day.
60
VECTORS FOR EXPRESSING CLONED GENES
[5]
expression in 100% of the colonies. This can also be achieved by using bicistronic structures (see below). However, we observed a significantly lower colony number in this kind of cotransfection experiment compared to experiments with cells already expressing T7 polymerase. In most clones, the level of T7 polymerase expression is considerably lower than that expected for metallothionein promoter constructs. It appears that there is a counterselection against cells expressing high levels of T7 polymerase. This conclusion is also supported by the observed difficulty in establishing stable clones with pCMVT7N (Fig. 1), in which T7 RNA polymerase expression is driven by the strong CMV promoter. If high-level expression is the final goal we recommend the use of a two-step protocol: pMTT7N is cotransfected with pT7neo at a ratio of 10 : 1 and cells are selected with the desired concentration of Geneticin depending on the cell type, usually between 400 and 800 ~g/ml. The pool of colonies can be used directly for the second transfection with the respective gene under control of a mutant T7 promoter together with either pT7mpac, pT7mhyg (see Vector and Oligonucleotides, above) or any other marker gene. Bicistronic constructions can also be useful in this case (see below).
Alternative Strategies for T7-Driven Gene Expression If the expression of a particular gene product is disadvantageous for the host cell or should be switched on at a fixed time point it is desirable to have a cell line carrying a silent gene. Two different ways are imaginable for activation of a gene under control of a mutant T7 promoter. First, a tightly regulated promoter could be used. We are currently exploring the usefulness of bacterial operator/repressor systems for this purpose. The use of eukaryotic regulatory elements such as hormone-response elements turned out to be inefficient in this context. The second alternative is the use of retroviral vectors to introduce the T7 polymerase gene efficiently into nearly 100% of the cells. To this end we have developed vectors based on pM6pac expressing the T7 polymerase gene from the retroviral long terminal repeat (LTR) or from CMV or SV40 promoters (Fig. 1). The experimental strategy is as follows. A vector containing the particular gene downstream of the T7m promoter is cotransfected with a selectable marker. After selection individual clones are analyzed for the presence of integrated and intact gene constructions by Southern blotting or PCR. The cells are then infected with a retroviral vector carrying the polymerase gene. We have tested this protocol for expression of the neo gene. Linear pT7neo (6 tzg) was transfected by the calcium phosphate technique into
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
61
5 x 105 NIH 3T3 cells together with 0.5 p~g of pY337 and selection with 50 /zg/ml of hygromycin was started the day after. Resulting colonies were pooled and tested for growth in 400/zg/ml of Geneticin. No survival of cells was observed. The cells were then infected with the retroviral vector pM6SVT7N (Fig. 1), which has been packaged by transfection of GP + E86 cells and was selected with 4/zg/ml of puromycin. The titer of the virus has been estimated on N I H 3T3 cells to be 1 x 105. The cells carrying the silent neo gene (105/5-cm dish) were infected with different aliquots of M6SVT7N virus stock (0.01, 0.1, and 1 ml). One day later cells were seeded at a concentration of 1000/5-cm dish in triplicate and selected with 400 /~g/ml of Geneticin. Parallel dishes without selection allowed the determination of plating efficiency. With the highest amount of virus (1 ml) the number of colonies in Geneticin equaled the plating efficiency without selection, suggesting a nearly 100% induction of expression of the neo gene. 38
Applications High-Level Foreign Gene Expression Stable Expression of the Genomic Human Growth Hormone Gene. All previous experiments for high-level expression have been performed with the wild-type T7 promoter. Because we have isolated optimized mutant promoters only recently, we have at present no long-term expression data. However, the preliminary data suggest that the levels of expression from the wild-type and mutant promoters are comparable. Here we describe our protocol, which leads to high-level expression of human growth hormone. A plasmid pGGH2.2 is constructed by cloning a 2.1-kbp genomic human growth hormone gene between the BamHI and EcoRI sites of pGEM2. Ten micrograms of linearized plasmid is cotransfected with 0.5 tzg pSV2neo 39 into 3 x 105 polymorphonuclear (PMN) mouse cells (clone A5) by the calcium phosphate technique as described above. After an overnight incubation with the DNA precipitate, cells are washed and supplemented with fresh medium. After 2 days cells are trypsinized, divided 1 : 6 into new dishes, and subjected to selection with 400/zg/ml of Geneticin. Medium is changed every third day for a period of 3 weeks. Colonies are trypsinized all together and seeded into 96-well microtiter plates at a dilution of 1 cell per every second well. Medium with Geneticin 37 K. Blochlinger and H. Diggelmann, Mol. Cell. Biol. 4, 2929 (1984). 38 W. Sommer and M. Strauss, manuscript in preparation (1992). 39 p. j. Southern and P. Berg, J. Mol. Appl. Genet. 1, 327 (1982).
62
VECTORS FOR EXPRESSING CLONED GENES
[5] kD
-
97
-
66
-
45
- 24 -4----
hGH
FIG. 3. Electrophoretic pattern of immunoprecipitated hGH produced by a PMN cell clone harboring a T7hGH plasmid. Lanes 1 and 2 are immunoprecipitates from extracts of 10 6 cells, lanes 3 to 8 are precipitates from 100/.d of culture supernatant. Lane 1 is fresh extract, lane 2 is extract incubated at 37° for I hr, lanes 3 to 5 are successive 24-hr supernatants of logarithmic cells, and lanes 6 to 8 represent the same culture supernatant of a confluent monolayer after 24, 48, and 72 hr. Immunoprecipitation was done by subsequent incubation with antiserum and protein A-Sepharose. The precipitates were run in a 12% (w/v) polyacrylamide gel.
is changed once a week. After 3 weeks supernatants are assayed for growth hormone secretion by the ELISA described above. High producers (more than 10/zg/ml hGH) are recloned to guarantee later stability of the clones. Using this protocol we succeeded in isolating several clones producing considerably more than 10/xg/ml/106 cells/day from approximately 250 primary colonies, with 2 clones producing 20 and 30 tzg/ml. These levels are slightly above those obtained using CMV or metallothionein promoter constructs. 36 However, the percentage of good producers is much lower (about 1 out of 400) in the latter case. The yield of growth hormone is best if the medium is changed every day and better in the exponential growth phase compared to a stationary culture. A typical pattern of growth hormone in cell extracts and in the medium after immunoprecipitation is shown in Fig. 3.
[5]
63
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE AAYA~
AA'TAAA
A VA
#"~
~ T ~
~TJO~
B PA
P'A
C
iI
T7prom.
V. rnouw
CI~ huml~'l
VKm~.
,
,
~-,khurrmn
FIG. 4. Maps of bi- and polycistronic constructions driven by a T7 promoter,
Stable Expression of Tissue Plasminogen Activator cDNA. The cDNA for human tissue plasminogen activator is cloned into pGEM downstream to the T7 promoter. The linear plasmid (6 tzg) is cotransfected with pSV2neo (0.5 /~g) into CHO185 cells. After 3 days, selection with 600 /xg/ml of Geneticin is started. Three weeks later colonies are pooled and cloned in microtiter plates as described for growth hormone expression. Clones producing more than 2 /~g/10 6 cells/day are recloned three times before stable expression levels can be detected. The highest level obtained in our experiments was 5 /zg/10 6 cells/day. Expression of Bi- and Polycistronic mRNA Selection of Expressing Clones. The coding sequence of the neo gene is cloned downstream to the gene of interest. The presence of a polyadenylation signal does not interfere with transcription of the bicistronic mRNA. We used fusion with the tPA cDNA as a model. A plasmid pGtPAAneo is constructed (Fig. 4A) and transfected into PMN cells (clone A5). Selection is performed using 400/zg/ml of Geneticin. The number of colonies obtained is about 10-fold lower as compared to transfections with pSV2neo (20 colonies/5-cm dish). However, all colonies give rise to stable clones expressing moderate to high levels of tPA. No colonies can be obtained in CHO cells due to the function of the polyadenylation signal as a transcriptional terminator. Alternatively, the luciferase coding sequence can be fused downstream to the gene of interest to allow for rapid quantitation of gene expression. We use a tPA-luc fusion gene. The plasmid pGtPAAL (Fig. 4B) is cotrans-
64
VECTORS FOR EXPRESSING CLONED GENES
[5]
fected with pT7mpaC into CHO cells expressing T7 polymerase. Selection is carried out with 4/.tg/ml ofpuromycin. Colonies are tested for luciferase expression, which can be detected at the level of 1-10 cells. However, the luciferase activity is decreased by a factor of five when the cistron is expressed in the second position instead of in the first position. The level of tPA synthesis correlates very well with the luciferase activity. No luciferase activity can be detected in CHO cells with this construction. As soon as a semiquantitative in situ assay for luciferase activity is available this kind of gene fusion will allow rapid identification of producer clones. Expression of Chimeric lmmunoglobulins. A plasmid pT7Ig may be constructed (Fig. 4C) in which the genomic sequences for variable regions of a mouse antibody to pig transferrin (a gift of Dr. S. Deev, Moscow) are fused to the genomic sequences for the constant regions of human IgE. The plasmid, containing two internal polyadenylation signals (which do not influence transcription by T7 polymerase), is cotransfected by electroporation with pT7mpac into Sp2/0 myeloma cells previously selected for expression of T7 RNA polymerase. After selection and subcloning in 96well microtiter plates secretion of IgE is determined using a commercial ELISA. Average levels of 100 ng/ml of IgE are detectable. Extracts are prepared and subjected to electrophoresis, and the gel is blotted to nitrocellulose and probed with anti-IgE. A 75-kDa heavy chain and a 25-kDa light chain are found. Using a solid-phase adsorption assay for pig transferrin, specific binding activity of the chimeric antibody is confirmed. Northern blot analysis shows the presence of a major transcript of about 8 kb. 4°
Synthesis of Antisense RNA and Ribozymes Recent applications of the T7 expression system in o u r laboratory have been directed toward the high-level synthesis of antisense RNA and ribozymes. The principle is described in brief: The T7 system allows expression of several thousand up to 30,000 RNA molecules per cell. For mRNAs of low or moderate abundance this level of antisense RNA might be sufficient to knock out the mRNA. We have tested this assumption by expression of a 365-bp fragment from the first exon of the human Rb-1 gene. We generated stable cell lines from CHO cells and primary human fibroblasts. In both systems no synthesis of the RB protein was detectable. Whereas the first were converted into tumorigenic cell lines, the latter have a dramatically shortened cell cycle.41 The tumorigenic cell lines might be immortalized, which is currently under investigation. 4o A. Lieber and M. Strauss, manuscript in preparation. 41 M. Strauss, S. Hering, A. Lieber, G. Herrmann, B. E. Griffin, and W. Arnold, Oncogene, in press (1992).
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
65
,p --- UAeC C eeUCUC CA UCUAU---"Rm ~ n GGAGGACAUGCGGGGC~ ACUGUCGUUGCAGAUA
AA %GA AGcGAGU ~'
GC AGua
FIG. 5. Structure of a ribozyme construction directed to the mRNA of hGH.
For mRNAs of higher abundance the use of hammerhead ribozymes 42'43 might be more efficient than using simple antisense RNA. We have designed a ribozyme construction against the mRNA for hGH (Fig. 5). The hammerhead structure and the flanking complementary sequences were synthesized as three overlapping oligonucleotides, annealed, filled in with Klenow polymerase, and cloned into the EcoRI site of pGEM1 together with the coding sequence of the neo gene. The resulting plasmid, pRZGHneo, was used to transfect PMN cells already expressing hGH from the T7 promoter. Following selection with Geneticin clones were analyzed for hGH secretion. The levels varied between 25 and 2.5% of the original hGH synthesis, with the majority of clones producing very low levels of hGH. Discussion and Comments The heterologous gene expression system described here has several advantages over others. However, several problems must be considered. First, the T7 promoter is not exclusively transcribed by T7 polymerase within the nucleus of mammalian cells. Second, the levels of expression obtained with the T7 system are not significantly higher than those obtained with strong eukaryotic promoters under optimal conditions. An third, high-level expression of the T7 RNA polymerase is disadvantageous to the host cell. The considerable expression level caused by the cellular RNA polymerase with the wild-type promoter does not significantly influence the expression by T7 polymerase. Thus, we may recommend the use of the wildtype promoter in most cases where high-level stable gene expression is 42 A. C. Forster and R. H. Symons, Cell 49, 211 (1987). 43 C. C. Sheldon, A. C. Jeffries, C. Davies, and R. H. Symons, in "Nucleic Acids and Molecular Biology" (F. Eckstein and D. M. J. LiUey, eds.), Vol. 4, p. 227. SpringerVerlag, Berlin, 1990.
66
VECTORS FOR EXPRESSING CLONED GENES
[6]
required. The advantage over other stable expression systems is the ease of selecting producer clones, not the height of expression. The expression levels are always lower in stable systems compared with the lytic viral ones. We tried to make use of the excess of T7 polymerase present in the nucleus of some clones by using episomal origin vectors. However, up to now the levels of expression could be enhanced only two- to fourfold. 44 We are currently working on the establishment of regulated systems that might allow a higher level of expression for a short period of time. The chief advantage of the modified T7 system based on mutant promoters is the strong dependence on transcription by T7 RNA polymerase. Thus, the system can be used for all purposes of selective gene expression. Cell lines or even transgenic mice carrying silent genes under the control of a mutant promoter can be established and their expression can be stimulated via subsequent introduction of T7 polymerase, for example, by retroviral vectors. Alternatively, inducible repressor systems could be used to repress either the T7 promoter or T7 polymerase expression. Additional useful applications are the expression of bi- or polycistronic mRNA as well as the efficient expression of antisense RNA or ribozymes. 44 V, Sandig and M. Strauss, unpublished observations 0991),
[6] E x p r e s s i o n V e c t o r s f o r H i g h - L e v e l G e n e E x p r e s s i o n in Dicotyledonous and Monocotyledonous Plants By REINHARD TOPFER, CHRISTOPH MAAS, CHRISTA H(SRICKE-GRANDPIERRE, J E F F SCHELL,
and
H A N S - H E N N I N G STEINBISS
Introduction High-level expression of selectable marker genes as well as that of agronomically important genes is a crucial aspect of plant molecular biology. The first chimeric genes for plant transformation experiments consisted of bacterial antibiotic resistance genes controlled by promoters derived from genes carried by the T-DNA region ofAgrobacterium tumefaciens Ti plasmids. ~-3 A second generation of constructs made use of the L. Herrera-Estrella, M. De Block, E. Messens, J.-P. Hernalsteens, M. Van Montagu, and J. Schell, EMBO J. 2, 987 (1983). M. Bevan, R. B. Flavell, and M.-D. Chilton, Nature (London) 304, 184 (1983).
METHODS IN ENZYMOLOGY,VOL.217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
HIGH-LEVEL GENE EXPRESSION BY T7 RNA POLYMERASE
47
and C219 is not entirely specific for P-glycoprotein.31 A series of antibodies directed against human P170 peptides has been described. 32Most of these antibodies, except for MRK-16, can be used on Western blots. 3. After resuspending immunoprecipitated material in sodium dodecylsulfate (SDS)-sample buffer for a Laemmli-type gel,33 elute antibody-P170 conjugate at room temperature for 15 min. Boiling will cause P170 to aggregate and it will not enter an SDS-polyacrylamide (PAGE) gel. 4. The MDRI gene product will migrate on SDS-PAGE as a diffuse band of approximately 170K. Apparent molecular weight will vary depending on the cell type being used for expression, probably due to differential glycosylation patterns. Cell lines expressing P-glycoprotein on their surfaces can also be detected by indirect immunofluorescence as described by Willingham et al.34 Positive cells can also be detected and sorted by FACS. For this purpose, we use 10/xg MRK-16/106 cells 29 with 85 /zg fluorescein isothiocyanate (FITC) goat anti-mouse IgG per 10 6 cells as a second antibody for fluorescence detection. 3~ F. Thiebaut, T. Tsuruo, H. Hamada, M. M. Gottesman, I. Pastan, and M. C. Willingham. J, Histochem. Cytochem. 37, 159 (1989). 3: E. P. Bruggemann, V. Chaudhary, M. M. Gottesman, and I. Pastan, BioTechniques 10, 202 (1991). 33 U. K. Laemmli, Nature (London) 227, 680 (1970). 34 M. C. Willingharn, N. D. Richert, M. M. Cornwel|, T. Tsuruo, H. Hamada, M. M. Gottesman, and I. Pastan, J. Histochem. Cytochem. 35, 1451 (1987).
[5] S t a b l e H i g h - L e v e l G e n e E x p r e s s i o n in M a m m a l i a n by T7 Phage RNA Polymerase
Cells
By A N D R E LIEBER, VOLKER SANDIG, WOLFGANG SOMMER, SILVIA BAHRING, and MICHAEL STRAUSS Introduction Various routes for high-level foreign gene expression in mammalian cells have been explored over the years) '2 However, there are not that many different principles to choose from; the choice is between transient and stable expression systems. Expression vectors for the first kind of I M. Strauss, U. Kiessling, and M. Platzer, Biol. Zentralbl. 105, 209 (1986). 2 j. Sambrook and M.-J. Gething, Focus 10, 41 (1987).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
48
VECTORS FOR EXPRESSING CLONED GENES
[5]
systems are mainly derived from viruses, such as vaccinia virus, 3-5 baculovirus, 6'7 simian virus 40 (SV40), 8'9 and others. Some of these systems
allow for very high expression levels, but only for the short period of 1-3 days.2,5,7 High-level transient expression is therefore useful for producing large amounts of a particular protein for further biochemical studies. However, under certain demanding conditions, it is desirable to express foreign genes continuously at a relatively high level. Stable expression of foreign genes can be achieved using constructs that either integrate into the host cell genome or have the ability to replicate at a moderate level. Vectors of the second type are preferentially derived from bovine papilloma virus (BPV) 1°-12 and from Epstein-Barr virus (EBV). 13 Integrating plasmid vectors can be amplified by linkage to genes such as that for dihydrofolate reductase (DHFR) 14A5or metallothionein 16 and subsequent selection with increasing drug concentrations. However, when genes are amplified by more than 100-fold the increase in the expression level is often less than 10-fold. 1~Additionally, differences in the level of expression achieved with various strong viral or mammalian promoters are within one order of magnitude when analyzed in transient expression assays.~7 Differences in the expression levels between individual clones derived from one and the same transfection can be enormous, ranging between only a few nanograms and several micrograms per 106 cells/ml/day. N,15 In searching for a stable expression system that is not restricted by the availability of host cell transcription factors and RNA polymerase, we became interested in the use of a bacteriophage promoter/polymerase system for which a highly selective function in prokaryotic host cells was 3 D. Panicalli and E, Paoletti, Proc. Natl. Acad. Sci. U.S.A. 79, 4927 (1982). 4 M. Mackett, G. L. Smith, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 79, 7415 (1982). 5 T. R. Fuerst and B. Moss, J. Mol. Biol. 206, 333 (1989). 6 G. E. Smith, M. J. Fraser, and M. D. Summers, J. Virol. 46, 584 (1983). 7 V. A. Luckow and M. D. Summers, Bio/Technology 6, 47 (1988). 8 M.-J. Gething and J. Sambrook, Nature (London) 293, 620 (1981). 9 j. T. Elder, R. A. Spritz, and S. M. Weissman, Annu. Rev. Genet. 15, 295 (1981). 10N. Sarver, P. Gruss, M.-F. Law, G. Khoury, and P. M. Howley, Mol. Cell. Biol, 1, 486 (1981). ii N. Hsiung, R. Fitts, S. Wilson, A. Milne, and D. Hamer, J. Mol. Appl. Genet. 2, 497 (1984). 12 D. DiMaio, in "The Papillomaviruses," p. 293. Plenum, New York, 1987. 13 p. B. G. M. Belt, H. Groeneveld, W. J. Teubel, P. van de Putte, and C. Backendorf, Gene 84, 407 (1989). 14 R. J. Kaufman and P. A. Sharp, J. Mol. Biol. 159, 601 (1982). 15 R. J. Kaufman, L. C. Wasley, A. J. Spiliotes, S. D. Gossels, S. A. Latt, G. R. Larsen, and R. M. Kay, Mol. Cell. Biol. 5, 1750 (1985). 16 G. N. Pavlakis and D. Hamer, Proc. Natl. Acad. Sci. U.S.A. 80, 397 (1983). 17 D. R. Hurwitz, R. Hodges, W. Drohan, and N. Sarver, Nucleic Acids Res. 15, 7137 (1987).
[5]
HIGH-LEVEL GENE EXPRESSION BY
T7 R N A POLYMERASE
49
known. Like other uneven T phages, the T7 phage codes for an RNA polymerase that is selective for phage promoters.~8-2° The latter, in turn, are so different in sequence from bacterial promoters that they cannot be transcribed by the bacterial RNA polymerase. ~8Moss and co-workers 2~'20were first in using this principle for the short-term vaccinia expression system. In this chapter we describe the adaptation of the transcriptional machinery of phage T7 to the mammalian cell system for highly selective stable gene expression. Principle In our original publication of T7 RNA polymerase-dependent gene expression in mammalian cells 23 we showed that the expression of the T7 RNA polymerase gene leads to cytoplasmic localization of the polymerase. This, in fact, is potentially useful for efficient transient expression from transfected plasmids and it is an ideal prerequisite for expression using vaccinia vectors. 24 For stable foreign gene expression a nuclear localization of the T7 polymerase is required. This has been achieved by fusion of a nuclear location signal to the amino terminus of the polymerase 25 or by substituting the nuclear location signal for the N-terminal 5% of the polymerase. 23 Cell lines can be established with this modified gene that harbor the T7 polymerase exclusively in the nucleus. Transfection of a foreign gene under control of a T7 promoter into such cells should result in transient as well as stable expression of the particular gene driven by the T7 polymerase. In fact, using chloramphenicol acetyl transferase (cat) 23 and other reporter genes we could demonstrate efficient expression within the range obtained with the strong Rous sarcoma virus (RSV) and cytomegalovirus (CMV) promoters. Human growth hormone has been expressed stably at levels of 20-30/zg/ml/106 cells/day. 26 However, we verified an effect that has been noticed before by ourselves and by other 18 j. j. Dunn and F. W. Studier, J. Mol. Biol. 166, 477 (1983). 19 p. Davanloo, A. H. Rosenberg, J. J. Dunn, and F. W. Studier, Proc. Natl. Acad. Sci. U.S.A. 81, 2035 (1984). 20 B. A. Moffat, J. J. Dunn, and F. W. Studier, J. Mol. Biol. 173, 265 (1984). 21 T. R. Fuerst, E. G. Niles, F. W. Studier, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 83, 8122 (1986). 22 B. Moss, O. Elroy-Stein, T. Mizukami, W. A. Alexander, and T. R. Fuerst, Nature (London) 348, 91 (1990). 23 A. Lieber, U. Kiessling, and M. Strauss, Nucleic Acids Res. 17, 8485 (1989). 24 O. Elroy-Stein and B. Moss, Proc. Natl. Acad. Sci. U,S.A. 87, 6743 (1990). 25 j. j. Dunn, B. Krippl, K. E. Bernstein, H. Westphal, and F. W. Studier, Gene 68, 259 (1988). 26 A. Lieber and M. Strauss, unpublished observations (1990).
50
VECTORS FOR EXPRESSING CLONED GENES
[5]
users of the system. It turned out that the T7 promoter can be transcribed by a cellular polymerase (probably polymerase II) quite efficiently if present in the context of a pGEM plasmid. This background expression level amounts to 10-50%, depending on the cell type. Thus, the T7 promoter in pGEM is actually a reasonably efficient promoter in mammalian cells, which allows the use of one and the same construct for expression in prokaryotic and eukaryotic cells as well as in a cell-free system. We will describe this interesting aspect elsewhere. 27 To establish an exclusive expression system for mammalian cells it was necessary to generate a modified T7 promoter that does not function with the cellular RNA polymerases and is still active with the T7 polymerase. Because we have succeeded in isolating several mutant promoters fulfilling these requirements we will describe the procedure in the first part of the experimental section (cloning and isolation of mutant T7 promoters). The strategy involves the synthesis of randomly mutagenized promoter oligonucleotides, their repeated incubation with HeLa cell nuclear extracts, the incubation of the unbound fraction with purified T7 polymerase, and amplification and cloning of the polymerase-bound fraction. Individual clones are assayed for function with T7 polymerase in vitro and within the cell using human growth hormone (hGH) as the test gene. The second part of the method to be outlined concerns gene transfer and the selection of clones expressing foreign genes under control of modified T7 promoters. The preferred protocol involves the use of a selectable marker also under control of a T7 promoter. There are three general variants of the procedure: (1) transfer of the gene of interest into cells already expressing the polymerase gene, (2) cotransfer of test gene, polymerase gene, and selectable marker, and (3) establishment of cells carrying a silent T7 promoter/test gene construct with subsequent gene activation by retroviral transfer of the polymerase gene. All three variants have their advantages and disadvantages. Finally, we will describe applications of the T7 expression system for purposes where this system is unique. Besides high-level expression of proteins from cDNA or genomic DNA it is exceptionally useful for expressing polycistronic mRNA and antisense RNA. Materials
Cell Lines
Mouse L t k - cells, Chinese hamster ovary (CHO) cells, and mouse myeloma cell line Sp2/0 Ag 14 are used as recipient cells for the polymerase gene and for cotransfections. 27 V. Sandig, A. Lieber, S. B~ihring, and M. Strauss, Gene, submitted (1992).
[5]
HIGH-LEVEL GENE EXPRESSION BY T 7 R N A POLYMERASE ~
I
1
f
r "Ec° R1369
\
I
51
f
-
/
I"7R N A !~ymemse ~
II T7 P.NA ! ~
~n~
1 ¢,, BsmHl --_ ~,_ ~ . . . ~ T R • Pat 11019
i LTR1 Pvu
M6SVTTN ~ 1 bp I12392 a 12467
rCLS/•x.bBtt
I
tit Pol
I"7R N A ~ y n ~ r a ~
FIG. 1. M a p s of plasmid v e c t o r s carrying the gene for a nuclear T7 R N A polymerase.
PMN clone A5 is a derivative of Ltk- cells expressing T7 RNA polymerase at a high level from the construct pMTT7N (Fig. 1) and has been selected with cadmium for the presence of the mouse metallothionein gene. 23 CHO185 is a clone of CHO cells that has been selected for the presence of pMTT7N. Ltk- cells, CHO cells, and their derivatives are grown in Dulbecco's modified Eagle's medium (DMEM) with 5% (v/v) fetal calf serum (GIBCO, Grand Island, NY) at 5% COz. Myeloma cells are grown in RPMI 1640 medium with 10% (v/v) fetal calf serum and 1 mg/ml of gentamycin.
Vectors and Oligonucleotides The vector family pGEM (Promega Madison, WI) was used originally for cloning and expression of reporter and selectable marker genes. In the studies described here only pT7neo is used from this series. For cloning
VECTORSFOR EXPRESSINGCLONEDGENES
52
HindI11.1~LHine!1.XImi ~ . _ ~_~Bam/~Bgm74
j
IS]
modit-a~l"l'7/a,omo~ !'''~Hindll125
"\
#
F,r.oR1396 BarnHI414 ~ / ~Xho!445 modit'l~lT7~ ~ ~ S p h 1445
hl~
7881~H~
~H
poly(A)signal Sph12640
Sph17.320
FIG. 2. Maps of plasmid vectors with marker genes driven from wild-type or mutant T7 promoters.
of the modified (mutant) T7 promoters pUC 19 is used. The standard vector with the most suitable promoter mutation (No. 86) is named pT7 m. Reporter and test genes are cloned into this vector and named accordingly pT7mhGH, pT7mluc, etc. (Fig. 2). The sequence of the synthetic T7 promoter is as follows: Wild type: Mutant 86:
5'-TTAATACGACTCACTATAGGGAGATA-3' ..... T ............ C .......
pMTT7N is derived from pMTT7 by replacing the BgllI/NarI fragment with a synthetic sequence coding for the nuclear location signal of SV40 large T antigen (Fig. 1). Because the sequence given in the original article 23 mistakenly contained two additional nucleotides, we give the correct sequence here (bold: sequence of the SV40 nuclear location signal):
[5]
HIGH-LEVEL GENE EXPRESSION BY T 7 R N A POLYMERASE
53
5'-AGATCTTTGCAAAAAGC T TTGC AAG A TGGATAAAGTT T TTAGAAAC TCCAGTAGG Me t A s pLy s V a 1 P h e A r g A s n S e r S e t A r g ACT
CCT CCA
A A A AAG AAG A G A AAG G T A GAA C G T C T A G A T C - 3 '
Thr-Pro-Pro-Ly
s -Ly s-Ly
s -Ar g-Ly
s -Va I -GI u ArgLeuAsp
pCMVT7N is constructed by inserting the 3.3-kbp BgllI/PvulI fragment of pMTT7N between the BgllI and SmaI sites of pCMVLT2. 28 pM6SVT7N contains the BgllI/PvulI fragment of pMTT7N inserted into the BgllI site of the retroviral vector construct pM6pac 29 (Fig. I).
Reagents All reagents should be of the highest purity available. The main compounds and enzymes used in our laboratory are from the following suppliers: Geneticin: GIBCO/BRL (Grand Island, NY)/Bethesda Research Laboratories (Gaithersburg, MD), Life Sciences Puromycin: Sigma (St. Louis, MO) DEAE-dextran (Mr 500,000): Pharmacia (Uppsala, Sweden) T7 RNA polymerase: New England BioLabs (Beverly, MA) Restriction enzymes: Boehringer Mannheim (Mannheim, Germany), Bethesda Research Laboratories, New England BioLabs Salts: Sigma BD-cellulose: Serva Feinchemica (Heidelberg, Germany)
Equipment Oligonucleotide synthesis: Performed using an Applied Biosystems (Foster City, CA) DNA synthesizer model 380 on the basis of methoxyamidites Electroporation experiments: Performed using the GenePulser (BioRad, Richmond, CA) Luciferase assays: Performed using a liquid scintillation counter PW 4700 (Philips, The Netherlands) or a luminometer LB 9501-1 Lumat (Berthold, Germany) General Methods
Purification of Plasmids for Transfection Plasmids are purified by two rounds of cesium chloride gradient centrifugation or, preferentially, superior purity is achieved by column z8 M. Strauss, S. Hering, L. Lfibbe, and B. E. Griffin, Oncogene 5, 1223 (1990). z9 M. Wirth, R. G r a n n e m a n n , and H. H a u s e r , J. Virol. submitted.
54
VECTORS FOR EXPRESSING CLONED GENES
[5]
chromatography on BD-cellulose as follows: A cleared alkaline lysate is neutralized, phenol treated, and precipitated with ethanol as in the standard procedure. The pellet is dissolved in TE buffer [10 mM TrisHCI, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.6]; RNA and protein are selectively precipitated by addition of ammonium acetate to a final concentration of 2.3 M. The precipitate is removed by centrifugation at 6000 rpm/min for 10 min at 4°. The DNA is precipitated from the supernatant with 70% (v/v) ethanol. After centrifugation the pellet is dissolved in 3 ml TE buffer with 0.3 M NaCI (pH 8). Two milliliters of BD-cellulose in TE buffer plus 0.3 M NaCI is filled into a 4- to 5-ml plastic column or syringe and the DNA solution is applied. The column can be spun; however, for maximal yields it should be run by gravity and the flow-through should be applied a second time. After washing with five column volumes of the same buffer the plasmid DNA is eluted with TE buffer plus 1 M NaCI and precipitated with 70% (v/v) ethanol.
Transfection Procedures For transfection of fibroblasts we generally use a modification of the standard calcium phosphate coprecipitation method. 23'3° The highest efficiencies (approximately 10 -3) a r e obtained as follows: 10 /zg of plasmid DNA in 220/xl of TE buffer plus 30/zl of 2 M CaCI2 are mixed in a test tube, and 250 t-d of 2 × HBS [50 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), 280 mM NaCI, 1.5 mM sodium phosphate (equal amounts of mono- and dibasic), pH 6.96] is added dropwise with simultaneous vortexing. The precipitate is directly added to 5 ml of culture medium containing 10% (v/v) fetal calf serum in 25cm 2 tissue culture flasks with cells that have been seeded the day before. For transfection of myeloma cells 31 8/xg of plasmid DNA is precipitated with ethanol, resuspended in 250 ~1 of RPMI 1640-25 mM HEPES (pH 7.15), 250 /zl of RPMI 1640/HEPES containing 1 mg/ml DEAEdextran is added to the DNA with vortexing, and the mixture is incubated with the cells on 10-cm petri dishes for 30 min. After washing with RPMI 1640, 7 ml of medium with serum plus 0.1 mM chloroquine are added for 3.5 hr. Cells are washed again and supplied with fresh medium. Electroporation of 10 7 cells/ml in culture medium with 10% (v/v) fetal calf serum is generally performed on ice with 10-50/xg of linear DNA using the following conditions for different cell types: 1.5 kV/cm 30 F, L. Graham and A. van der Eb, Virology 52, 456 (1973). sl A. Lieber, M. Teppke, G. Herrmann, and M. Strauss, FEBS Lett. 282, 225 (1991).
[5l
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
55
for 3.5 msec with Sp2/0 and 3.0 kV/cm for 3.5 msec with CHO or Ltkcells.
Reporter Gene Assays Chloramphenicol Acetyltransferase Activity. Our assay is a modification of the original procedure of Gorman et al. 32 as described previously .23 Luciferase Activity. Cells are trypsinized and incubated with medium plus 10% (v/v) calf serum for 30 min and are subsequently washed with phosphate-buffered saline (PBS). Then 106 cells are lysed in 1 ml buffer containing 25 mM Tris-phosphate (pH 7.8)/8 mM MgC12/1 mM dithiothreitol (DTT)/I% (v/v) Triton X-100/I% (v/v) bovine serum albumin/15% (v/v) glycerol/0.4 mM phenylmethylsulfonyl fluoride (PMSF). Cell debris is removed by centrifugation. The enzyme reaction mixture contains 50/xl lysate, 2.5 ~1 of 10 mM ATP, and 5 p~l of 1 mM luciferin. The latter is added 10 sec before introducing the reaction tube into the scintillation counter. Photon emission is counted for 10 sec. Photon emission is counted immediately with the luminometer. Between 10 sec and 5 min after addition of luciferin the photon emission does not decrease significantly. There is a linear dependence of emission from the enzyme concentration between 102 and 10 7 counts. Growth Hormone Detection. An enzyme-linked immunosorbent assay (ELISA) is used in which a monoclonal anti-hGH antibody (1:2000 in PBS) is fixed to a microtiter plate by overnight incubation at 4°. After washing three times with water and with PBS plus 0.05% (v/v) Tween 20 the cavities are blocked with 150 /~i of 0.5% (v/v) bovine serum albumin in PBS at 37° for 1 hr. Then 50 /~1 of cell culture supernatant is added to the coated cavities, incubated at 37° for I hr, and washed off with PBS plus 0.05% (v/v) Tween 20. After adding 50 /~I of a rabbit anti-hGH antiserum (1 : 5000), incubating at 37° for 1 hr, and washing, 50/~1 of peroxidase-conjugated goat anti-rabbit antibodies is added. Following incubation at 37° for 1 hr and extensive washing with water, 100 p,l of the staining solution is added containing 25 mg/ml o-phenyldiamine (OPD) in 0.1 M phosphate-citrate buffer (pH 5.0). The color intensity is measured in a photometer. A commercial hGH (Serono, Switzerland) is used as a standard. Linear response is observed between 0.5 and 10 ng/ml. Detection of Tissue Plasminogen Activator. The tissue plasminogen activator (tPA) protein was determined using an ELISA exactly as described for hGH. 32 C. Gorman, L. F. Moffat, and B. Howard, Mol. Cell. Biol. 2, 1044 (1982).
56
VECTORS FOR EXPRESSING CLONED GENES
[5]
Experimental Procedures Cloning and Isolation of Mutant 77 Promoters Mutant Oligonucleotide Synthesis. The sequence of the T7 promoter with additional flanking restriction sites is synthesized using a modification of the mutagenic procedure published previously. 31 To 2.9 ml of the main phosphoamidite solution (0.13 M) in each position 78/xl of each of the other three amidite solutions is added, resulting in an impurity of 8% for each solution. The oligonucleotide mixture is vacuum dried and dissolved in TE buffer. One microgram of the oligonucleotide mixture is annealed to 1/xg of a 18-mer primer completely complementary to the 3' end of the promoter/linker sequence in 10/.tl of TE by heating to 95 ° and slow cooling to room temperature. The tube is briefly centrifuged. Double-strand synthesis is performed in a total volume of 25/zl with I0 U of Klenow fragment of DNA polymerase in the presence of a 0.4 mM concentration of all four deoxynucleotide triphosphates and 1 /zCi of [32p]ATP for 1 hr at room temperature. Double strands are purified by gel electrophoresis in a 6% (w/v) polyacrylamide gel, excission of the top band, maceration, and elution in 0.5 M ammonium acetate at 37° overnight. The eluate is applied to a C18 column (SepPak; Waters Chromatography Division, Millipore, Milford, MA), the latter is washed with water, and elution is done with I vol of 60% (v/v) methanol. The eluate is dried in a vacuum centrifuge (SpeedVac) and redissolved in TE buffer. HeLa Nuclear Extracts. HeLa cells are grown in roller bottles to a total of 101° cells. Extracts are prepared according to the procedure described by Manley, 33 which is not outlined here. Following precipitation with (NH4)zSO 2 the extract is dialyzed against a 1000-fold volume of 20 mM Tris-HCl (pH 7.9)-20% (v/v) glycerol-0.2 mM EDTA-10 mM 2-mercaptoethanol-0. I M KC1-0.5 mM PMSF. Extracts with a protein concentration of 15 mg/ml are stored in aliquots in liquid nitrogen. Promoter Adsorption to Nuclear Proteins. Salt conditions must be optimized. From our experience we recommend the following composition: Tris-HCl (pH 7.9), 12 mM KCI, 50 mM MgClz, 10 mM 2-Mercaptoethanol, 10 mM EDTA, 0.2 mM Glycerol (15%, v/v) 33 j. L. Manley, in "Transcription and Translation: A Practical Approach" (B. D. Hames and S. J. Higgins, eds.), p. 91. 1RL Press, Oxford, England, 1987.
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
57
The incubation mixture contains this buffer and the following additives in a total of 20 txl: H e L a extract (10-20/xg) diluted in dialysis buffer Escherichia coli DNA (2/xg) and 1 /xg hDNA After preincubation at room temperature for 5 min, 20 ng of end-labeled double-stranded mutant oligonucleotides is added. Following incubation at room temperature for 20 min and addition of 2/xl electrophoresis sample buffer the sample is run in a 5% (w/v) nondenaturing polyacrylamide gel at low ionic strength (6.8 mM Tris-HC1, pH 7.9/1 mM EDTA/3.3 mM sodium acetate) with buffer circulation. The wet gel is exposed to X-ray film for 30 min and the band corresponding to unbound oligonucleotides is excised. After elution with 0.5 M ammonium acetate (1.5 ml) at 37° overnight and purification over a C18 column, 50/zg of proteinase K and 1 mM CaC12 are added. The treatment is stopped after 15 min at 37° by addition of 5 mM EDTA and an equal volume of phenol. The oligonucleotides are precipitated with 10 vol of ethanol in the presence of 5 /xg dextran T-500. After amplification by polymerase chain reaction (PCR) the incubation with HeLa extract is repeated three times. Amplification by Polymerase Chain Reaction. The oligonucleotides are redissolved in 30/xl H20 and 300/zg total of both primers corresponding to the nonmutated flanking sequences of the T7 promoter is added together with 12.5 ~1 of a 20% (v/v) Chelex 10034solution. After heating to 95 ° for 5 min and cooling on ice, Taq buffer, 2 mM concentrations of all four deoxynucleotides, and I U Taq polymerase are added. Thirty cycles (1 min at 94 °, 45 sec at 50 °, 30 sec at 74 °) are performed with a 10-rain postincubation at 74 °. After estimation of the amount of oligonucleotides, 20 ng is treated again with HeLa extracts as above. Binding to T7 RNA Polymerase. Conditions for incubation of oligonucleotides with T7 RNA polymerase are exactly as described above for HeLa extracts, using 250 U of enzyme instead of extract. Following electrophoresis the retarded band was excised, purified, and amplified as described. Cloning of Mutant Promoters. One microgram of the polymerasebinding mutant oligonucleotides is cleaved with 100 U of both restriction endonucleases having sites in the flanking sequences (EcoRI and XbaI in our case) and ligated to the human growth hormone gene in pUC19. Following transformation bacterial colonies are screened for inserts by using end-labeled PCR primers. Transcription in Vitro. Plasmid minipreparations can be used after 34 j. Singer-Sam, R. L. Tanguay, and A. D. Riggs, Amplifications 3, 11 (1989).
58
VECTORS FOR EXPRESSING CLONED GENES
[5]
extensive RNase treatment. Individual mutant promoter plasmids are tested for transcription with T7 polymerase in the presence or absence of HeLa cell extract by incubating in the following reaction mixture (25/A): HeLa extract (8 mg/ml) or dialysis buffer, 12.5/xl MgC1z, 10 mM RNasin, 2 U ATP, GTP, and UTP, 500/zM [32p]CTP (0.5/zCi), 50/xM T7 RNA polymerase, 50 U Plasmid DNA, 1/~g After incubation at 30 ° for I hr, samples are applied to Whatman (Clifton, NJ) GF/C filters, precipitated with 10% trichloroacetic acid (TCA), washed with TCA, ethanol, and acetone, and measured in a liquid scintillation counter. Cellular Expression Assay. Both CHO and CHO185 cells are transfected with a mixture of 20/zg test plasmid, 2/xg pRSVLuc, 35 and 1 /~g pT7neo using the protocol described above. Assays for hGH secretion and luciferase (transfection standard) are performed after 3 days and one-tenth of the cells are subjected to selection with 600/zg/ml G418 (Geneticin) to generate pools of about 100 colonies for testing stable expression levels. We have analyzed 61 mutant promoters) 6 The expression levels obtained for some of them are given in Table I. The higher transcription of the mutants in vitro in the presence of HeLa extracts reflects the reduced binding of inhibitory factors whereas the reduced expression in CHO cells in vivo is probably due to loss of polymerase II binding. Selection of Cell Clones Carrying T7 R N A Polymerase Several selectable marker genes were cloned downstream of the wildtype or mutant T7 promoter and have been tested for selectability in both CHO and CHO185 cells as well as after cotransfer with pMTT7N. From our experience we recommend using the neo gene. It is actually expressed from the wild-type T7 promoter only in cells expressing T7 polymerase. In contrast, other selectable marker genes can be expressed at a functional level by cellular RNA polymerases from the wild-type T7 promoter. Data of two experiments using the neo gene and selection with Geneticin are given in Table II. In cases in which the rapid establishment of the T7 expression system 35 j. R. de Wet, K. V. Wood, M. DeLuca, D. R. Helinski, and S. Subramani, Mol. Cell. Biol. 7~ 725 (1987). 36 A. Lieber, V. Sandig, and M. Strauss, Eur. J. Biochem. submitted (1992).
[5]
H I G H - L E V E L G E N E EXPRESSION BY TABLE
T7
RNA
59
POLYMERASE
I
PROPERTIES OF MUTANT T 7 PROMOTERS
Promoter
Sequence -18
Wild type Mutant 13 Mutant 44 Mutant 57 Mutant 68 Mutant 86
-10
+1
Transcription"
Expression ~'
in vitro (%)
in vioo I%)
-HeLa
+HeLa
CHO185
CHO
100 70 82 73
10 46 40 46
115 64 70 54
100 6 20 4
50 80
43 55
37 67
8 4
+8
TTAATACGACTCACTATAGGGAGATA ........ G ............ G .... -C - C ................... T- ..... T ............ C - T ..... ...... T ..... C ........ TT- - ..... T ............ C .......
" Transcription by T7 polymerase in vitro was done in the absence or presence of H e L a nuclear extracts. Counts obtained for the wild-type promoter in the absence of extract were taken as 100c;~. h Stable expression of human growth hormone was determined in populations of 100-200 colonies obtained after cotransfer with pT7neo and selection with Geneticin. The level obtained for the wildtype promoter in CHO cells is the 100% value.
in a particular cell type is required we suggest a cotransfer of the gene of interest under control of the mutant T7 promoter together with pMTT7N and pT7neo at a ratio of 20 : ! : 1. In this case 100% of the resulting colonies express T7 polymerase and more than 90% will express the gene of interest. Physical linkage of the gene of interest to pT7neo would guarantee
T A B L E II T 7 R N A POLYMERASE-DEPENDENT SELECTION FOR neo GENE EXPRESSION Colonies a Plasmid pUCII8
pT7neo pT7neo + pMTT7N
C H O cells
C H O 1 8 5 cells
0/0 2/0 100/60
0/1 200/300 ND
T w o d a y s a f t e r t r a n s f e c t i o n w i t h 6 / . t g o f the respective plasmid, the calcium phosphate techn i q u e w a s u s e d to s e e d 1 × 105 cells into 10-cm d i s h e s w i t h D M E M plus 5% ( v / v ) fetal c a l f s e r u m plus 600 p . g / m l G e n e t i c i n . S e l e c t i o n w a s f o r 2 weeks, with medium changes and colony counts m a d e e v e r y third day.
60
VECTORS FOR EXPRESSING CLONED GENES
[5]
expression in 100% of the colonies. This can also be achieved by using bicistronic structures (see below). However, we observed a significantly lower colony number in this kind of cotransfection experiment compared to experiments with cells already expressing T7 polymerase. In most clones, the level of T7 polymerase expression is considerably lower than that expected for metallothionein promoter constructs. It appears that there is a counterselection against cells expressing high levels of T7 polymerase. This conclusion is also supported by the observed difficulty in establishing stable clones with pCMVT7N (Fig. 1), in which T7 RNA polymerase expression is driven by the strong CMV promoter. If high-level expression is the final goal we recommend the use of a two-step protocol: pMTT7N is cotransfected with pT7neo at a ratio of 10 : 1 and cells are selected with the desired concentration of Geneticin depending on the cell type, usually between 400 and 800 ~g/ml. The pool of colonies can be used directly for the second transfection with the respective gene under control of a mutant T7 promoter together with either pT7mpac, pT7mhyg (see Vector and Oligonucleotides, above) or any other marker gene. Bicistronic constructions can also be useful in this case (see below).
Alternative Strategies for T7-Driven Gene Expression If the expression of a particular gene product is disadvantageous for the host cell or should be switched on at a fixed time point it is desirable to have a cell line carrying a silent gene. Two different ways are imaginable for activation of a gene under control of a mutant T7 promoter. First, a tightly regulated promoter could be used. We are currently exploring the usefulness of bacterial operator/repressor systems for this purpose. The use of eukaryotic regulatory elements such as hormone-response elements turned out to be inefficient in this context. The second alternative is the use of retroviral vectors to introduce the T7 polymerase gene efficiently into nearly 100% of the cells. To this end we have developed vectors based on pM6pac expressing the T7 polymerase gene from the retroviral long terminal repeat (LTR) or from CMV or SV40 promoters (Fig. 1). The experimental strategy is as follows. A vector containing the particular gene downstream of the T7m promoter is cotransfected with a selectable marker. After selection individual clones are analyzed for the presence of integrated and intact gene constructions by Southern blotting or PCR. The cells are then infected with a retroviral vector carrying the polymerase gene. We have tested this protocol for expression of the neo gene. Linear pT7neo (6 tzg) was transfected by the calcium phosphate technique into
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
61
5 x 105 NIH 3T3 cells together with 0.5 p~g of pY337 and selection with 50 /zg/ml of hygromycin was started the day after. Resulting colonies were pooled and tested for growth in 400/zg/ml of Geneticin. No survival of cells was observed. The cells were then infected with the retroviral vector pM6SVT7N (Fig. 1), which has been packaged by transfection of GP + E86 cells and was selected with 4/zg/ml of puromycin. The titer of the virus has been estimated on N I H 3T3 cells to be 1 x 105. The cells carrying the silent neo gene (105/5-cm dish) were infected with different aliquots of M6SVT7N virus stock (0.01, 0.1, and 1 ml). One day later cells were seeded at a concentration of 1000/5-cm dish in triplicate and selected with 400 /~g/ml of Geneticin. Parallel dishes without selection allowed the determination of plating efficiency. With the highest amount of virus (1 ml) the number of colonies in Geneticin equaled the plating efficiency without selection, suggesting a nearly 100% induction of expression of the neo gene. 38
Applications High-Level Foreign Gene Expression Stable Expression of the Genomic Human Growth Hormone Gene. All previous experiments for high-level expression have been performed with the wild-type T7 promoter. Because we have isolated optimized mutant promoters only recently, we have at present no long-term expression data. However, the preliminary data suggest that the levels of expression from the wild-type and mutant promoters are comparable. Here we describe our protocol, which leads to high-level expression of human growth hormone. A plasmid pGGH2.2 is constructed by cloning a 2.1-kbp genomic human growth hormone gene between the BamHI and EcoRI sites of pGEM2. Ten micrograms of linearized plasmid is cotransfected with 0.5 tzg pSV2neo 39 into 3 x 105 polymorphonuclear (PMN) mouse cells (clone A5) by the calcium phosphate technique as described above. After an overnight incubation with the DNA precipitate, cells are washed and supplemented with fresh medium. After 2 days cells are trypsinized, divided 1 : 6 into new dishes, and subjected to selection with 400/zg/ml of Geneticin. Medium is changed every third day for a period of 3 weeks. Colonies are trypsinized all together and seeded into 96-well microtiter plates at a dilution of 1 cell per every second well. Medium with Geneticin 37 K. Blochlinger and H. Diggelmann, Mol. Cell. Biol. 4, 2929 (1984). 38 W. Sommer and M. Strauss, manuscript in preparation (1992). 39 p. j. Southern and P. Berg, J. Mol. Appl. Genet. 1, 327 (1982).
62
VECTORS FOR EXPRESSING CLONED GENES
[5] kD
-
97
-
66
-
45
- 24 -4----
hGH
FIG. 3. Electrophoretic pattern of immunoprecipitated hGH produced by a PMN cell clone harboring a T7hGH plasmid. Lanes 1 and 2 are immunoprecipitates from extracts of 10 6 cells, lanes 3 to 8 are precipitates from 100/.d of culture supernatant. Lane 1 is fresh extract, lane 2 is extract incubated at 37° for I hr, lanes 3 to 5 are successive 24-hr supernatants of logarithmic cells, and lanes 6 to 8 represent the same culture supernatant of a confluent monolayer after 24, 48, and 72 hr. Immunoprecipitation was done by subsequent incubation with antiserum and protein A-Sepharose. The precipitates were run in a 12% (w/v) polyacrylamide gel.
is changed once a week. After 3 weeks supernatants are assayed for growth hormone secretion by the ELISA described above. High producers (more than 10/zg/ml hGH) are recloned to guarantee later stability of the clones. Using this protocol we succeeded in isolating several clones producing considerably more than 10/xg/ml/106 cells/day from approximately 250 primary colonies, with 2 clones producing 20 and 30 tzg/ml. These levels are slightly above those obtained using CMV or metallothionein promoter constructs. 36 However, the percentage of good producers is much lower (about 1 out of 400) in the latter case. The yield of growth hormone is best if the medium is changed every day and better in the exponential growth phase compared to a stationary culture. A typical pattern of growth hormone in cell extracts and in the medium after immunoprecipitation is shown in Fig. 3.
[5]
63
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE AAYA~
AA'TAAA
A VA
#"~
~ T ~
~TJO~
B PA
P'A
C
iI
T7prom.
V. rnouw
CI~ huml~'l
VKm~.
,
,
~-,khurrmn
FIG. 4. Maps of bi- and polycistronic constructions driven by a T7 promoter,
Stable Expression of Tissue Plasminogen Activator cDNA. The cDNA for human tissue plasminogen activator is cloned into pGEM downstream to the T7 promoter. The linear plasmid (6 tzg) is cotransfected with pSV2neo (0.5 /~g) into CHO185 cells. After 3 days, selection with 600 /xg/ml of Geneticin is started. Three weeks later colonies are pooled and cloned in microtiter plates as described for growth hormone expression. Clones producing more than 2 /~g/10 6 cells/day are recloned three times before stable expression levels can be detected. The highest level obtained in our experiments was 5 /zg/10 6 cells/day. Expression of Bi- and Polycistronic mRNA Selection of Expressing Clones. The coding sequence of the neo gene is cloned downstream to the gene of interest. The presence of a polyadenylation signal does not interfere with transcription of the bicistronic mRNA. We used fusion with the tPA cDNA as a model. A plasmid pGtPAAneo is constructed (Fig. 4A) and transfected into PMN cells (clone A5). Selection is performed using 400/zg/ml of Geneticin. The number of colonies obtained is about 10-fold lower as compared to transfections with pSV2neo (20 colonies/5-cm dish). However, all colonies give rise to stable clones expressing moderate to high levels of tPA. No colonies can be obtained in CHO cells due to the function of the polyadenylation signal as a transcriptional terminator. Alternatively, the luciferase coding sequence can be fused downstream to the gene of interest to allow for rapid quantitation of gene expression. We use a tPA-luc fusion gene. The plasmid pGtPAAL (Fig. 4B) is cotrans-
64
VECTORS FOR EXPRESSING CLONED GENES
[5]
fected with pT7mpaC into CHO cells expressing T7 polymerase. Selection is carried out with 4/.tg/ml ofpuromycin. Colonies are tested for luciferase expression, which can be detected at the level of 1-10 cells. However, the luciferase activity is decreased by a factor of five when the cistron is expressed in the second position instead of in the first position. The level of tPA synthesis correlates very well with the luciferase activity. No luciferase activity can be detected in CHO cells with this construction. As soon as a semiquantitative in situ assay for luciferase activity is available this kind of gene fusion will allow rapid identification of producer clones. Expression of Chimeric lmmunoglobulins. A plasmid pT7Ig may be constructed (Fig. 4C) in which the genomic sequences for variable regions of a mouse antibody to pig transferrin (a gift of Dr. S. Deev, Moscow) are fused to the genomic sequences for the constant regions of human IgE. The plasmid, containing two internal polyadenylation signals (which do not influence transcription by T7 polymerase), is cotransfected by electroporation with pT7mpac into Sp2/0 myeloma cells previously selected for expression of T7 RNA polymerase. After selection and subcloning in 96well microtiter plates secretion of IgE is determined using a commercial ELISA. Average levels of 100 ng/ml of IgE are detectable. Extracts are prepared and subjected to electrophoresis, and the gel is blotted to nitrocellulose and probed with anti-IgE. A 75-kDa heavy chain and a 25-kDa light chain are found. Using a solid-phase adsorption assay for pig transferrin, specific binding activity of the chimeric antibody is confirmed. Northern blot analysis shows the presence of a major transcript of about 8 kb. 4°
Synthesis of Antisense RNA and Ribozymes Recent applications of the T7 expression system in o u r laboratory have been directed toward the high-level synthesis of antisense RNA and ribozymes. The principle is described in brief: The T7 system allows expression of several thousand up to 30,000 RNA molecules per cell. For mRNAs of low or moderate abundance this level of antisense RNA might be sufficient to knock out the mRNA. We have tested this assumption by expression of a 365-bp fragment from the first exon of the human Rb-1 gene. We generated stable cell lines from CHO cells and primary human fibroblasts. In both systems no synthesis of the RB protein was detectable. Whereas the first were converted into tumorigenic cell lines, the latter have a dramatically shortened cell cycle.41 The tumorigenic cell lines might be immortalized, which is currently under investigation. 4o A. Lieber and M. Strauss, manuscript in preparation. 41 M. Strauss, S. Hering, A. Lieber, G. Herrmann, B. E. Griffin, and W. Arnold, Oncogene, in press (1992).
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
65
,p --- UAeC C eeUCUC CA UCUAU---"Rm ~ n GGAGGACAUGCGGGGC~ ACUGUCGUUGCAGAUA
AA %GA AGcGAGU ~'
GC AGua
FIG. 5. Structure of a ribozyme construction directed to the mRNA of hGH.
For mRNAs of higher abundance the use of hammerhead ribozymes 42'43 might be more efficient than using simple antisense RNA. We have designed a ribozyme construction against the mRNA for hGH (Fig. 5). The hammerhead structure and the flanking complementary sequences were synthesized as three overlapping oligonucleotides, annealed, filled in with Klenow polymerase, and cloned into the EcoRI site of pGEM1 together with the coding sequence of the neo gene. The resulting plasmid, pRZGHneo, was used to transfect PMN cells already expressing hGH from the T7 promoter. Following selection with Geneticin clones were analyzed for hGH secretion. The levels varied between 25 and 2.5% of the original hGH synthesis, with the majority of clones producing very low levels of hGH. Discussion and Comments The heterologous gene expression system described here has several advantages over others. However, several problems must be considered. First, the T7 promoter is not exclusively transcribed by T7 polymerase within the nucleus of mammalian cells. Second, the levels of expression obtained with the T7 system are not significantly higher than those obtained with strong eukaryotic promoters under optimal conditions. An third, high-level expression of the T7 RNA polymerase is disadvantageous to the host cell. The considerable expression level caused by the cellular RNA polymerase with the wild-type promoter does not significantly influence the expression by T7 polymerase. Thus, we may recommend the use of the wildtype promoter in most cases where high-level stable gene expression is 42 A. C. Forster and R. H. Symons, Cell 49, 211 (1987). 43 C. C. Sheldon, A. C. Jeffries, C. Davies, and R. H. Symons, in "Nucleic Acids and Molecular Biology" (F. Eckstein and D. M. J. LiUey, eds.), Vol. 4, p. 227. SpringerVerlag, Berlin, 1990.
66
VECTORS FOR EXPRESSING CLONED GENES
[6]
required. The advantage over other stable expression systems is the ease of selecting producer clones, not the height of expression. The expression levels are always lower in stable systems compared with the lytic viral ones. We tried to make use of the excess of T7 polymerase present in the nucleus of some clones by using episomal origin vectors. However, up to now the levels of expression could be enhanced only two- to fourfold. 44 We are currently working on the establishment of regulated systems that might allow a higher level of expression for a short period of time. The chief advantage of the modified T7 system based on mutant promoters is the strong dependence on transcription by T7 RNA polymerase. Thus, the system can be used for all purposes of selective gene expression. Cell lines or even transgenic mice carrying silent genes under the control of a mutant promoter can be established and their expression can be stimulated via subsequent introduction of T7 polymerase, for example, by retroviral vectors. Alternatively, inducible repressor systems could be used to repress either the T7 promoter or T7 polymerase expression. Additional useful applications are the expression of bi- or polycistronic mRNA as well as the efficient expression of antisense RNA or ribozymes. 44 V, Sandig and M. Strauss, unpublished observations 0991),
[6] E x p r e s s i o n V e c t o r s f o r H i g h - L e v e l G e n e E x p r e s s i o n in Dicotyledonous and Monocotyledonous Plants By REINHARD TOPFER, CHRISTOPH MAAS, CHRISTA H(SRICKE-GRANDPIERRE, J E F F SCHELL,
and
H A N S - H E N N I N G STEINBISS
Introduction High-level expression of selectable marker genes as well as that of agronomically important genes is a crucial aspect of plant molecular biology. The first chimeric genes for plant transformation experiments consisted of bacterial antibiotic resistance genes controlled by promoters derived from genes carried by the T-DNA region ofAgrobacterium tumefaciens Ti plasmids. ~-3 A second generation of constructs made use of the L. Herrera-Estrella, M. De Block, E. Messens, J.-P. Hernalsteens, M. Van Montagu, and J. Schell, EMBO J. 2, 987 (1983). M. Bevan, R. B. Flavell, and M.-D. Chilton, Nature (London) 304, 184 (1983).
METHODS IN ENZYMOLOGY,VOL.217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.