A competitive enzyme linked aptasensor with rolling circle amplification (ELARCA) assay for colorimetric detection of Listeria monocytogenes

Food Control 107 (2020) 106806

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

A competitive enzyme linked aptasensor with rolling circle amplification (ELARCA) assay for colorimetric detection of Listeria monocytogenes

T

Zhongxu Zhana,1, Hui Lia,1, Ju Liua, Guoyang Xiea, Fangbing Xiaoa, Xin Wub, Zoraida P. Aguilarc, Hengyi Xua,* a

State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang, 330047, PR China Jiangxi Institute for Food Control, Nanchang, 330001, PR China c Zystein, LLC., Fayetteville, AR, 72703, USA b

A R T I C LE I N FO

A B S T R A C T

Keywords: Listeria monocytogenes Rolling circle amplification Colorimetric Aptasensor

Listeria monocytogenes (L. monocytogenes) is a foodborne pathogen which can cause significant threats to human health, thus, a highly specific and accurate method for detection in food is urgently needed. In this study, an enzyme-linked aptasensor with rolling circle amplification (ELARCA) assay was developed for the sensitive and specific detection of L. monocytogenes. The assay was based on the competition between the aptamer (that was specific for L. monocytogenes) that was bound to the biotin probe 1 (BP1~A) and the RCA probe that was complementary to the BP1. Addition of the bacteria released the BP1 making it available for the RCA probe which initiated the RCA process. In the presence of the RCA buffer, multiple copies of the DNA were formed which attached the biotin probe 3 (BP3). The biotin in BP3 interacted with streptavidin labeled with horse radish peroxidase (SA-HRP) to complete the assay complex. In the presence of the enzyme substrate, HRP produced a chromophore that led to the colorimetric detection. Under the optimal conditions, the ELARCA assay for L. monocytogenes showed a limit of detection (LOD) of 4.6 × 102 CFU/mL in pure culture, which was three orders of magnitude higher than without RCA. The ELARCA assay in spiked fresh lettuce showed an LOD of 6.1 × 103 CFU/g. The method developed was fast, low-cost, sensitive, and highly specific for L. monocytogenes. By changing the specificity of the aptamer, the proposed ELARCA method provided a potential platform for the detection of other pathogenic bacteria.

1. Introduction Listeria monocytogenes (L. monocytogenes) is a foodborne pathogen which has caused significant threats to human health in both developing and developed countries (Meng, Li, Li, Xiong, & Xu, 2017; Shi et al., 2015). Infection with L. monocytogenes can lead to septicemia, meningitis, gastroenteritis and abortion (Drevets, Jelinek, & Freitag, 2001; Tapia, den Besten, & Abee, 2018). This pathogen can survive in soil, water, plant and human or animal feces (Locatelli, Spor, Jolivet, Piveteau, & Hartmann, 2013; Luo et al., 2017). Moreover, it keeps its viability and growth at refrigeration temperatures that poses a great threat to stored food (Jemmi & Stephan, 2006; Lambertz, Ivarsson, Lopez-Valladares, Sidstedtet, & Lindqvist, 2013). To effectively prevent harm from L. monocytogenes, a highly specific and accurate assay for detection in food is urgently needed.

The conventional assays for detection of foodborne pathogens are based on plate and culture, which are complicated and time-consuming. To overcome this shortcoming, new techniques such as polymerase chain reaction (PCR) (Mao et al., 2016; Zhang et al., 2014), enzymelinked immunosorbent assay (ELISA) (Chen, Huang, Xu, Xiong, & Li, 2015; Guo et al., 2016a,b), flow cytometry (FC) (Li, Li, Aguilar, Xiong, & Xu, 2018; Meng et al., 2017a,b), dynamic light scattering (DLS) (Huang et al., 2015) and more have been developed. Although these techniques are rapid with excellent sensitivity, they still need expensive instruments and reagents, which are not affordable in poor areas. Therefore, it is important to consider alternative methods to make up for these shortcomings. An alternative method of detection for foodborne L. monocytogenes is the use of aptamer for capture. An aptamer can be a synthetic nucleotide or peptide that serves as alternative to antibodies, which can

*

Corresponding author. State Key Laboratory of Food Science and Technology, Nanchang University, Address: 235 Nanjing East Road, Nanchang, 330047, PR China. E-mail addresses: [email protected], [email protected] (H. Xu). 1 Co-first authors. https://doi.org/10.1016/j.foodcont.2019.106806 Received 25 May 2019; Received in revised form 30 July 2019; Accepted 2 August 2019 Available online 07 August 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.

Food Control 107 (2020) 106806

Z. Zhan, et al.

sequences listed in Table 1. T4 DNA ligase, phi29 DNA polymerase and dNTPs were purchased from Sangon Biotech Engineering Technology and Service Co., Ltd (Shanghai, China). Luria-Bertani (LB) broth was bought from Land Bridge Technology Co. Ltd. (Beijing, China). Streptavidin (SA) was purchased from Shanghai hualan Chemical Technology Co. Ltd. (Shanghai, China). The bovine serum albumin (BSA), H2O2 and Tween 20 were obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). The substrate/chromogen solution 3,3′,5,5′-Tetramethylbenzidine (TMB) was obtained from Aladdin Industrial Inc. (Shanghai, China), and SA-HRP was obtained from Solaibao Technology Co., Ltd. (Beijing, China). The 96-well polystyrene plates were obtained from Corning Inc. (New York, USA). Ultrapure water was obtained from a Milli-QA apparatus (Molsheim, France). Lettuce was purchased from the local supermarket.

bind to the target molecule with high affinity and specificity (Bai et al., 2018). The aptamer is low-cost, simple to synthesize, and has thermal stability compared with antibody. Aptamers have been used as recognition molecule to detect proteins (Ocaña et al., 2015; Gao et al., 2015), biological molecules (Sabet, Hosseini, Khabbaz, Dadmehr, & Ganjali, 2017; Sun, Zhang, Sun, Wang, & Tang, 2017) and foodborne pathogens (Abbaspour, Norouz-Sarvestani, Noori, & Soltani, 2015; Suh et al., 2018). However, one capture aptamer can only recognize one single strand DNA (ssDNA) from the target bacteria at a time which may lead to low sensitivity of the assay. In recent years, many signal amplification methods have been reported to improve detection sensitivity (Chen, Liu, Xin, Zhao, & Liu, 2018; Li et al., 2018a,b,c; Yu et al., 2018). One such method is the rolling circle amplification (RCA) which is a simple and powerful isothermal amplification method and can generate multiple ssDNA that could bind with the signal detection probe (Hao et al., 2017; Qiu et al., 2017; Zhang, Lv, Lin, Li, & Tang, 2018). RCA only requires a short strand of DNA as a primer and a circular DNA as the template for amplification with phi29 DNA polymerase (Xu, Cui, Zhao, Tang, & Kong, 2018; Xu et al., 2019; Zhu et al., 2015). The RCA products can hybridize with a series of signal detection probes. This has been used for detection of nucleic acids, small molecules, and proteins (Guo et al., 2016a,b; Teng et al., 2017; Wu et al., 2018; Yao et al., 2017; Zhang et al., 2018a,b). However, these are mostly based on the sandwich ELISA that used antibody or combination of antibody with aptamer. Using these details from past studies, we developed a competitive aptamer sensor with rolling circle amplification coupled with the horseradish peroxidase for colorimetric detection of L. monocytogenes. The enzyme linked aptasensor with rolling circle amplification (ELARCA) assay was performed in a microplate. Biotin probe 1 (BP1) with the aptamer (BP1~A) was immobilized in the well through the link between biotin and streptavidin forming SA~BP1~A. Upon exposure of the aptamer with the bacteria, the BP1 was set free to hybridize with the RCA probe to carry out the RCA reaction leading to the formation of the copies of the ssDNA (cssDNA). Biotin-Probe 3 (BP3) bound to the cssDNA forming the BP3~cssDNA and the process was repeated to form multiple copies of the cssDNA. The addition of streptavidin labeled with horseradish peroxidase (SA-HRP) led to the formation of the SA-HRP ~ BP3~cssDNA complex. The HRP generated the chromophore responsible for the absorbance signal upon addition of the enzyme substrate. The concentration of the L. monocytogenes was quantified based on the intensity of the absorbance signal which was recorded at 450 nm. Compared with the sandwich ELISA that used antibody or combined of antibody with aptamer, the proposed ELARCA assay was sensitive, specific, easy to use, and cost-effective for L. monocytogenes detection in food.

2.2. Bacterial culture preparation The strains used in this experiment including L. monocytogenes (CMCC54007), Bacillus cereus (PZ14579), Cronobacter sakazakii (CMCC45401), Salmonella Enteritidis (ATCC13076), Staphylococcus aureus (CMCC26001), Escherichia coli O157:H7 (ATCC43888) and Pseudomonas aeruginosa (CMCC10104) were grown in Luria-Bertani (LB) medium overnight at 37 °C in a rotary shaker at 180 rpm. The sterile phosphate-buffered saline (PBS, 0.01 M, pH 7.4) was used to reconstitute the fresh bacteria to obtain 10 serial dilutions. The viable cell number of bacteria was determined using conventional plate count method after incubation at 37 °C for 18 h prior to enumeration. 2.3. Preparation of BP1~A, RCA probe and RCA reaction The BP1, RCA primer, Padlock DNA were designed and simulated with the NUPACK software (http://www.nupack.org/). The BP1~A was obtained as follows: BP1 and the specific aptamer (A) was mixed, heated at 95 °C for 5 min in a water bath, and cooled to room temperature to form the BP1~A. The RCA probe was prepared as follows: 10 μL of RCA primer (10 μM), 12 μL Padlock DNA (10 μM), 10 μL 10 × T4 DNA ligase reaction buffer, 10 μL of T4 DNA ligase (5 U/μL) and ultrapure water was used to adjust the reaction volume to 100 μL. The ligation reaction was conducted at room temperature for 16 h and terminated with thermal treatment at 65 °C for 10 min. The prepared BP1~A and RCA probe were either directly used or stored at −20 °C until use. The RCA reaction contained 1.4 mM dNTP, 0.15 U/μL of phi29 DNA polymerase, 5 μL 10 × phi 29 DNA polymerase buffer and ultrapure water to adjust the reaction volume to 50 μL. The mixture was incubated at 37 °C for a 2 h. 2.4. Working principle of the competitive strategy

2. Experimental section In this study, a competitive enzyme linked aptamer sensor for colorimetric detection of L. monocytogenes was developed. The principle of the assay depicted in Scheme 1 contained the two sets of tests performed, with RCA and without RCA. Initially, 50 μL streptavidin was placed in the microplate wells and incubated at 4 °C overnight. Excess reagent was decanted and the wells were washed two times with PBST (PBS containing 0.05% Tween-20). A 300 μL of blocking buffer (PBS

2.1. Materials and reagents The DL 5000 DNA marker was obtained from TaKaRa Biotech Co., Ltd. (Dalian, China). The agarose was obtained from Solaibao Technology Co., Ltd. (Beijing, China). All of the DNA oligonucleotides were synthesized by TsingKe Biotech. Co. Ltd. (Beijing, China) with the Table 1 The DNA sequences used in this study. Name

Sequence (5′-3′)

Reference

Biotin probe 1 Aptamer Biotin probe 2 RCA primer Padlock DNA Biotin probe 3

ATCAACCGGGTACCCTTTTTT-Biotin TATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT TACCCGGTTGAT-Biotin TACCCGGTTGATAAAAAAAATTGGTTATGTGGCTGATGTTGC PO4-CACATAACCAAAAACCCGAAGAGAAGGAAGAGAAAGCAACATCAGC Biotin-CCCGAAGAGAAGGAAGAGAAA

this study Zhang et al. (2016) this study this study this study this study

2

Food Control 107 (2020) 106806

Z. Zhan, et al.

Scheme 1. Schematic illustration of the ELARCA assay for detection of L. monocytogenes.

treated with 2.5 μL of 10 × loading buffer before loading on to a 1% agarose gel for electrophoresis at a constant voltage of 250 V for 15 min followed by imaging under the UV trans illuminator (Bio-Rad, Hercules, CA). Similarly, to confirm the formation of the cssDNA, CD was used to detect the presence of the cssDNA. A similar reaction involving 250 nM RCA probe with and without the RCA reaction buffer were incubated as above. A 400 μL aliquot of the resulting products were transferred into cuvettes and the CD spectrum was recorded between 230 nm and 300 nm in a 1 cm path on a Biologic MOS 450 spectrograph.

containing 3.0% BSA) was added into the wells and incubated for 120 min to prevent nonspecific adsorption. After washing three times with PBST, 50 μL of BP1~A was immobilized in the wells for 30 min at 37 °C through the link between biotin and streptavidin to form SA~ BP1~A. Subsequently, 100 μL various concentration of L. monocytogenes were added into the well and incubated at 37 °C for 60 min to allow the aptamer to bind with the bacteria, thereby releasing the BP1. After washing four times, the wells were divided into two groups, one for the assay with RCA and the second was for the assay without RCA to detect L. monocytogenes. The wells that were used with RCA were treated as follows: 50 μL of RCA probe was added into the wells and incubated at 37 °C for 30 min. After washing five times with PBST, RCA reaction buffer was added into the wells and incubated for 120 min at 37 °C. Next, the plates were washed six times with PBST and excess wash buffer was decanted before the addition of 50 μL BP3 followed by incubation at 37 °C for 30 min. The wells were washed seven times with PBST before the addition of 50 μL SA-HRP followed by incubation at 37 °C for 30 min. Finally, each well was washed eight times with PBST, decanted, and 50 μL enzyme substrate was added followed by incubation at 37 °C for 10 min. The reaction was stopped by adding 50 μL of 10% (v/v) H2SO4 and the signals were measured at 450 nm with a multimode microplate reader (ThermoFisher Scientific, San Jose, CA). The wells that were used without RCA were treated as follows: 50 μL biotin probe 2 (BP2) was added into the wells and incubated at 37 °C for 30 min followed by washing five times with PBST. A 50 μL SA-HRP was added and incubated at 37 °C for 30 min. Finally, each well was washed six times with PBST, and 50 μL enzyme substrate was added and incubated at 37 °C for 10 min. The reaction was stopped by adding 50 μL of 10% (v/v) H2SO4 and the signals were measured at 450 nm with a multimode microplate reader.

2.6. Specificity test A useful method of foodborne pathogen detection had to be specific for the target pathogen to avoid confusing false positives and false negatives. Hence, the reagents used above were applied to various strains of bacteria. The bacteria listed in section 2.2 were centrifuged at 12000 rpm for 5 min and washed with sterile PBS two times. The bacteria were inactivated by incubation at 75 °C for 15 min and diluted with sterile PBS to obtain a 105 CFU/mL. These bacteria suspensions were centrifuged at 12000 rpm for 5 min and the resulting pellet was resuspended in 100 μL sterilized water. The respective suspensions were used for the ELARCA assay to evaluate the specificity of the ELARCA assay.

2.7. Detection of L. monocytogenes in lettuce samples The ELARCA method developed was tested in a real food sample to evaluate its efficacy. Fresh lettuce was purchased from the local supermarket and washed with sterile PBS. A 1 g sample of lettuce and freshly harvested L. monocytogenes were added to 0.01 M sterile PBS to adjust the reaction volume to 10 mL to obtain a final concentration of 6.1 × 107 CFU/g to 6.1 × 100 CFU/g lettuce sample. The mixture was homogenized for 10 min before taking a 1 mL supernatant that was centrifuged at 12000 rpm for 5 min to collect the precipitate which was resuspended in 100 μL sterilized water. The resuspended precipitate was analyzed using the ELARCA assay.

2.5. Agarose gel electrophoresis and circular dichroism (CD) spectroscopy The formation of products in the form of cssDNA during the RCA reaction using 1 μM RCA probe with and without the RCA reaction buffer were verified by gel electrophoresis and circular dichroism spectroscopy. The RCA reaction buffer and the RCA probe were incubated for 120 min at 37 °C to form the cssDNA. A 15 μL aliquot was 3

Food Control 107 (2020) 106806

Z. Zhan, et al.

3. Result and discussion

the mole ratio of BP1 to the aptamer was between 1:2 to 1:4. Hence, the ratio of BP1 to aptamer at 1:2 was used for the succeeding procedures. Fig. 2B showed the effect of varying the concentration of streptavidin. The △OD became constant when the concentration of streptavidin was 10 μg/mL. Thus, 10 μg/mL of streptavidin was selected for the succeeding studies. The effects of the concentration of the BP1~A, RCA probe and BP3 were evaluated. As shown in Fig. 2C–E, the highest △OD were obtained when the concentration of BP1~A, RCA probe and BP3 were at 10 nM, 62.5 pM and 2.5 nM, respectively. The RCA reaction time and the concentration of phi29 DNA polymerase was also investigated in order to provide the shortest time for the best signal. Fig. 2F–G showed the optimized RCA reaction conditions at a reaction time of 120 min and the optimized concentration of phi29 DNA polymerase was 0.15 U/μL. All the tests were repeated in triplicate.

3.1. Working principle of the assay An ELARCA assay was developed for the low cost, sensitive and specific detection of L. monocytogenes. The assay was based on the indirect competition between the aptamer (that was specific for L. monocytogenes) that was bound to the BP1 and the RCA probe that was complementary to the BP1. When the aptamer in the BP1~A was not released, that was in the absence of the L. monocytogenes, the RCA probe would not be able to bind with the BP1, therefore no RCA would ensue. In the presence of the L. monocytogenes, the aptamer would bind with the L. monocytogenes, thereby making BP1 available for the RCA probe forming BP1~RCA probe which initiated the RCA process. In the presence of the RCA buffer, multiple copies of the DNA would be formed and attached with the BP3. The biotin in BP3 would combine with SAHRP which in the presence of the enzyme substrate produced the colorimetric detection. Only in the presence of L. monocytogenes would the RCA reaction take place making this system highly specific.

3.4. ELARCA assay detection of L. monocytogenes in pure culture Under the optimized conditions, the ELARCA assay for detection of L. monocytogenes was evaluated to establish the limit of detection (LOD) and the dynamic range of detection. Fig. 3 showed the ELARCA assay results under the optimized conditions. These results indicated that ELARCA assay had a dynamic range from 4.6 × 102 CFU/mL to 4.6 × 107 CFU/mL with a linear correlation given by y = 0.1898x 0.0359 (R2 = 0.9418) where y = the absorbance at 450 nm and x = the concentration of L. monocytogenes. Based on the NC + 3SD (Xu et al., 2017), the LOD was 4.6 × 102 CFU/mL in pure culture. This was three orders of magnitude higher than the LOD of the assay without RCA that was 4.6× 105 CFU/mL (Supplementary information). All the tests were repeated triplicates. Importantly, our assay neither required complex conjugation with nanomaterials nor used antibody. To better demonstrate the advantage of our ELARCA assay, the associated information had been compared with other methods for Listeria monocytogenes detection and listed in Table 2.

3.2. Agarose gel electrophoresis and circular dichroism (CD) spectroscopy The RCA products were analyzed by agarose gel electrophoresis and circular dichroism spectroscopy. As shown in Fig. 1A, Lane 1 was the RCA probe (1 μM) without the RCA reaction buffer and lane 2 was the RCA probe (1 μM) with the RCA reaction buffer. A significantly bright DNA band was observed on lane 2 while no DNA band was observed on Lane 1. These results showed that the assay with RCA reaction buffer amplified the cssDNA. The circular dichroism spectroscopy in Fig. 1B confirmed the presence of a DNA peak around 280 nm in the presence of the RCA probe and the RCA reaction buffer while no distinct peak was observed without these buffers. The results of the agarose gel electrophoresis and circular dichroism spectroscopy confirmed the importance of the RCA probe in the ELARCA assay for the bacteria. All the tests were repeated in triplicate.

3.5. Specificity of the assay

3.3. Optimization of ELARCA for L. monocytogenes

The specificity of the ELARCA assay for detection of L. monocytogenes was also evaluated using L. monocytogenes plus non-target bacteria that included Salmonella Enteritidis (ATCC13076), Cronobacter sakazakii (CMCC45401), Escherichia coli O157: H7 (ATCC43888), Staphylococcus aureus (CMCC26001) Pseudomonas aeruginosa (CMCC10104), and Bacillus cereus (PZ14579). PBS was used as negative control to evaluate the specificity of the assay. As shown in Fig. 4, the absorbance signals for the assay of the non-target bacteria and the PBS showed significantly low absorbance signals compared with the assay involving the target L. monocytogenes. These results indicated that the

To obtain the optimized conditions for detection of L. monocytogenes using the ELARCA assay, the mole ratio of BP1 to A, the concentration of streptavidin, BP1~A, RCA probe, BP3, the RCA reaction time, and the concentration of phi29 DNA polymerase were carefully optimized using 4.6 × 105 CFU/mL L. monocytogenes. Fig. 2A showed the effects of changing the mole ratio of BP1 to the A. The changing in absorbance (△OD) (the absorbance after addition of 4.6 × 105 CFU/mL L. monocytogenes - the absorbance after addition of PBS) became constant when

Fig. 1. (A) Agarose gel electrophoresis image for the assay development. Lane 1: competitive colorimetric assay without RCA; Lane 2 competitive colorimetric assay with RCA. (B) Circular dichroism (CD) spectroscopy for the assay development. 4

Food Control 107 (2020) 106806

Z. Zhan, et al.

Fig. 2. ELARCA assay parameter optimization. (A) Effect of the ratio of BP1 to A, (B) Effect of the concentration of streptavidin on the microplate well, (C) Effect of the concentration of BP1~A, (D) Effect of the concentration of RCA probe, (E) Effect of the concentration of BP3, (F) Effect of the RCA reaction time, (G) Effect of the concentration of phi29 DNA polymerase. The concentration of L. monocytogenes used in these tests was 4.6 × 105 CFU/mL. The error bars represented the standard deviation of three measurements. 5

Food Control 107 (2020) 106806

Z. Zhan, et al.

Fig. 3. The calibration curve of the ELARCA assay for detection of L. monocytogenes in pure culture.

Fig. 4. The specificity of ELARCA assay for detection of L. monocytogenes using six non-target bacteria at concentrations of 105 CFU/mL.

newly developed ELARCA assay was highly specific for the detection of L. monocytogenes. All the tests were repeated in triplicate. 3.6. Application of the ELARCA assay for the detection of L. monocytogenes in spiked lettuce The ELARCA assay for detection of L. monocytogenes was applied in spiked lettuce samples to exhibit its applicability in real food samples. As shown in Fig. 5, the absorbance intensity was detected even in the presence of lettuce samples. The signals varied with the concentration of L. monocytogenes that was mixed with the same concentration of lettuce. A linear correlation between the concentration of L. monocytogenes in spiked lettuce samples and the absorbance was recorded at y = 0.166x - 0.0666 (R2 = 0.9295), where the x was the concentration of the L. monocytogenes in spiked lettuce samples ranging from 6.1 × 103 CFU/g to 6.1 × 107 CFU/g and y was the absorbance at 450 nm. Based on NC + 3SD, the LOD in lettuce samples was 6.1 × 103 CFU/g. This indicated that the ELARCA assay could be performed without difficulty and without separation steps in the presence of real food samples. All the tests were repeated in triplicate.

Fig. 5. The calibration curve of ELARCA assay for detection of L. monocytogenes in spiked lettuce samples.

the method developed in this study shows a potential to be a platform assay for the sensitive detection other pathogenic bacteria.

4. Conclusion In conclusion, we successfully established an enzyme linked aptasensor assisted by rolling circle amplification, ELARCA, for colorimetric detection of L. monocytogenes using lettuce as the simulant food. Under the optimum parameters, the ELARCA assay gave an LOD of 4.6 × 102 CFU/mL in pure culture and in spiked lettuce, the LOD was 6.1 × 103 CFU/g. The ELARCA assay exhibited a high specificity toward L. monocytogenes that was not observed in any other pathogenic bacteria. For future studies, by changing the specificity of the aptamer,

Conflict of interest form We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome.

Table 2 Comparison of different methods for Listeria monocytogenes detection. Detection methods Asymmetric polymerase chain reaction and rolling circle amplification Electrochemical immunosensor Immunomagnetic separation with lateral flow immunoassay Optical biosensor Nanoparticle cluster catalyzed signal amplification Immunomagnetic separation with nucleic acid lateral flow biosensor Immunomagnetic separation and urease catalysis Enzyme-linked aptasensor with rolling circle amplification

Materials DNA Antibody Antibody Antibody Vancomycin-aptamer Antibody Antibody Aptamer

6

Detection limit 1

4.8 × 10 CFU/mL 1.0 × 102 CFU/mL 1.0 × 104 CFU/mL 1.0 × 102 CFU/mL 5.4 × 103 CFU/mL 3.5 × 103 CFU/mL 3.0 × 102 CFU/mL 4.6 × 102 CFU/mL

Reference Zhan, Liu, Yan, Aguilar, and Xu (2019) Cheng et al. (2014) Shi et al. (2015) Chen, Huang, Cai, Wang, and Lin (2018) Zhang et al. (2016) Li et al. (2018a,b,c) (Chen et al., 2015) This study

Food Control 107 (2020) 106806

Z. Zhan, et al.

Acknowledgements

Bioelectronics, 102, 307–315. Locatelli, A., Spor, A., Jolivet, C., Piveteau, P., & Hartmann, A. (2013). Biotic and abiotic soil properties influence survival of Listeria monocytogenes in soil. PLoS One, 8(10), e75969. Luo, D., Huang, X., Mao, Y., Chen, C., Li, F., Xu, H., et al. (2017). Two-step large-volume magnetic separation combined with PCR assay for sensitive detection of Listeria monocytogenes in pasteurized milk. Journal of Dairy Science, 100(10), 7883–7890. Mao, Y., Huang, X., Xiong, S., Xu, H., Aguilarc, Z. P., & Xiong, Y. (2016). Large-volume immunomagnetic separation combined with multiplex PCR assay for simultaneous detection of Listeria monocytogenes and Listeria ivanovii in lettuce. Food Control, 59, 601–608. Meng, X., Li, F., Li, F., Xiong, Y., & Xu, H. (2017a). Vancomycin modified PEGylatedmagnetic nanoparticles combined with PCR for efficient enrichment and detection of Listeria monocytogenes. Sensors and Actuators B: Chemical, 247, 546–555. Meng, X., Yang, G., Li, F., Liang, T., Lai, W., & Xu, H. (2017b). Sensitive detection of Staphylococcus aureus with vancomycin-conjugated magnetic beads as enrichment carriers combined with flow cytometry. ACS Applied Materials & Interfaces, 9(25), 21464–21472. Ocaña, C., Hayat, A., Mishra, R., Vasilescu, A., Valle, M. D., & Marty, J. (2015). A novel electrochemical aptamer-antibody sandwich assay for lysozyme detection. Analyst, 140(12), 4148–4153. Qiu, Z., Shu, J., He, Y., Lin, Z., Zhang, K., Lv, S., et al. (2017). CdTe/CdSe quantum dotbased fluorescent aptasensor with hemin/G-quadruplex DNzyme for sensitive detection of lysozyme using rolling circle amplification and strand hybridization. Biosensors and Bioelectronics, 87, 18–24. Sabet, F. S., Hosseini, M., Khabbaz, H., Dadmehr, M., & Ganjali, M. R. (2017). FRET-based aptamer biosensor for selective and sensitive detection of aflatoxin B1 in peanut and rice. Food Chemistry, 220, 527–532. Shi, L., Wu, F., Wen, Y., Zhao, F., Xiang, J., & Ma, L. (2015). A novel method to detect Listeria monocytogenes via superparamagnetic lateral flow immunoassay. Analytical and Bioanalytical Chemistry, 407(2), 529–535. Suh, S. H., Choi, S. J., Dwivedi, H. P., Moore, M. D., Escudero-Abarca, B. I., & Jaykus, L. (2018). Use of DNA aptamer for sandwich type detection of Listeria monocytogenes. Analytical Biochemistry, 557, 27–33. Sun, A., Zhang, Y., Sun, G., Wang, X., & Tang, D. (2017). Homogeneous electrochemical detection of ochratoxin A in foodstuff using aptamer-graphene oxide nanosheets and DNase I-based target recycling reaction. Biosensors and Bioelectronics, 89, 659–665. Tapia, N. C., den Besten, H. M. W., & Abee, T. (2018). Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface. International Journal of Food Microbiology, 273, 20–27. Teng, J., Ye, Y., Yao, L., Yan, C., Cheng, K., Xue, F., et al. (2017). Rolling circle amplification based amperometric aptamer/immuno hybrid biosensor for ultrasensitive detection of Vibrio parahaemolyticus. Microchimica Acta, 184(9), 3477–3485. Wu, Z., Lin, L., Khan, M., Zhang, W., Mao, S., Zheng, Y., et al. (2018). DNA-mediated rolling circle amplification for ultrasensitive detection of thrombin using MALDI-TOF mass spectrometry. Chemical Communications, 54(82), 11546–11549. Xu, Y., Cui, Y., Zhao, Q., Tang, A., & Kong, D. (2018). Label-free and sensitive detection of uracil-DNA glycosylase using exponential real-time rolling circle amplification. Analytical Methods, 10(20), 2405–2410. Xu, J., Wang, Y., Yang, L., Gao, Y., Li, B., & Jin, Y. (2017). A cytometric assay for ultrasensitive and robust detection of human telomerase RNA based on toehold strand displacement. Biosensors and Bioelectronics, 87, 1071–1076. Xu, H., Zhang, S., Ouyang, C., Wang, Z., Wu, D., Liu, Y., et al. (2019). DNA nanostructures from palindromic rolling circle amplification for the fluorescent detection of cancerrelated microRNAs. Talanta, 192, 175–181. Yao, L., Ye, Y., Teng, J., Xue, F., Pan, D., Li, B., et al. (2017). In vitro isothermal nucleic acid amplification assisted surface-enhanced Raman spectroscopic for ultrasensitive detection of vibrio parahaemolyticus. Analytical Chemistry, 89(18), 9775–9780. Yu, B., Li, F., Zhao, T., Li, F., Zhou, B., & Xu, H. (2018). Hybridization chain reactionbased flow cytometric bead sensor for the detection of emetic Bacillus cereus in milk. Sensors and Actuators B: Chemical, 256, 624–631. Zhang, L., Huang, R., Liu, W., Liu, H., Zhou, X., & Xing, D. (2016). Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzed signal amplification. Biosensors and Bioelectronics, 86, 1–7. Zhang, K., Lv, S., Lin, Z., Li, M., & Tang, D. (2018a). Bio-bar-code-based photoelectrochemical immunoassay for sensitive detection of prostate-specific antigen using rolling circle amplification and enzymatic biocatalytic precipitation. Biosensors and Bioelectronics, 101, 159–166. Zhang, Z., Wang, L., Xu, H., Aguilar, Z. P., Liu, C., Gan, B., et al. (2014). Detection of nonemetic and emetic Bacillus cereus by propidium monoazide multiplex PCR (PMAmPCR) with internal amplification control. Food Control, 35(1), 401–406. Zhang, H., Zhuo, Z., Chen, L., Chen, C., Luo, F., Chen, Y., et al. (2018b). Enhanced performance of a hyperbranched rolling circle amplification based electrochemiluminescence aptasensor for ochratoxin A using an electrically heated indium tin oxide electrode. Electrochemistry Communications, 88, 75–78. Zhan, Z., Liu, J., Yan, L., Aguilar, Z. P., & Xu, H. (2019). Sensitive fluorescent detection of Listeria monocytogenes by combining a universal asymmetric polymerase chain reaction with rolling circle amplification. Journal of Pharmaceutical and Biomedical Analysis, 169, 181–187. Zhu, X., Feng, C., Zhang, B., Tong, H., Gao, T., & Li, G. (2015). A netlike rolling circle nucleic acid amplification technique. Analyst, 140(1), 74–78.

The work was supported by the National Key R&D Program of China (No.: 2018YFC1602500), Research Foundation from State Key Laboratory of Food Science and Technology, Nanchang University, China (No.: SKLF-ZZB-201720) and the Key Research and Development Program of Jiangxi Province, China (20171BBG70073). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.foodcont.2019.106806. References Abbaspour, A., Norouz-Sarvestani, F., Noori, A., & Soltani, N. (2015). Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus. Biosensors and Bioelectronics, 68, 149–155. Bai, C., Lu, Z., Jiang, H., Yang, Z., Liu, X., Ding, H., et al. (2018). Aptamer selection and application in multivalent binding-based electrical impedance detection of inactivated H1N1 virus. Biosensors and Bioelectronics, 110, 162–167. Cheng, C., Peng, Y., Bai, J., Zhang, X., Liu, Y., Fan, X., et al. (2014). Rapid detection of Listeria monocytogenes in milk by self-assembled electrochemical immunosensor. Sensors and Actuators B: Chemical, 190, 900–906. Chen, Q., Huang, F., Cai, G., Wang, M., & Lin, J. (2018a). An optical biosensor using immunomagnetic separation, urease catalysis and pH indication for rapid and sensitive detection of Listeria monocytogenes. Sensors and Actuators B: Chemical, 258, 447–453. Chen, Q., Lin, J., Gan, C., Wang, Y., Wang, D., Xiong, Y., et al. (2015). A sensitive impedance biosensor based on immunomagnetic separation and urease catalysis for rapid detection of Listeria monocytogenes using an immobilization-free interdigitated array microelectrode. Biosensors and Bioelectronics, 74, 504–511. Chen, R., Huang, X., Xu, H., Xiong, Y., & Li, Y. (2015a). Plasmonic enzyme-linked immunosorbent assay using nanospherical brushes as a catalase container for colorimetric detection of ultralow concentrations of Listeria monocytogenes. ACS Applied Materials & Interfaces, 7(51), 28632–28639. Chen, Z., Liu, Y., Xin, C., Zhao, J., & Liu, S. (2018b). A cascade autocatalytic strand displacement amplification and hybridization chain reaction event for label-free and ultrasensitive electrochemical nucleic acid biosensing. Biosensors and Bioelectronics, 113, 1–8. Drevets, D. A., Jelinek, T. A., & Freitag, N. E. (2001). Listeria monocytogenes-infected phagocytes can initiate central nervous system infection in mice. Infection and Immunity, 69(3), 1344–1350. Gao, L., Li, Q., Li, R., Yan, L., Zhou, Y., Chen, K., et al. (2015). Highly sensitive detection for proteins using graphene oxide-aptamer based sensors. Nanoscale, 7(25), 10903–10907. Guo, Q., Han, J., Shan, S., Liu, D., Wu, S., Xiong, Y., et al. (2016a). DNA-based hybridization chain reaction and biotin-streptavidin signal amplification for sensitive detection of Escherichia coli O157: H7 through ELISA. Biosensors and Bioelectronics, 86, 990–995. Guo, Y., Wang, Y., Liu, S., Yu, J., Wang, H., Wang, Y., et al. (2016b). Label-free and highly sensitive electrochemical detection of Escherichia coli based on rolling circle amplifications coupled peroxidase-mimicking DNAzyme amplification. Biosensors and Bioelectronics, 75, 315–319. Hao, L., Gu, H., Duan, N., Wu, S., Ma, X., Xia, Y., et al. (2017). An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet for Staphylococcus aureus detection. Analytica Chimica Acta, 959, 83–90 2017. Huang, X., Xu, Z., Mao, Y., Ji, Y., Xu, H., Xiong, Y., et al. (2015). Gold nanoparticle-based dynamic light scattering immunoassay for ultrasensitive detection of Listeria monocytogenes in lettuces. Biosensors and Bioelectronics, 66, 184–190. Jemmi, T., & Stephan, R. (2006). Listeria monocytogenes: Food-borne pathogen and hygiene indicator. Revue Scientifique Et Technique, 25(2), 571–580. Lambertz, S. T., Ivarsson, S., Lopez-Valladares, G., Sidstedtet, M., & Lindqvist, R. (2013). Subtyping of Listeria monocytogenes isolates recovered from retail ready-to-eat foods, processing plants and listeriosis patients in Sweden 2010. International Journal of Food Microbiology, 166(1), 186–192. Li, F., Li, F., Aguilar, Z. P., Xiong, Y., & Xu, H. (2018a). Polyamidoamine (PAMAM) dendrimer-mediated biotin amplified immunomagnetic separation method coupled with flow cytometry for viable Listeria monocytogenes detection. Sensors and Actuators B: Chemical, 257, 286–294. Li, F., Li, F., Luo, D., Lai, W., Xiong, Y., & Xu, H. (2018b). Biotin-exposure-based immunomagnetic separation coupled with nucleic acid lateral flow biosensor for visibly detecting viable Listeria monocytogenes. Analytica Chimica Acta, 1017, 48–56. Li, Y., Yu, C., Yang, B., Liu, Z., Xia, P., & Wang, Q. (2018c). Target-catalyzed hairpin assembly and metal-organic frameworks mediated nonenzymatic co-reaction for multiple signal amplification detection of miR-122 in human serum. Biosensors and

7