Replication of RNA by the DNA-dependent RNA polymerase of phage T7

Cell, Vol. 57, 423-431,

May 5, 1989, Copyright

0 1989 by Cell Press

Replication of RNA by the DNA-Dependent RNA Polymerase of Phage T7 Maria M. Konarska and Phillip A. Sharp Center for Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge, Massachusetts 02139

Summary The DNA-dependent RNA polymerase of bacteriophage T7 utilizes a specific RNA as a template and replicates it efficiently and accurately. The RNA product (X RNA), approximately 70 nucleotides long, is initiated with either pppC or pppG and contains an AUrich sequence. Replication of X RNA involves synthesis of complementary strands. Both strands are also significantly self-complementary, producing RNA with an extensive hairpin secondary structure. Replication of X RNA by T7 RNA polymerase is both template and enzyme specific. No other RNA serves as template for replication; neither do other polymerases, including the closely related T3 RNA polymerase, replicate X RNA. The T7 RNA polymerase-X RNA system provides an interesting model for studying replication of RNA by DNA-dependent RNA polymerases. Such a mechanism has been proposed to propagate viroids and hepatitis 6, pathogenic RNAs whose replication seems to depend on cellular RNA polymerases.

dent on RNA replication in the absence of known viral polymerases. Viroid RNAs are small circular molecules that do not encode polypeptides of significant length (for a recent review see Keese and Symons, 1987). However, these RNAs replicate efficiently within plant cells in the absence of coinfecting virus. T7 RNA polymerase consists of a single polypeptide chain of 98,856 daltons and recognizes its promoter DNA sequence with very high specificity (Chamberlin and Ryan, 1982; Moffat et al., 1984). The combination of its high promoter specificity and ease of overexpression in bacteria through molecular cloning has established T7 RNA polymerase as the preferred enzyme for in vitro synthesis of RNA substrates (Davanloo et al., 1984; Tabor and Richardson, 1985; Krieg and Melton, 1987; Milligan et al., 1987). Most DNA-dependent RNA polymerases have been shown to accept RNA as template for polymerization of NTPs (Chamberlin, 1974a, 1974b). To date, this polymerization has been characterized as inefficient and nonspecific for both initiation and termination. This perhaps reflects the absence of appropriate promoter sequences or structures in the RNA templates tested. We show here that the DNA-dependent RNA polymerase of phage T7 will accurately and efficiently replicate a short RNA template. This system provides an interesting model for studying replication of RNA by DNA-dependent RNA polymerases.

Results Introduction RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possess catalytic activity. RNA is one of two cellular molecules that encode information for their own replication. The other is DNA, whose replication is tightly controlled and whose cellular distribution is restricted to highly complex structures such as chromosomes. In theory, RNA-templated RNA synthesis-i.e., RNA replication-could occur commonly in cells if appropriate polymerases were available. The cell contains at all times a significant concentration of potential RNA templates and nucleoside triphosphates (NTPs). RNA-templated RNA polymerization may be rare because amplification of some RNAs, particularly those acting as enzymes or as competitive inhibitors of processes dependent on RNA recognition, could be pathogenic to cells. All well-characterized RNA replication processes are dependent on a virus-specified RNA-dependent RNA polymerase. These polymerases tend to be single polypeptide chains that efficiently replicate RNA only when complexed to other viral or cellular proteins. For example, the phage Qf3 replicase is a complex of four proteins: a virally encoded polymerase subunit and three cellular proteins, elongation factors EFlii and EF-Ts (Blumenthal et al., 1982) and the ribosomal protein Sl (Wahba et al., 1974). Certain biological systems are apparently depen-

Generation of RNA X in T7 Polymerase Transcription Reactions In the course of experiments involving transcription in vitro of deoxyoligonucleotide templates by T7 RNA polymerase, high levels of an unanticipated RNA product were generated. This ~70 nucleotide (nt) RNA, X, was efficiently synthesized in standard transcription reactions containing a synthetic deoxyoligonucleotide template (termed USl) and a preparation of T7 RNA polymerase from United States Biochemical Corp. (USB). In analogous reactions containing other preparations of the same enzyme, X RNA was not synthesized. Instead, the expected 23 nt long transcript of the DNA template was generated (Figure 1). In contrast, with the USB T7 RNA polymerase preparation, synthesis of X RNA was very efficient and specific, invariably generating a product of m70 nt independent of the character of the DNA template. Typically, the final concentration of X RNA in the reaction was approximately 1 mglml, which for a 70 nt long RNA corresponds to m40 FM or to 2.8 m M nucleotides in product. In addition to the major, -70 nt X RNA product, a series of slower-migrating RNAs was produced (Figure 1 and 3). These transcripts, called 2X, 3X, 4X, etc., represent oligomers of X RNA (see data below). Also generated in the reaction was a series of products migrating as 3-10 nt RNAs (Figure 1). These RNAs may be related to products of abortive initiation previously observed in standard tran-

Cell 424

Figure 1. Generation of X RNA by US6 T7 RNA Polymerase in the Presence of Synthetic Deoxyoligonucleotide Inducer Transcription reactions contaming T7 RNA polymerase preparations (USB, lanes l-3’; New England Biolabs, lanes 4 and 5) were carried out in the absence of a DNA template (lanes 1 and 4) or in the presence of 10.100, and 50 nM US1 deoxyoligonucleotide template (lanes 2, 3, and 5, respectively). Reaction products were separated m a 20% polyacrylamide-8 M urea gel and visualized by autoradiography (A) or by ultraviolet shadowing (B). The specific RNA transcript of US1 synthettc DNA template is 23 nt long. Positions of major transcription products and dye markers (XC, xylene cyanol; BB, bromophenol blue) are indicated.

xc*

-

t

23”l

Lie--

scription reactions containing T7 RNA polymerase and a DNA promoter (Milligan et al., 1987; Martin et al., 1988). Synthesis of X RNA was abolished by substitution of NTPs with dNTPs or by omission of one of the NTPs (data not shown). Identical X RNA product was generated by the USB T7 RNA polymerase in reactions containing different synthetic deoxyoligonucleotide templates of various length and sequence. Moreover, equally efficient and specific production of X RNA was observed when synthetic DNA templates were substituted with various unrelated deoxyor ribo-oligonucleotides that did not contain sequences related to those of the T7 promoter (Figure 2 and data not shown). Thus, synthesis of X RNA did not require an exogenously added template. Rather, the addition of a nonspecific nucleic acid component was required to induce synthesis of X RNA.

15000

I

0

1

100

200

300

time (min) Figure 2. Time Course of Generation of X RNA by USB T7 RNA Polymerase TranscriptIon reactions (100 ~1) contaming USB T7 polymerase (10 PI) were carried out under standard conditions. Incorporation of [@PIUTP into acid-precipitableTT sured as described in Experrmental Procedures. Reactions contained either no added template (@). 120 ng (-200 nM) deoxyoligonucleotide of sequence CCAGTCTCCGTAGTGTCTGT (m), or 250 ng (-100 nM) X RNA (+)

X RNA Is a Template for Its Own Synthesis by T7 RNA Polymerase Kinetic parameters of the synthesis of X RNA were studied using acid precipitation of transcription products. ‘This assay gives results quantitatively identical to measurement of radioactivity in appropriate bands separated by gel electrophoresis (data not shown). Interestingly, even in the presence of an optimal amount of deoxyoligonucleotide inducer, the time course of X RNA synthesis by the USB T7 RNA polymerase showed a significant lag period followed by a phase of rapid accumulation of product (Figure 2). This lag period was shortened significantly when the X RNA produced in one transcription reaction was phenol extracted, purified in a denaturing gel, and subsequently added to another reaction (Figure 2 and data not shown). Moreover, in the presence of exogenously added X RNA, not only the USB T7 RNA polymerase but any preparation of T7 RNA polymerase was active in generating the X product (Figure 3). Thus, although the USB T7 polymerase had the unusual ability to synthesize X RNA in the absence of exogenously added X template, this was atypical of other preparations of T7 RNA polymerase, for which addition of X RNA template was strictly required for its replication. All preparations of T7 polymerase tested were active in standard, control transcription reactions containing DNA templates with T7 promoter sequences. As expected for an RNA-directed reaction, replication of X RNA was significantly less sensitive to inhibition by actinomycin D than the plasmid DNA-dependent control transcription (data not shown). Thus, X RNA served as a template for its own synthesis by the DNA-dependent T7 RNA polymerase. Furthermore, replication of X RNA strictly required the T7 RNA polymerase. Neither E. coli RNA polymerase, bacteriophage SP6 RNA polymerase, nor the closely related T3 RNA polymerase could replicate X RNA (Figure 3). The efficiencies with which DNA and RNA templates were utilized by T7 RNA polymerase were determined by measuring the initial rates of nucleotide incorporation at various template concentrations. The X RNA was compared to two types of DNA templates, one consisting of synthetic deoxyoligonucleotides providing a double-

RNA Replrcation 425

by T7 RNA Polymerase

ii.”

co.5 x :i

Figure 3. T7 RNA Polymerase

Replicates

X RNA

Transcription reactions (10 ~1) were carried out in the presence of 25 ng (~100 nM) X RNA and various preparations of T7 RNA polymerase: USB (lane l), fractions V (lane 2) and VII (lane 3) of the extended purification scheme (Tabor and Richardson, 1985; S. Tabor, unpublished observations), and Stratagene (lane 5). In addition, Stratagene T3 RNA polymerase (lane 4) New England Biolabs SP6 RNA polymerase (lane 6) and New England Biolabs, E. coli RNA polymerase (lane 7) were analyzed in parallel. RNA products were separated by electrophoresis rn a 10% polyacrylamide-8 M urea gel. Positions of major RNA products are Indicated.

stranded T7 promoter region (US1 template) and another in which sequences derived from the adenovirus 2 major late transcription unit were inserted downstream of the T7 promoter in the plasmid vector PBS (Ad10 and Ad13 templates). The rates of transcription (V) were measured at fixed enzyme concentration and in the linear phase of the reactions. Results of these saturation kinetic experiments comparing transcription velocity (V) at different template concentrations ([S]) are shown in Figure 4A. The same results are also presented as a double-reciprocal plot, l/V versus l/[S], following the Lineweaver-Burk formalism (Figure 48) which allows for more accurate determination of vlllax and K, values. The apparent maximal reaction velocity, V,,,, was approximately 20-fold higher for DNA templates containing the optimal T7 promoter sequence (Ad10 and Ad13 templates) than for X RNA. The apparent V max established for the partially double-stranded deoxyoligonucleotide US1 template was approximately 5-fold lower than the equivalent value determined for the Ad10 template (data not shown). The observed differences in the specific activity of T7 polymerase may reflect differences in the rate at which transcripts are initiated, elongated, or released from the enzyme, or any combination of these. Comparison of K, values for the two types of templates indicated that T7 RNA polymerase has only

Figure 4. Comparison of the Relative Efficiency of Transcriptron by T7 RNA Polymerase in the Presence of X RNA and DNA Templates Containing T7 Promoter Sequences Transcription reactions were carried out in 10 sl volumes with 0.5 PI of fraction V enzyme (‘~2 frg) and varyrng amounts of template IS]. After a 10 m m incubation at 37°C acid-precipitable [u-~‘P]UTP radioactivity was determined in duplicates for reactions containing X RNA (8) and plasmid DNA pBSAdl0 (+) templates. The apparent initial velocity(V), expressed in arbitrary units, was normalized for the sequence content of various transcripts. (A) Plot of V versus [S]. (B) Double-reciprocal plot (Lineweaver-Burk plot): i/V versus l/[S]. Equations l/V = 3.905e-4 + 0.2459(1/[5]), R = 0.99; and l/V = 2.63gem5 + O.O051(1/[S]), R = 1.00, describing the double-reciprocal plots for X RNA and pBSAdl0 templates, respectively, were used to determme apparent K, values (629 nM and 193 nM, respectively).

~2- to 3-fold lower apparent affinity for X RNA than for a DNA template containing the optimal T7 promoter. The apparent K, value established for X RNA (~400-600 nM) is certainly overestimated since only a fraction of the RNA added to the replication reaction can serve as active template (see below). The X RNA template preparation is almost certainly heterogenous in both conformation and sequence. This may be due in part to the high misincorporation rate commonly observed in RNA replication reactions. T7 RNA polymerase, like other DNA-dependent RNA polymerases, can accept RNA homo- and heteropolymers as template. In all previous cases RNA-directed RNA synthesis initiated and terminated randomly and frequently exhibited internal slippage (Chamberlin, 1974a, 1974b). Poly(A), poly(C), poly(A,U), and double-stranded poly(A)poly(U) were compared with X RNA as templates (Figure 5 and data not shown). In some reactions ribo-oligonucleotides of m70 nt, similar in length to the X RNA, were tested. As expected, all of the ribopolymer sequences served as templates for transcription, but with efficiencies at least lo-fold lower than that of X RNA (Figure 5). In addition, transcripts from these reactions lacked the ability to replicate further in the presence of T7 polymerase. Similarly, none of the naturally occurring RNAs tested, including total RNA from E. coli or HeLa cells and E. coli, yeast, or HeLa tRNA, served as an efficient template for transcription by T7 RNA polymerase. Furthermore, in the

Cell 426

0

50

100

time (min) Figure 5 Comparison RNA Polymers

of Template Actlwty

of X RNA and Synthetic

Time course of [w3’P]UTP mcorporatlon mto RNA was carried out I” the presence of Stratagene T7 RNA polymerase wng X RNA (lq), 50-100 nt long ollgo(C) rlbopolymer (+), poly(C) ribopolymer (0). 50-100 nt long oligo(A,C) nbopolymer ( n ), and poly(A,C) ribopolymer (!~I). All RNA templates were present at 10 nglpl. Transcriptional activity was determined in duplvzate reactIons by measurement of acidinsoluble radioactIvIty

of high concentrations of these RNAs (~1-5 mglml), replication of X RNA was strongly inhibited (data not shown).

presence

Structural Analysis of X RNA Both the predominant product of replication, minor 2X, 3X, and 4X species were isolated

X RNA, and from a dena-

Ming polyacrylamide gel and subjected to further structural analysis. These products were shown to be linear RNA molecules, as indicated by production of a regular ladder after a partial alkaline hydrolysis of 5’ terminally labeled material (Figure 6B and data not shown). To analyze the base composition of the product, unlabeled X RNA was digested to completion with ribonuclease T2, and the resulting nucleoside 3’-phosphates were labeled with [v3zPJATP and polynucleotide kinase. These were then treated with nuclease Pl and resolved by thin-layer chromatography (TLC; Figure 6C). The nucleotide c’omposition of X RNA was determined from the ratio of radioactivity detected in the four spots: pA (450/o), pC (120/o), pG (90/o), and pU (34%). Since the X RNA as recovered from the gel probably consists of two complementary strands in a mixture of unknown ratio, these percentages must be interpreted with caution. However, X RNA is undoubtedly rich in A+U as compared with G+C residues. To analyze the 5’termini, X RNA was treated with phosphatase and labeled with [Y-~~P]ATP and polynucleotide kinase. Digestion with nuclease Pl produced radioactive pA (200/o), pC (45%), and pG (35%). When the same analysis was repeated with X RNA that had not been treated with phosphatase, only a pA spot was produced (data not shown). Independently, X RNA was labeled during transcription with either s-32P-labeled ATP, CTP, GTP, or UTP Samples of each RNA were digested to completion with RNAase T2 or nuclease Pl, and products were resolved by two-dimensional TLC. This type of analysis icientified

Figure 6. Structural

c

EG WX -

XA

x D -X6 -

xc

x E

-

BB

I

d”

Analysis

of X RNA

(A) [a-32P]UTP-labeled X RNA and oligomer 2X, 3X. and 4X RNAs were Isolated from a standard transcription reaction (as I” Figure 3, lane 5) and digested wtth RNAase Tl The starting material (lanes l-4) and products of digestIon (lanes 5-8) were separated in a 10% polyacrylamide-8 M urea gel. The ratios of Intensity of the XA and Xa bands, as determmed by densitometric scannmg of the autoradiograph. were 1.1.14 for X RNA, 1.2.77 for 2X RNA, 1:4.98 for 3X RNA, and 1:6.34 for 4X: RNA. (6) 5’termlnally labeled X RNA (lanes 1-3). X,, RNA (lanes 4-6), and Xa RNA (lanes 7-9) were subjected to partial alkaline hydrolysis for 0 min (lanes 1. 4, and 7), 5 min (lanes 2.5, and 8), and 10 min (lanes 3. 6, and 9). Products of the reactlon were resolved In a 20% polyacrylamide-8 M urea gel. XC and BB Indicate posltions of xylene cyanol and bromophenol blue dye markers. (C)Analysis of base cornposItIon of X RNA. Unlabeled X RNA was digested lo completion wth RNAase T2. and the resultmg nucleoslde 3’.monophosphates (Np) were labeled wth polynucleotlde ktnase and [Y-~‘P]ATP Products (pNp) were treated with nuclease Pl, and the resulting nucleoside 5’.monophosphates (pN) were resolved by two-dImensIonal TLC. (D and E) X RNA labeled during transcriptIon with [cI-~*P]CTP (in [D]) or [&*P]GTP (in [El) was digested to completion with RNAase T2 Products of the reaction were resolved by twodlmensional TLC.

RNA 427

Replicationby

T7

RNA Polymerase

Y-terminal pppC and pppG residues; no pppA or pppu residues were detected (Figures 6D and 6E and data not shown). Thus, X RNA transcripts were initiated with pppC and pppG, while a small fraction of RNA (m20%), perhaps representing degradation products, contained 5’ HOA termini. Almost all known in vivo transcripts synthesized by the T7 polymerase have guanosine at their 5’termini, and only one of the T7 class II promoters initiates with an A residue (Dunn and Studier, 1983). Digestion of internally labeled X RNA with the guanosine-specific RNAase Tl generated only two major products, designated XA and Xs (Figure 6A). The sizes of the two products were estimated as ~65 and ~35 nt, respectively. The combined length of XA and Xs (~100 nt) cannot be accounted for by the length of monomeric X RNA (~70 nt) used as the substrate in RNAase Tl digestion, and thus each of these RNAs is probably derived from different strands. When 5’ terminally labeled X RNA was subjected to RNAase Tl digestion, only Xs and very short (l-3 nt) RNAs, but not XA RNA, were detected among products. Identical results were obtained using X RNA labeled at the 3’ end with pCp (data not shown). The simplest interpretation of these results is that there are two populations of X RNA molecules-most likely two complementary strands-that generate the long RNAase Tl-resistant oligonucleotides (see below). These two strands of X RNA, present at almost equimolar ratios, would differ in the distribution of RNAase Tl-cleavable G residues located near both ends of one strand (to generate X,) and in the middle of the other strand (to generate two Xs RNAs). Although conditions used for RNAase Tl reactions were sufficient for complete digestion of control tRNA molecules (data not shown), at least Xs RNA, and probably also XA RNA, represents a product of partial cleavage. When [a32P]GTP-labeled X RNA was subjected to extensive RNAase Tl digestion at 65%, the Xs fragment was further cleaved to generate ~10 nt oligonucleotides. Under the same conditions the XA fragment remained resistant to RNAase Tl cleavage. Moreover, gel-purified XA RNA treated repeatedly by heat denaturation followed by incubation with RNAase Tl did not generate shorter degradation products (data not shown). This resistance to further cleavage by RNAase Tl is probably due to a pronounced secondary structure. When digested with RNAase A under high-ionic-strength conditions, XA RNA was only cleaved at a cluster of sites near its midpoint, generating RNAs approximately 30 nt in length. This suggests that Xn RNA forms a hairpin structure due to the presence of a palindromic sequence. The loop at the top of the hairpin is not cleavable with RNAase Tl but is sensitive to RNAase A (data not shown). The oligomeric RNAs 2X, 3X, and 4X shared with the monomer X the characteristic pattern of RNAase Tl cleavage (Figure 6A). Densitometry of the autoradiograph shown in Figure 6A was used to estimate the molar ratio of XA and Xs RNAs generated by digestion of the oligomerit RNAs with RNAase Tl. The Xn and Xs products are generated in a 1:l ratio from digestion of total X RNA. This ratio is 3:l for the 2X RNA, 51 for the 3X RNA, and

approximately 7:l for the 4X RNAs. These ratios suggest that the 2X oligomer RNA is composed of an equal mixture of repeats of Xs-XA-Xs and XA-XXA,where each of these units is separated by a RNAase Tl-cleavable region. Similarly, the 3X and 4X material could be composed of Xs-XA-XA-X~ and XA-XA-X~, and XsXA-XA-XXA-Xsand XnXA-XA-XA, respectively. The XA and Xs units in the oligomers may not be identical to those generated by RNAase Tl digestion of X RNAs since variation in sequence may be related to their oligomeric structure. However, it is clear that the oligomer RNAs share a common structure and general sequence organization with the monomer X RNAs. Electrophoresis of X RNA in a native polyacrylamide gel produced two major bands. The slower-migrating form could be converted into the faster-migrating form by boiling of the sample before electrophoresis (Figure 7A). This would be consistent with the slower-migrating form being double stranded (dsX) and the faster-migrating form representing single strands of X RNA (ssX) (see below for further evidence). Slow renaturation of X RNA at high concentrations resulted in the formation of a series of slowermigrating forms, presumably concatamers (Figure 7A). Renaturation of X RNA at low concentrations generated primarily SSX and low levels of dsX. The formation of concatamers suggests that each of the two strands of X RNA has an internal repeat, perhaps a palindromic sequence. The double-stranded nature of the dsX RNA was demonstrated by its resistance to nuclease digestion. Incubation of X RNA in the presence of RNAase A or Tl at low ionic strength (50 mM Iris-HCI; pH 7.5) did not result in cleavage of the dsX form (Figures 76 and 7C, lanes 3, 4, 7, and 8). In contrast, the same digestion resulted in complete conversion of the SSX RNA into material that migrated as XA and Xs RNAs (Figures 78 and 7C, lanes 5,6,9, and 10). The XA and Xs RNAs, ~65 and ~35 nt in length, respectively, are generated as resistant products because of extensive secondary structure. One strand of X RNA generates XA RNA after RNAase Tl digestion because the loop at the top of the hairpin structure does not contain a cleavable G residue. The other strand contains such a G residue in the loop and is thus converted to approximately half-length Xs RNAs. The Xs RNA is resistant to further digestion with RNAase Tl because of its double-stranded nature. Similarly, digestion with RNAase A generates Xs RNAs by cleavage in the loop of the hairpin of one strand. The loop of the other strand is RNAase A resistant and thus generates XA RNAs. These results suggest that X RNA is composed of two complementary strands, each with a palindromic sequence that forms an almost perfect hairpin structure. The notion that X RNA contains self-complementary sequences was confirmed by Northern hybridization analysis. X RNA was electrophoresed in a denaturing polyacrylamide gel, transferred to a nylon membrane, and hybridized to [a-ssP]UTP-labeled X RNA. In addition, RNAase Tl digestion products, XA and Xs, were used as probes in Northern hybridization analysis (Figure 8). Atthough both X and Xa RNAs annealed to X RNA, the efficiency of hybridization was significantly higher when XB

Cell 428

A

probe RNase Tl

Xi3

xA

-

+

-

+ -

1

2

3

4

12

3

RNase

C

4

5

6

7

8

910 1

RNase Tl

A

-A N

NDDNND

DN

+

Figure 8. Northern

D

.- x -

xA

I. xe

2

Hybridization

3

‘I

5

6

of X RNA

Unlabeled X RNA (~10 ng; lanes 1, 3. and 5) and X RNA drgested with RNAase Tl (-15 ng; lanes 2,4, and 6) were electrophoresed in a denaturing 10% polyacrylamrde gel, stained with ethidium bromrde (lanes 5 and 6) and transferred to a nylon membrane Blots were hybridized using [c?P]UTP-labeled XA (lanes 1 and 2) and Xa RNA (lanes 3 and 4) as probes. Positions of X, Xa, and Xe, RNAs are indrcated.

a small fraction (QY+&lO%) of X and almost undetectable amounts of Xn RNAs were bound, whereas Xs RNA was efficiently retained on the membrane (data not shown). This result is consistent with an extensive secondary structure exhibited by these forms of RNA. Thus, X RNA sequences are composed of two complementary strands, each of which is significantly self-complementary. **,:a. ~Il..rn..L-r(“X-

1

2

3

4

5

6

Figure 7. X RNA Contains Self-Complementary

7

8

9

10

Sequences

(A) X RNA (-IO3 cpm, *I ug), Isolated from a denaturing polyacrylamide gel, was electrophoresed in a 4% native gel (lanes 1 and 3). In lane 2, X RNA was heated to 100% for 3 min and chilled on ice before electrophoresis. In lane 4, X RNA was treated in the same way, but allowed to cool slowly to room temperature. Positions of faster-migrating monomer X RNA (ssX), slower-migrating double-stranded structure (dsX), and concatamers of X RNA (X,) are indicated. (B) X RNA prepared as in (A), lanes 1 and 2. was electrophoresed in a 4% native gel. X RNA samples were digested with RNAase A (2 ug, rn 10 frl of 50 m M Tris-HCI [pfi 7.51 for 1 hr) (lanes 3-6) or RNAase Tl (2 U, rn 10 ul of 50 m M Tris-HCI [pH 7.51 for 1 hr) (lanes 7-10). Incubatrons were carried out at 25°C (lanes 3, 5, 7, and 9) or at 37°C (lanes 4, 6, 8, and 10). Reactions in lanes 1, 3, 4, 7, and 8 contained a native preparation of X RNA (lanes N), while reactions in lanes 2, 5. 6.9, and 10 contained X RNA that was heated to 100°C for 3 min and chilled on Ice (lanes D). Positions of single-stranded (ssX) and doublestranded (dsX) X RNA are indicated. (C) Aliquots of reactions analyzed in (B), lanes l-10, were electrophoresed rn a 10% polyacrylamide-8 M urea gel. Positions of full-length X RNA and major RNAase Tl digestion products, XA and Xs, are rndrcated

RNA was used as a probe (Figure 8 and data not shown). Moreover, both XA and Xs probes hybridized efficiently to Xa, but not XA, fragments of X RNA (Figure 8). This resulted in part from an inefficient retention of X and XA RNAs on a filter. The efficiency of transfer was tested independently using radioactive X, XA, and Xs RNAs. Only

Discussion We have shown that the well-characterized DNA-dependent RNA polymerase of bacteriophage T7 will #accept RNA as a template and accurately replicate it. The degree of amplification in a single reaction can be a million-fold, and the ~70 nt X RNA product is initiated with either pppC or pppG. Thus the polymerase must recognize a specific RNA sequence or structure for initiation and then elongate through ~70 nt of sequence before either termination or cleavage of the RNA occurs. Replication of X RNA is specific to T7 RNA polymerase; T3 RNA polymerase, which is over 80% identical to T7 RNA polymerase at the amino acid level, will not replicate this RNA. These two polymerases have different optimal DNA promoter sequences, and thus their nucleic acid recognition surfaces must vary. Replication of X RNA by T7 RNA polymerase involves the synthesis of two (probably complementary) strands. These strands are defined by an asymmetric distribution of guanosine residues that are located near the termini of one strand and the midsection of the other. Additionally, both strands are probably significantly selfcomplementary and thus form stable hairpin structures. Whether the monomer strand or the double-stranded form constitutes the template for replication by T7 RNA polymerase awaits further experiments. However, it is clear that this RNA polymerase will specifically recognize X R;JA and efficiently replicate it in the presence of NTPs. The origin of X RNA is a mystery. The only identified

RNA Replication 429

by T7 RNA Polymerase

source of the X RNA template is some preparations of T7 RNA polymerase. These preparations will generate X RNA in the absence of exogenously added template when incubated for prolonged periods with NTPs. We cannot exclude the possibility that X RNA is synthesized de novo by the T7 RNA polymerase in these reactions. However, it is difficult to rationalize why only these particular preparations of enzyme would exhibit this unusual de novo synthesis and why RNA products of the same size and sequence would be generated in different reactions. At present the alternative possibility, that these preparations of T7 RNA polymerase are contaminated with a small amount of X RNA, seems more likely. However, even this interpretation does not explain the origin of contaminating RNA but only suggests that it was either generated in vivo during growth of the bacteria producing the polymerase or that the X RNA contaminated the preparation of the enzyme. Initial attempts to detect X RNA in E. coli strains overproducing T7 RNA polymerase have been unsuccessful. The current structure of X RNA probably reflects the specific conditions of in vitro replication. The combination of a high mutation rate common to RNA replication processes (for discussion see Sedivy et al., 1987), a high degree of amplification, and a strong selection for molecules with optimal template activity would generate a heterogeneous population of RNAs that might differ significantly from their progenitor sequence. Replication of RNA by a prokaryotic DNA-dependent RNA polymerase has previously been described (Biebricher and Orgel, 1973). Ten cycles of addition of products from one transcription reaction to another were used to generate RNA specifically active as template for purified E. coli RNA polymerase. The conditions used in these reactions were significantly different from those of DNAtemplated transcription in that Mn*+ was substituted for Mg*+ and inosine triphosphate was substituted for GTP (Biebricher and Orgel, 1973; Zasloff and Felsenfeld, 1977). The most extensively studied prokaryotic RNA replication system is that of phage CID. The Qb replicase will accurately and efficiently replicate a number of small RNAs in addition to its natural QB RNA template (Kacian et al., 1972; Mills et al., 1975; Biebricher, 1987; Munishkin et al., 1988). The evolution or selection of specific RNA sequences by variation of reaction conditions during amplification has been addressed with the Qp replicase system (Mills et al., 1967; Kacian et al., 1972; Biebricher and Orgel, 1973). Finally, replication of RNA by animal viral polymerases is currently being studied. These reactions commonly utilize mixtures of many proteins and either the viral RNA genome or a complementary RNA as a potential template for replication (Baron and Baltimore, 1982; Schubert et al., 1985). The activities of molecularly cloned viral RNA polymerases are only now beginning to be analyzed. Replication of RNA has long been regarded as an important process for both theoretical and practical reasons. RNAwas undoubtedly the earliest form of genetic material and must have been replicated in primordial systems. It has been proposed that contemporary RNA viruses are evolutionary descendents of this RNA world (CavalierSmith, 1987; Weiner and Maizels, 1987). The observation

that T7 RNA polymerase can accurately replicate RNA provides two new insights into our concepts of the role of RNA in evolution. First, it suggests that all RNA polymerases, both cellular and viral, DNA dependent or RNA dependent, may have an intrinsic ability to replicate RNA efficiently. This may reflect a common evolutionary origin of these polymerases from RNA replication and transcription processes in early systems (Cavalier-Smith, 1987; Gilbert, 1986), and may partially explain the conserved amino acid sequences shared by these polymerases (Hartmann et al., 1988). Second, the divergence between cellular processes and RNA viruses may not be very ancient. It is easy to imagine T7 RNA polymerase being incorporated into the emerging genome of an RNA virus. Thus some RNA viruses may not be remnants of an earlier period in evolution, but rather may be more recent descendants of cellular processes. From a practical point of view, the ability of 5’7 RNA polymerase to replicate RNA efficiently may be related to the replication of a class of RNA pathogens such as viroidtype RNAs. These small circular RNAs (viroids and virusoids; ~350 nt) were first identified as infectious agents in plants, where they replicate as rolling circles (Branch et al., 1981; reviewed by Robertson and Branch, 1987) and generate monomer-unit-length genomes from the singlestranded oligomer intermediate by self-cleavage (Buzayan et al., 1986; Prody et al., 1986; for a recent review see Keese and Symons, 1987). Viroid RNAs do not encode proteins but are nevertheless infectious. Thus these pathogens depend on cellular polymerases for replication. The nature of the cellular polymerase is unknown, but the sensitivity of viroid replication to the mushroom toxin a-amanitin suggests that the DNA-dependent RNA polymerase II might be involved (Rackwitz et al., 1981; Semancik and Harper, 1984). A viroid-type RNA, hepatitis 6, has recently been identified in mammals (Chen et al., 1986; Kos et al., 1986; Wang et al., 1986; Makino et al., 1987). This circular RNA genome (~1700 nt) is significantly longer than plant viroids and contains an open reading frame for a ~22 kd polypeptide (Kuo et al., 1988). It is also thought to replicate as a rolling circle and to generate monomers by self-cleavage (Sharmeen et al., 1988). S RNA is transmitted from cell to cell by the vector of the hepatitis B particle. However, its replication is thought to be independent of products encoded by hepatitis B virus, and primarily dependent on cellular polymerases. If DNA-dependent polymerases such as T7 RNA polymerase can readily replicate RNA, then viroid-like pathogens may be very common. They may be responsible for many disease states of thus far unknown etiology and may have been detected only in the small number of known examples in which pathogenesis is distinct and rapid. Thus it is important to establish the general principles of replication of RNA by DNA-dependent RNA polymerases. The T7 RNA polymerase-X RNA system provides the most defined such process now available. Experimental Procedures Enzymes and Plasmids USB T7 RNA polymerase

was purchased

from the United States Bio-

Cell 430

chemical Corp. (lot #49307, 150,000 U/ml). Other preparations of T7 RNA polymerase were purchased from Boehringer, New England Biolabs, Pharmacra, Promega, and Stratagene. In addition, Dr. C. Richarson, Harvard Medical School, kindly provided purified preparatrons of T7 RNA polymerase (fractions V and VII, prepared as described by Tabor and Richardson [1985], followed by additional purification on hydroxylapatite and blue dextran columns [S. Tabor personal communication]). E. coli RNA polymerase was purchased from Pharmacra, SP6 RNA polymerase was from New England Biolabs and Promega, and T3 RNA polymerase was from Pharmacia and Stratagene. DNA oligonucleotrde template US1 was constructed following the model of Milligan and Uhlenbeck (1987) and consisted of a mixture of two oligonucleotides that generated the following double-stranded promoter segement with an extended single-stranded template sequence: 5’.TAATACGACTCACTATAG-3’ 3’.ATTATGCTGAGTGATATCGGGCTTAGGCTCCCTCCATTCC.5’

pBSAdl0 and pBSAd13 were originally constructed to produce precursor RNA transcripts for splicing studies and contained sequences Of the major late transcription unit of adenovirus 2. pBSAd13 was constructed by insertron of Hhal-BamHI fragment (168 nt) of plasmid pBSAd1 (Konarska and Sharp, 1987) Into the Smal site of a Bluescript PBS- vector (Stratagene Cloning Systems). pBSAdl0 was similar to pBSAdi3 but contained in addition a 90 nt long FnuDII-Hhal fragment of pBSAd1 positioned upstream of the Hhal-BamHI fragment. pBSAd10 and pBSAd13 were linearized with Pvull and FnuDII, respectively, and used as templates for T7 RNA polymerase. The expected transcripts were 67 nt and 87 nt long, respectively Enzyme Assays Transcription reactions were performed following the conditions of Millrgan et al (1987) and contained 40 m M Tris-HCI (pH 8.1) 1 m M spermidine, 5 m M dithiothrertol. 0.01% (v/v) Triton X-100, and 80 mglml polyethylene glycol (8000 MW). Typically, reactions were performed rn 10 PI volumes and contained 4 m M of each NTP [a-s*P]UTP (25-250 ~Crlumol). 20 m M MgCls, 50-200 U of T7 RNA polymerase, and DNA or RNA template, as indicated. lncubatron was carried out at 37°C for 4 hr, unless stated otherwise. Following the incubation, RNA products were extracted with phenol, precipitated with ethanol, and separated rn a denaturing polyacrylamide gel. For preparation of unlabeled RNA, transcnpbon products were vrsualized in a polyacrylamide gel by ultraviolet shadowing. Transcriptional activity was determrned either by direct measurement of radioactivrty present rn appropriate gel slices or by an acid precipitatron assay. For determmation of acid-insoluble radioactivity, 2 ~1 alrquots of the transcrtption reaction were mixed with 8 ul of 1 M sodrum acetate (pH 5.5) containing 0.1 pg/ul yeast tRNA carrier and spotted onto Whatman 3MM filters in duplicate (5 ul aliquots). The filters were washed three times for 15 m m each rn a cold solution of 3% (v/v) phosphoric acid, 20 m M sodium pyrophosphate, 3 m M EDTA. and air-dried, and the acid-insoluble radioactivity was counted (Hinkle and Richardson, 1974). Structural Analysis of RNA RNA samples were separated by electrophoresis in 10% or 20% polyacrylamide-8 M urea gels rn Tris-borate buffer (Mantatis et al., 1982) Electrophoresrs under nondenaturing conditions was performed as described previously (Konarska and Sharp, 1987) usrng 4% or 10% polyacrylamide gels in 50 m M Tris-glyctne buffer. RNAase Tl or RNAase A digestions were carried out In 10 ul of 50 m M Trrs-HCI (pH 7.5) wtth 1-2 wg of enzyme for 3 hr at 37%. unless otherwise stated. Before addition of the enzyme, the RNA was denatured by heating to 9O“C for 5 min followed by rapid cooltng on Ice. Labelmg of RNA wrth (y-ssP]ATP by using polynucleotide krnase or with [32P]pCp by using RNA ligase was performed as described (Maniatiset al., 1982). Partial alkaline hydrolysisof 5’terminally labeled RNA fragments was carned out rn 10 ul of 25 m M NaOH for 5 or 10 min at 80% Nuclease Pl or RNAase T2 drgesttons were carned out rn 10 nl of 50 m M ammomum acetate (pH 5.3) with 1 pg of enzyme for 1 hr at 50°C. Nucleotide products of RNAase digestions were separated by two-

dimensional TLC on cellulose plates using solvent A (isobutyric acrd-concentrated NH4 OH-HsO, 577:38:385) in the first dimension and solvent B (tert-butanol-concentrated HCI-HsO, 14:3:3) In the second dimension (Konarska et al., 1985) Northern Hybridization RNA was transferred from a gel onto a GeneScreen membrane (New England Nuclear) and prehybridized as described previously (Konarska and Sharp, 1987). Hybridization was carried out at 42OC with lo5 cpmlml of [r+P]UTP-labeled X RNA. X RNA used as a probe was prepared by transcription with T7 RNA polymerase as described above, except that the incubations were in 50 ul and contained 0.1 m M UTP and [a-ssP]UTP at 50 uCi/nmol. The membrane was washed in 0.1x SSC, 0.1% SDS twice for 15 min at room temperature and once for IO min at 55%. Under these conditions nonspecific hybridization of X RNA to poly(A), poly(U), and poly(A,U) ribopolymers was not detectable (data not shown). The hybridized RNA was detected by autoradiography at -70°C with an intensifying screen Acknowledgments We are grateful to Drs. Stan Tabor and Charles Richardson, Harvard Medrcal School, for the gift of the purified T7 RNA polymerase and helpful comments concerning the work. We acknowledge materials and helpful informahon provided by Dr. Carl Fuller, USB. We thank members of the Sharp lab for many thoughtful and shmulating discussrons. M. M. K. is a Lucille P Markey Scholar. This work was supported by a grant from the Lucille P Markey Charitable Trust (no. 87-19) to M. M. K. and partially by grants from the National lnstrtutes of Health (no. GM34277) and National Cancer Institute (no. CA14051) to f? A. S. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C Section 1734 solely to indicate this fact. Received February

13. 1989; revised March 17, 1989.

References Baron, M. H., and Baltimore, D. (1982). Purification and properties of a host cell protein required for poliovirus replicahon ,n vitro. J. Brol. Chem. 257 12351-12358. Brebricher, C. K. (1987). Replrcation and evolution of short-chained RNA species replicated by 08 replicase. Cold Spring Harbor Symp. &ant. Biol. 52, 299-306. Biebricher, C. K.. and Orgel, L E. (1973). An RNA that multtplies Indefinitely with DNA-dependent RNA polymerase: selection from a random copolymer. Proc. Natl. Acad. SCI. USA 70, 934-938. Blumenthal, T., Landers, T. A., and Weber, K. (1972). Bacteriophage Q8 replicase contains the protein biosynthesis elongation factors EF Tu and EF Ts. Proc. Nat1 Acad. Sci. USA 69. 1313-1317. Branch, A D.. Robertson, H. D., and Dickson, E (1981) Longer-thanunit-length vrroid minus strands are present in RNA from infected plants. Proc. Natl. Acad. Sci. USA 78, 6381-6385 Buzayan, J. M., Gerlach, W. L., and Bruemng, G (1986). Non-enzymatic cleavage and ligation of RNAs complementary to a plant virus satellite RNA. Nature 323, 349-353. Cavalier-Smith, T. (1987). The origrn of ceils: a symbrosrs between genes, catalysts, and membranes. Cold Spring Harbor Symp. Quant. Brol. 5.2, 805-824. Chamberlin, M. J. (1974a). The selectivity Biochem. 43, 721-775.

of transcription.

Annu. Rev.

Chamberlin, M. J. (1974b). Bacterial DNA-dependent RNA polymerase. In The Enzymes, Vol. 10, f? Bayer, ed. (New York: Academrc Press), pp. 333-374. Chamberlin. M. J., and Ryan, T. (1982). Bacteriophage DNA-dependent RNA polymerases. In The Enzymes. Vol 15. P Bayer. ed. (New York: Academic Press), pp. 87-108. Chen. P.-J., Kalpana, G., Goldberg, J., Mason, W.. Werner, B., Gerin, J., and Tyler, J. (1986). Structure and replication of the genome of the hepatitis 8 virus. Proc. Natl. Acad. Sci. USA 83. 8774-8778.

RNA Replication 431

by T7 RNA Polymerase

Davanloo, P, Rosenberg, A. R.. Dunn, J. J.. and Studier, F. W. (1984). Cloning and expression of the gene for bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 87. 2035-2039.

Robertson, H. D.. and Branch, A. D. (1987). The viroid replicatron process. In Viroids and Vrrord-like Pathogens, J. S. Semancik, ed. (Boca Raton, Florida: CRC Press), pp. 49-69.

Dunn, J. J., and Studier, F. W. (1983). Complete nucleotide sequence of bacteriophage T7 and the locations of T7 genetic elements. J. Mol. Biol. 766, 477-535.

Schubert, M., Harmison, G. G , Richardson, C. D.. and Meier, E (1985). Expression of a cDNA encodmg a functional 241.kilodalton vesicular stomatitis virus RNA polymerase. Proc. Natl. Acad. Sci. USA 82, 7984-7988

Gilbert, W. (1986). Origin of life: the RNA world. Nature 319. 618. Hartmann, G. R., Biebricher, C. K., Glaser, S. J., Grosse, F., Katzameyer, M. J., Lindner, A. J., Mosig. H.. Nasheuer, H.-P, RothmanDenes, L. B., Schaffner, A. R., Schneider, G. J., Stetter, K.-O., and Thomm. M. (1988). Initiation of transcription-a general tool for affinity labeling of RNA polymerase by autocatalysis. Biol. Chem. HoppeSeyler 369, 775-788. Hinkle, D. C., and Richardson, C. C. (1974). Bacteriophage T7 deoxyribonucleic acid replication in vitro. J. Biol. Chem. 249, 2974-2984. Kacian, D. L., Mills, D. R.. Kramer, F. R., and Spiegelman, S. (1972). A replicating RNA molecule suitable for a detailed analysis of extracellular evolution and replication. Proc. Natl. Acad. Sci. USA 69, 30383042. Keese, P.. and Symons, R. H. (1987). The structure of viroids and virusoids. In Viroids and Viroid-like Pathogens, J. S. Semancik, ed. (Boca Raton, Florida: CRC Press), pp. l-47. Konarska, M. M., and Sharp, t? A. (1987). Interactions between small nuclear ribonucleoprotein particles in formation of spliceosomes. Cell 49, 763-774. Konarska, M. M., Grabowski, P J., Padgett, R. A., and Sharp, f? A. (1985). Characterization of the branch site in lariat RNAs produced by splicing of mRNA precursors. Nature 373, 552-557. Kos, A., Dijkema, R., Arnberg, A. C.. van der Meide, f? H., and Schellekens, H. (1986). The hepatitis delta (6) possesses a circular RNA. Nature 323, 558-560. Krieg, f? A., and Melton, D. A. (1987). In vitro RNA synthesis with SP6 RNA polymerase. Meth. Enzymol. 755, 397-415. Kuo, M. Y. P, Goldberg, J., Coates, L., Mason, W., Gerin, J., and Tyler, J. (1988). Molecular cloning of hepatitis delta virus RNA from an infected woodchuck liver: sequence, structure and applications. J. Virol. 62, 1855-1861. Makino. S., Chang, M. F., Shieh, C. K.. Kamahora. T.. Vannier, D. M., Govindarajan, S., and Lai. M. M. C. (1987). Molecular cloning and sequencing of a human hepatitis delta (6) virus RNA. Nature 329, 343-346. Maniatis, T., Fritsch, E. F., and Sambrook. J. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Martin, C. T., Muller, D. K., and Coleman, J. E. (1988). Processivity in early stages of transcription by T7 RNA polymerase. Biochemistry 27, 3966-3974. Milligan, J. F., Groebe, D. R., Witherell, G. W.. and Uhlenbeck, 0. C. (1987). Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucl. Acids Res. 75, 8783-8798. Mills, D. R., Peterson, R. L., and Spiegelman, S. (1967). An extracellular Darwinian experiment with a self-duplicating nucleic acid molecule. Proc. Natl. Acad. Sci. USA 58. 217-224. Mrlls, D. R., Kramer, F. R., Dobkin, C., Nishihara, T., and Spiegelman, S. (1975). Nucleotide sequence of microvariant RNA: another small replicating molecule. Proc. Natl. Acad. Sci. USA 72, 4252-4256. Moffat, B. A., Dunn, J. J., and Studier, F. W. (1984). Nucleotide sequence of the gene for bacteriophage T7 RNA polymerase. J. Mol. Biol. 773, 265-269. Munishkin, A., Voronin, L. A.. and Chetverin. A. B. (1988). An in viva recombinant RNA capable of autocatalytic synthesis by Q8 replicase. Nature 333, 473-475. Prody, G. A., Bakos. J. T., Buzayan, J. M.. Schneider, I. R., and Bruening, G. (1986). Reversible autolytic processing of dimeric plant virus satellite RNA. Science 237, 1577-1580. Rackwitz, H.-R., Rohde, W., and Sanger, H. L. (1981). DNA-dependent RNA polymerase II of plant origin transcribes viroid RNA into fulllength copies. Nature 297, 297-301.

Sedrvy, J. M., Capone. J. P, RajBhandary, U. T. and Sharp, I? A (1987). An inducible mammalian amber suppressor: propagation of a poltovrrus mutant. Cell 50, 379-389. Semancik, J. S.. and Harper, K. L. (1984). Optrmal conditrons for cellfree synthesis of citrus exocortis viroid and the question of specificity of RNA polymerase activity. Proc. Natl. Acad. SCI. USA 87, 4429-4433. Sharmeen, L., Kuo, M. Y. P., Dinter-Gottlieb, G., and Taylor, J (1988) Antigenomrc RNA of human hepatitis delta virus can undergo selfcleavage. J. Viral. 62, 2674-2679. Tabor, S., and Richardson, C. C. (1985). Bacteriophage T7 RNA polymerase-promoter system for controlled exclusive expression of specific genes Proc. Natl. Acad. Sci. USA 82, 1074-1078. Wahba, A. J., Mtller, M. J., Nrveleau, A., Landers, T. A., Carmrchael, G. G., Weber, K., Hawley, D. A., and Slobin, L. I. (1974). Subunit I of Qg replicase and 30s ribosomal protein Sl of fscherichia co/i. Evidence for the Identity of the two proterns. J. BIoI. Chem. 249, 3314-3316 Wang, K.-S., Choo. Q-L.. Weiner, A. J.. Ou. J.-H., Najarian, R. C., Thayer, R. M., Mullenbach, G. T., Denniston, K J., Germ, J. L , and Houghton, M. (1986). Structure, sequence and expressron of the hepatitis delta (6) viral genome. Nature 323, 508-514 Werner, A. M., and Maizels. N. (1987). tRNA-like structures tag the 3’ ends of genomic RNA molecules for replrcation: rmplications for origin of protein synthesis. Proc. Natl. Acad. Sci. USA 84. 7383-7387. Zasloff, M., and Felsenfeld, G. (1977). Analysis of in vitro transcription of duck reticulocyte chromatin using mercury-substituted ribonucleoside trrphosphates. Biochemistry 76. 5135-5145.