- Email: [email protected]
Colorimetric aptasensor for the detection of mercury based on signal intensification by rolling circle amplification
Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
Contents lists available at ScienceDirect
Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy journal homepage: www.elsevier.com/locate/saa
Colorimetric aptasensor for the detection of mercury based on signal intensification by rolling circle amplification Shijia Wu a, b, c, Qianru Yu b, Chuxian He b, Nuo Duan a, b, c, * a
State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, China School of Food Science and Technology, Jiangnan University, Wuxi 214122, China c International Joint Laboratory on Food Safety, Jiangnan University, Wuxi 214122, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 May 2019 Received in revised form 7 July 2019 Accepted 13 July 2019 Available online 20 July 2019
Techniques that are sensitive to detect mercury ion (Hg2þ) are very important, due to its serious threat to public health and food security. In this work, a colorimetric aptasensor was fabricated for the detection of Hg2þ based on rolling circle amplification (RCA). The aptamer was immobilized onto the microplate and hybridized with its complementary strand (cDNA1) which linked with a primer for triggering the RCA reaction of circular template. The successfully RCA process led to the formation of long ssDNA chains on the microplate, which created many hybridized DNA fragments for bio-cDNA2. The tagged amount of horseradish peroxidase (HRP) was enhanced through the avidin/biotin binding between avi-HRP and bio-cDNA2. In the addition of TMB-H2O2, HRP was catalyzed and generated an optical signal. However, in the presence of target, Hg2þ specifically and preferentially bound with aptamer and formed a strong and stable T-Hg2þ-T complex, which led to the release of cDNA1 and HRP cluster. Consequently, the optical signal decreased. Our results showed that the limit of detection (LOD) of this system was 1.6 nM with excellent specificity, and that the detection signals were enhanced by up to 18 times under RCA conditions when compared with detections without RCA. This method has been successfully used to detect Hg2þ in water samples with a recovery of 98%e105.74%. © 2019 Elsevier B.V. All rights reserved.
Keywords: Aptamer Hg2þ Colorimetric RCA Signal amplification Water
1. Introduction The pollution of heavy metals has become a worldwide agricultural eco-environment problem, posing a serious threat to modern agriculture, ecological safety, and especially to food security. Some of the heavy metals, such as cadmium (Cd), lead (Pb), mercury (Hg), and arsenic (As) are considered to be highly toxic and hazardous to human health even at trace levels. They may enter soils and groundwater and bio-accumulate in both animals and plants, then, enter the human body through food chain. Among the heavy metal ions, mercury ions (Hg2þ) are strongly toxic and widespread in the environment. Upon exposure, Hg2þ can cause a variety of adverse health effects, such as brain damage, kidney failure, immune system disruption, muscle weakness and paralysis of the limbs [1,2]. The maximum residue limit of total Hg is 0.02 mg/ kg in cereals and derived products as stipulated by the People's
* Corresponding author at: State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, China, School of Food Science and Technology, Jiangnan University, Wuxi 214122, China, International Joint Laboratory on Food Safety, Jiangnan University, Wuxi 214122, China. E-mail address: [email protected] (N. Duan). https://doi.org/10.1016/j.saa.2019.117387 1386-1425/© 2019 Elsevier B.V. All rights reserved.
Republic of China Standard (GB 2762-2017). The World Health Organization (WHO) permits the maximum mercury level of 6 ppb in drinking water [3]. This leads to the requirement of fast, accurate and reliable techniques for the detection of heavy metal ions. Aptamers are single-stranded oligonucleotides that can bind with high affinity and specificity to target molecules similar to antigeneantibody interactions [4]. They are selected in vitro using a method known as the systematic evolution of ligands by exponential enrichment (SELEX) [5,6]. Compared with antibodies, aptamers hold significant advantages such as better stability, great reproducibility, flexible labeling, and easy storage [7]. Especially, the aptamers are easily synthesized in vitro, their production eliminates the use of animals and allows for the selection of aptamers against poor immunogenic molecules. Heavy metal ions have no immunogenicity, which makes it very difficult to prepare monoclonal antibodies. The emergence of aptamer has benefited the detection of heavy metal ions. Since Hg2þ can selectively bind between two DNA thymine (T) bases and promote T-T mismatches to form stable T-Hg2þ-T base pairs, aptamer-based biosensors for the detection of Hg2þ has been extensively studied, including fluorescent sensors [8,9], colorimetric sensors [10], and electrochemical sensors [11]. Among these techniques, colorimetry has
2
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
attracted much attention owing to their conveniences of visual observation and simple operations. In recent years, a variety of colorimetric biosensors based on gold nanoparticles (AuNPs) have been developed for the selective detection of Hg2þ [12e14]. The quantification principle is associated with AuNPs aggregation that is AuNPs can be aggregated to induce the red shift of the surface plasmon resonance depending on the aggregation degree. However, the red shift is too slight to be distinguished in low concentration of target, which limits the sensitivity of colorimetry. To improve the sensitivity of the detection methods, rolling circle amplification (RCA) strategy can be adopted for signal amplification. RCA is an isothermal amplification technology involving numerous copies of the complementary sequence toward original circular template with tandem periodic oligonucleotides to produce a long ssDNA [15]. Since it was first established and applied for signal amplification by Landegren et al. in 1998 [16], it has been widely used in biomedical field, such as protein profiling [17], microRNA and DNA detection [18,19] whole-genome analysis [20], and foodborne pathogens detection [21,22] due to its simplicity, specificity, and sensitivity. Moreover, many highly sensitive and selective sensors have been developed by constituting the aptamer (high affinity target recognition) with RCA (signal amplification). Jiang et al. have constructed an aptamer-based RCA platform for fluorescent detection of pathogenic bacteria [23]. Shen et al. developed an electrochemical aptasensor for adenosine detection based on RCA strategy with a detection limit as low as 0.032 nM [24]. In addition, Liang et al. established a RCA-based colorimetric aptasensor for carcinoembryonic antigen (CEA) detection and the detection limit is 2 pM [25]. Up to date, the RCA-based aptasensors for Hg2þ detection have been focused on combining with electrochemiluminescence technology [26,27]. There is no report on RCAbased colorimetric aptasensor for Hg2þ detection. Therefore, in this work, we employed aptamers as recognition elements and RCA as a signal amplification platform for sensitive quantitative detection of Hg2þ. Aptamer specific to Hg2þ was immobilized onto the microplate and hybridized with bio-cDNA1primer (cDNA1), which was applied to RCA reaction. The introduction of RCA was expected to enhance the conjugated amount of HRP through specific binding between the bio-cDNA2 which was complementary with the RCA products and avi-HRP. In the addition of TMB-H2O2, HRP was catalyzed and generated an optical signal. When Hg2þ was introduced, a rigid hairpin-shaped structure of THg2þ-T was formed due to the recognition of aptamers and target, leading to the release of HRP cluster and the decrease of the optical signal. Our results showed that the LOD of this system was 1.6 nM enhanced by up to 18 times compared with detections without RCA strategy. 2. Materials and methods 2.1. Reagents and materials Avidin, streptavidin-conjugated horseradish peroxidase (aviHRP), and 3,3,5,5-tetramethylbenzidine TMB-H2O2 were obtained from Sigma-Aldrich (U.S.A.). T4 DNA Ligase (5 U/mL) and buffer, phi29 DNA polymerase (10 U/mL) and 10 phi29 DNA polymerase buffer, and dNTP mixture (each 25 mM) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Mercuric chloride and other reagents were of analytical grade and were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Ultrapure water processed by a Milli-Qsystem (Millipore, Bedford, USA) was used in all aqueous solutions. The DNA strands were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China). According to the previous report [28,29], the Hg2þ aptamer and the related sequences were designed and shown in Table 1. The 5’end of the circular DNA template was phosphorylated to form an open loop.
Table 1 Sequences of sensing probes used in this study. Probes
Sequences (50 e30 )
Aptamer Aptamer complementary-primer (cDNA1) Circular template
TTCTTTCTTCCCCTTGTTTGTT-bio AAGAAAGAATTTTTTTGTCCGTGC TAGAAGGAAACAGTTAC p-TAGCACGGACATATATGATGGT ACCGCAGTATGAGTATCTCCTATC ACTACTAAGTGGAAGAAAT GTAACTGTTTCCTTC bio-GTTTCCTTCTAGCAC
Signal probe (cDNA2)
The italic and bold portion of aptamer complementary-primer was complementary to the sequences respectively italic in the circular template. The signal probe was identical to the underlined portion of circular template. 2.2. Equipment UVeVis spectra and absorbance were determined by a UV-1800 spectrophotometer (Shimadzu Co., Kyoto, Japan) and SpectraMax M5 (Molecular Devices Co., U.S.A.). Inductively Coupled PlasmaMass Spectrometry (ICP-MS) NexION 350 (PerkinElmer, U.S.A.) was used for the detection of Hg2þ in real samples. 2.3. Assay procedure 2.3.1. Immobilization of capturing aptamers The microplates were coated with 50 mL/well of avidin at the concentration of 25 mg/mL in coating buffer (15 mM Na2CO3 and 35 mM NaHCO3, pH 9.6) at 4 C overnight. Then the wells were washed three times with phosphate-buffered saline (PBS) buffer (10 mM, pH 7.4) containing 0.05% Tween 20 (PBST). Subsequently, biotin modified aptamer (100 nM/well) were added to the wells at 37 C for 1 h and washed three times with PBST. The wells were then blocked with 2% BSA in PBS buffer (10 mM, pH 7.4) at 37 C for 2 h and washed three times with PBST. 2.3.2. Optimization of experimental conditions Aptamer concentration: 100 mL of a series of aptamer concentration (25, 50, 75, 100, 150, 200, and 250 nM) were added to the avidin coated wells and measured the initial absorbance intensity at 260 nm (A0). After incubating at 37 C for 1 h, the solution was removed to other wells to measure the supernatant absorbance intensity at 260 nm (A). The effects of aptamer conditions were evaluated by measuring the change of (A0-A)260. cDNA1 concentration: The aptamer concentration was set at 100 nM. Then, 100 mL of cDNA1 (set at 25, 50, 75, 100, 150, 200, and 250 nM) in STE buffer (10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA) were added to the plate and measured the initial absorbance intensity at 260 nm (A0). After hybridizing for 1 h at 37 C, the solution was removed to other wells to measure the supernatant absorbance intensity at 260 nm (A). The effects of cDNA1 conditions were evaluated by measuring the change of (A0-A)260. Signal probe (bio-cDNA2) concentration: After the RCA reaction, 100 mL of bio-cDNA2 (0.25, 0.5, 1.0, 1.5, 2.0, 2.5, 5 mM) in STE buffer were added to the plate and hybridized for 1 h at 37 C. Following washed three times with PBST, 100 mL of avi-HRP (diluted with water to the ratio of 1:1000) was added the plate and incubated for 30 min at 37 C. The plates were washed three times with PBST, and TMB-H2O2 (100 mL/well) was added, and the plate was incubated for 10 min, which was followed by the addition of 50 mL of H2SO4 (1 M) in order to stop the reaction. The effects of signal probe concentration were evaluated by measuring the absorbance at 450 nm.
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
3
Fig. 1. Schematic representation of the aptamer-based colorimetric sensor for detection of Hg2þ with rolling circle amplification.
Avi-HRP concentration: After the signal probe hybridizing with RCA products, 100 mL of avi-HRP (diluted with water to the ratio of 1:20,000, 1:15000, 1:10,000, 1:7500, 1:5000, 1:2500, 1:1000) was
added the plate and for 30 min at 37 C, respectively. The following procedures were the same as above mentioned. The effects of aviHRP concentration were evaluated by measuring the absorbance at
Fig. 2. The effects of aptamer concentration (A), cDNA1 concentration (B), signal probe concentration (C), and diluted ratio of avi-HRP (D) on the analytical performance of colorimetric aptasensor.
4
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
450 nm. 2.3.3. Hg2þ detection assay For Hg2þ detection assay, 150 nM/well of cDNA1 in STE buffer was added to the plate and hybridized for 1 h at 37 C. Then, the solutions in the microplate were discarded and washed three times with PBST. Afterwards, bio-cDNA2 (1 mM) was added and incubated for 1 h at 37 C. After washing three times with PBST, 100 mL of aviHRP was added and incubated for 30 min at 37 C. Following washed three times with PBST, 100 mL of PBS buffer containing different Hg2þ concentrations was added to the wells for incubation at 37 C for 1 h. The plates were washed three times with PBST, and (TMB)-H2O2 (100 mL/well) was added, and the plate was incubated for 10 min, which was followed by the addition of 50 mL of H2SO4 (1 M) in order to stop the reaction. The absorbance was measured using a microplate reader at 450 nm. All measurements were performed in triplicate. 2.3.4. Hg2þ detection with signal amplification assay For Hg2þ detection with signal amplification assay, 150 nM/well of cDNA1 in STE buffer was added to the plate and hybridized for 1 h at 37 C. Then, the solutions in the microplate were discarded and washed three times with PBST. Then, rolling circle amplification was performed basically followed our previous studies [30]. Briefly, the ligation reaction was carried out in each well by adding 20 mL of circular template (1 mM), 2.5 mL of T4 DNA ligase (5 U/mL), 2.5 mL of T4 DNA ligase buffer and incubated at 37 C for 1 h. The plates were washed three times with PBST, then, the RCA reaction was carried out in each well by adding 1 mL of phi29 DNA polymerase (10 U/mL), 2.5 mL of 10 phi29 DNA polymerase buffer, 1 mL of dNTP (25 mM), 1 mL of BSA and 19.5 mL of ultrapure water and incubated at 37 C for 2 h. Then, bio-cDNA2 (1 mM) was added to hybridize with RCA product at 37 C for 1 h. Following washed three times with PBST, 100 mL of avi-HRP was added the plate and incubated for 30 min at 37 C. Afterwards, 100 mL of PBS buffer containing different Hg2þ concentrations was added to the wells. After incubation at 37 C for 1 h, the solutions in the microplate were discarded and washed three times with PBST. TMB-H2O2 (100 mL/well) was added, and the plate was incubated for 10 min, which was followed by the addition of 50 mL of H2SO4 (1 M) in order to stop the reaction. The absorbance was measured using a microplate reader at 450 nm. All measurements were performed in triplicate.
structure is formed due to the formation of T-Hg2þ-T complex, which leads to the release of cDNA1 and HRP cluster. The optical signal is decreased accordingly. Moreover, to enhance the sensitivity, a signal amplification technology based rolling circular amplification is employed. The successfully RCA process leads to the formation of long ssDNA chains on the microplate, which creates many hybridized DNA fragments for cDNA2, resulting in an increase of labeled avi-HRP to the duplex. Thus, the amplified optical signal of HRP and TMB-H2O2 can be measured for sensitive detection of Hg2þ. 3.2. Optimization for the assay To achieve an optimal analytical performance of the colorimetric aptasensor for Hg2þ detection, several experimental conditions have been investigated, including the concentration of aptamer, cDNA1, circular template concentration, T4 DNA ligase interaction time, incubation time of Phi29 DNA polymerase, and avi-HRP diluted ratio. The concentration of the aptamer immobilized onto the micro-wells is vital for the capture of Hg2þ to the maximum extent. The effects of aptamer concentration were evaluated by measuring the change of (A0-A)260, where A0 was the initial aptamer solution absorbance intensity at 260 nm, and A was the supernatant solution absorbance intensity at 260 nm. As shown in Fig. 2A, with increasing concentration of the aptamer, (A0-A)260
2.4. Real samples treatment The lake water samples were collected from Tai Lake, China. The water samples were filtered through a 0.22 mm membrane syringe filter and were diluted 10 times with buffer, and then spiked to desired concentrations of Hg2þ (2.5e100 nM). The succeeding detection operation was the same as described above. 3. Results and discussion 3.1. Mechanism of the developed aptasensor Fig. 1 depicts the complete detection process and the sensing principle of this colorimetric aptasensor for the detection of Hg2þ. Firstly, the Hg2þ aptamer is immobilized onto the microplate through the specific reaction between biotin tagged to aptamer and avidin coated onto the microplate. Then, the cDNA1 is added to hybridize with aptamer. The primer linked to cDNA1 is then hybridized with bio-cDNA2. With the addition of avi-HRP, HRP is tagged to the duplex through the avidin/biotin binding. In the absence of target, HRP is catalyzed with the addition of TMB-H2O2, and generated an optical signal. In the presence of Hg2þ, aptamer preferentially bind with the target and a rigid hairpin-shaped
Fig. 3. Agarose gel electrophoresis image for the resulting RCA products. Lane 1: marker (250e15,000 bp), lane 2 and 3: two replicate reactions in the presence of T4 DNA Ligase and polymerase, lane 4 and 5: two replicate reactions in the absence of T4 DNA Ligase and polymerase.
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
5
and obtaining improved results, the optimum aptamer concentration is determined as 100 nM. Similarly, the concentration of cDNA1 was studied in the same way. As shown in Fig. 2B, the maximum (A0-A)260 is found at 150 nM cDNA1 concentration. Therefore, the optimum cDNA1 concentration is chosen at 150 nM in the study. In addition, to achieve high amplification efficiency of RCA, the effects of circular template concentration, T4 DNA ligase, and Phi29 DNA polymerase interaction time were evaluated by measuring the change of the solution absorbance intensity at 450 nm (A450). As shown in Fig. S1A, the absorbance intensity increases with the increasing amount of circular template concentration and reaches a maximum value at 1 mM. Thus, the optimal concentration of circular template is selected at 1 mM. As shown in Fig. S1B and C, the absorbance intensity increases rapidly with the T4 DNA Ligase reaction time and phi29 DNA polymerase reaction time. The maximum absorbance intensity is achieved at 1 h of T4 DNA Ligase reaction and 2 h of DNA polymerase reaction. Further reaction does not increase the absorbance intensity. Thus the optimal reaction time of T4 DNA Ligase is chosen as 1 h and polymerase as 2 h. Under this optimal RCA reaction conditions, the RCA products were analyzed by agarose gel electrophoresis. It is observed that the RCA products in two replicate reactions show extremely low mobility (Fig. 3), which indicates that the products are high molecular weight and can provide enormous signal amplification in the assay. After the amplification products obtained, the concentration of signal probe and avi-HRP were optimized to achieve a sufficient hybridization and labeling. As shown in Fig. 2C and D, the absorbance intensity reaches a maximum when the signal probe concentration is 1 mM and the diluted ratio of avi-HRP is 1:1000. The absorbance intensity does not increase obviously when the signal probe concentration and the diluted ratio of avi-HRP exceeded. Thus, the optimum signal probe concentration is chosen at 1 mM and the diluted ratio of avi-HRP is 1:1000 in the study. 3.3. Analytical performance Under the optimal experimental conditions, a series concentration of Hg2þ was detected using the established assay. According to the detection principle, the absorbance intensity was maximized in the absence of target. With the increase of Hg2þ, the absorbance intensity is gradually decreased both in with RCA and without RCA conditions (Fig. 4A). The color in RCA conditions is obviously darker than that of without RCA conditions visually (Images inset in Fig. 4A).We used the relative absorbance intensity at 450 nm (A0eA)450, where A0 and A represent the absorbance intensities in
Fig. 4. UV/Vis spectrum of different concentration of Hg2þ in aptamer-based colorimetric sensor. Inset images are visual color changes with different concentration of Hg2þ with or without RCA, respectively (A), plot of the relative absorbance intensity (A0eA)450 versus Hg2þ concentration (B), UV/Vis spectrum of the same concentration of Hg2þ in aptamer-based colorimetric sensor with or without RCA (C).
increases and reaches a maximum at 100 nM, then tends to be stable at higher concentration. Therefore, for conserving material
Fig. 5. Change in absorbance intensity (A0eA)450 of the developed sensor with different interferents. The concentration of Hg2þ was 50 nM, while the concentration of the other interferents was 1 mM.
6
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
Table 2 Detection results and recoveries of spiked water samples. Sample
Added (nM)
ICP/MS Mean ± SD (nM) (n ¼ 5)
The present method mean ± SD (nM) (n ¼ 5)
Recovery%
1 2 3 4 5 6
2.5 5 10 25 50 100
2.65 ± 0.12 4.56 ± 0.27 10.14 ± 0.54 27.13 ± 1.18 47.32 ± 1.23 96.72 ± 2.12
2.45 ± 0.20 5.11 ± 0.45 10.32 ± 1.10 24.55 ± 1.77 49.8 ± 2.85 105.74 ± 6.56
98% 102.2% 103.2% 98.2% 99.6% 105.74%
the absence and presence of target analyte, as y-axis, the Hg2þ concentration as x-axis to get linear curve fitting. As presented in Fig. 4B, the (A0eA)450 value is proportional to the concentration of Hg2þ, with a linear range of 2.5e100 nM and a linear correlation coefficient of 0.9971 based on the RCA signal amplification strategy. The detection limit can be as low as 1.6 nM, estimated by the equation LOD ¼ 3SD/slope, where SD represents the standard deviation of blank samples, and the slope was obtained from the calibration curve. However, with no signal amplification strategy, the (A0eA)450 value exhibits a linear relationship with the Hg2þ concentration in the range of 50e300 nM (R ¼ 0.9960). The limit of detection is 28.4 nM. Moreover, as shown in Fig. 4C, the (A0eA)450 value with RCA intensification is much larger than that of without RCA intensification under the same concentration of 50 nM of Hg2þ. The results revealed that use of RCA-based colorimetric aptasensing strategy enabled a high sensitivity and a low detection limit for the detection of Hg2þ. Such a high sensitivity was ascribed to the high quantity HRP labeling based on the rolling circle amplification. Compared with published Hg2þ detection methods, our method exhibits comparable sensitivity to instrumental methods and fluorescence and electrochemical sensors (Table S1). Moreover, due to both the high affinity of the aptamer and the signal amplification strategy of RCA, it demonstrates much improved sensitivity in colorimetric-based sensors. 3.4. Selectively and practical performance of the assay A variety of interfering ions were used to evaluate the specificity of this aptasensor. The absorbance in the presence of Kþ, Ca2þ, Mg2þ, Cd2þ, Pb2þ, Zn2þ, Naþ, and Cu2þ (1 mM), were individually measured under the same condition of Hg2þ (50 nM). As shown in Fig. 5, the (A0eA)450 value increases significantly with the addition of the Hg2þ, while there are no obvious changes in absorbance intensity for these interfering ions, respectively. It suggests that there is no serious cross reaction and the developed aptasensor has good specificity for the detection of Hg2þ. To further investigate the applicability of this system in practical sample analysis, we evaluated its accuracy using lake water (collected from Tai Lake, China) spiked with Hg2þ. There was no Hg2þ detected in samples. The accuracy of the established assay was evaluated by the comparison with ICP-MS. As shown in Table 2, the results obtained by our developed method are consistent with the results obtained by the ICP-MS. The recoveries are in the range of 98e105.74%. These results indicate that the fabricated aptasensor has great potential for Hg2þ detection in the real samples. 4. Conclusion In this study, a high sensitive colorimetric detection strategy based on aptamer as a recognition element and RCA as a signal intensification strategy was developed for Hg2þ detection. The aptamer has high affinity (low detection limit) and high specificity (low interference) to Hg2þ. The introduction of RCA was expected to
enhance the conjugated amount of HRP through specific binding between the bio-cDNA2 which was complementary with the RCA products and avi-HRP. Our results showed that the LOD of this system was 1.6 nM with excellent specificity, and that the detection signals were enhanced by up to 18 times under RCA conditions when compared with detections without RCA. In terms of these advantages, it can be expected that the enhancement of HRP labeling based on RCA signal amplification strategy may offer a new direction in the development of high performance colorimetric aptasensors for sensitive and selective detection of a wide range of analytes. Although RCA is good strategy for signal amplification, the operation time for RCA is relative long. It is necessary for us to further investigate the RCA reaction system and conditions to improve the amplification efficiency and reduce the reaction time in the future. Acknowledgement This work was partially supported by Project funded by National Key Research and Development Program of China (2018YFC1602905), China Postdoctoral Science Foundation (2017M610299, 2018T110443), National Natural Science Fund of China (NSFC 31871721, 31772086) and Young Elite Scientists Sponsorship Program by CAST (2017QNRC001). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.saa.2019.117387. References rea, E. McSorley, M. Sakamoto, H.M. Chan, [1] E. Ha, N. Basu, S. B-O'Reilly, J.G. Do Current progress on understanding the impact of mercury on human health, Environ. Res. 152 (2017) 419e433. [2] K.H. Kim, E. Kabir, S.A. Jahan, A review on the distribution of Hg in the environment and its human health impacts, J. Hazard. Mater. 306 (2016) 376e385. [3] WHO, Guidelines for drinking-water quality. http://www.who.int/water_ sanita-tion_health/water-quality/guidelines/en/2008. [4] N. Aozadeh, M.Y. Memar, S.R. Moaddab, H.S. Kafil, Aptamer-assisted novel technologies for detecting bacterial pathogens, Biomed. Pharmacother. 93 (2017) 737e745. [5] A.D. Ellington, J.W. Szostak, In vitro selection of RNA that bind specific ligands, Nature 346 (1990) 818e822. [6] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505e510. [7] S.M. Nimjee, C.P. Rusconi, B.A. Sullenger, Aptamers: an emerging class of therapeutics, Annu. Rev. Med. 56 (2005) 555e583. [8] X.L. Song, B.C. Fu, Y.F. Lan, Y.X. Chen, Y.L. Wei, C. Dong, Label-free fluorescent aptasensor berberine-based strategy for ultrasensitive detection of Hg2þ ion, Spectrochim. Acta A 204 (2018) 301e307. [9] D.D. Tan, Y. He, X.J. Xing, Y. Zhao, H.W. Tang, D.W. Pang, Aptamer functionalized gold nanoparticles based fluorescent probe for the detection of mercury (II) ion in aqueous solution, Talanta 113 (2013) 26e30. [10] L. Li, B.X. Li, Y.Y. Qi, Y. Jin, Label-free aptamer-based colorimetric detection of mercury ions in aqueous media using unmodified gold nanoparticles as colorimetric probe, Anal. Bioanal. Chem. 393 (2009) 2051e2057. [11] Y. Zang, J.P. Lei, Q. Hao, H.X. Ju, “Signal-On” photoelectrochemical sensing strategy based on target-dependent aptamer conformational conversion for selective detection of lead(II) ion, ACS Appl. Mater. Interfaces 6 (2014) 15991e15997. [12] L.L. Tan, Y.M. Zhang, H. Qiang, Y.H. Li, J.Y. Sun, L.Y. Hu, Z.B. Chen, A sensitive Hg (II) colorimetric sensor based on synergistic catalytic effect of gold nanoparticles and Hg, Sensors Actuators B Chem. 229 (2016) 686e691. [13] F.Y. Wang, J.W. Sun, Y.X. Lu, X.X. Zhang, P.S. Song, Y.Y. Liu, Dispersion-aggregation-dispersion colorimetric detection for mercury ions based on an assembly of gold nanoparticles and carbon nanodots, Analyst 143 (2018) 4741e4746. [14] A.G. Memon, X.H. Zhou, J.C. Liu, R.Y. Wang, L.H. Liu, B.F. Yu, M. He, H.C. Shi, Utilization of unmodified gold nanoparticles for label-free detection of mercury (II): insight into rational design of mercury-specific oligonucleotides, J. Hazard. Mater. 321 (2017) 417e423. [15] F.B. Dean, J.R. Nelson, T.L. Giesler, R.S. Lasken, Rapid amplification of plasmid and phage DNA using phi29 DNA polymerase and multiply-primed rolling
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387 circle amplification, Genome Res. 11 (2001) 1095e1099. [16] J. Baner, M. Nilsson, M. Mendel-Hartvig, U. Landegren, Signal amplification of padlock probes by rolling circle replication, Nucleic Acids Res. 26 (1998) 5073e5078. [17] B. Schweitzer, S. Roberts, B. Grimwade, W.P. Shao, M.J. Wang, Q. Fu, Q.P. Shu, I. Laroche, Z.M. Zhou, V.T. Tchernev, Multiplexed protein profiling on microarrays by rolling-circle amplification, Nat. Biotechnol. 20 (2002) 359e365. [18] Y.Q. Cheng, X. Zhang, Z.P. Li, X.X. Jiao, Y.C. Wang, Y.L. Zhang, Highly sensitive determination of microRNA using target-primed and branched rolling-circle amplification, Angew. Chem. Int. Ed. 48 (2009) 3268e3272. [19] W. Xu, X.J. Xie, D.W. Li, Z.Q. Yang, T.H. Li, X.G. Liu, Ultrasensitive colorimetric DNA detection using a combination of rolling circle amplification and nicking endonuclease-assisted nanoparticle amplification (NEANA), Small 8 (2012) 1846e1850. [20] X.H. Pan, A.E. Urban, D. Palejev, V. Schulz, F. Grubert, Y.P. Hu, M. Snyder, S.M. Weissman, A procedure for highly specific, sensitive, and unbiased whole-genome amplification, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 15499e15504. [21] J.L. Zhong, X.H. Zhao, Isothermal amplification technologies for the detection of foodborne pathogens, Food Anal. Methods 11 (2018) 1543e1560. [22] Z.Y. Wang, Q. Yang, Y.Z. Zhang, Z.X. Meng, X.Y. Ma, W. Zhang, Saltatory rolling circle amplification (SRCA): a novel nucleic acid isothermal amplification technique applied for rapid detection of Shigella Spp. in vegetable salad, Food Anal. Methods 11 (2018) 504e513.
7
[23] Y.Q. Jiang, S. Zou, X.D. Cao, A simple dendrimer-aptamer based microfluidic platform for E. coli O 157:H7 detection and signal intensification by rolling circle amplication, Sensors Actuators B Chem. 251 (2017) 976e984. [24] J. Shen, H.Y. Wang, C.X. Li, Y.Y. Zhao, X.J. Yu, X.L. Luo, Label-free electrochemical aptasensor for adenosine detection based on cascade signal amplification strategy, Biosens. Bioelectron. 90 (2017) 356e362. [25] K. Liang, S.T. Zhai, Z.D. Zhang, X.Y. Fu, J.W. Shao, Z.Y. Lin, B. Qiu, G.N. Chen, Ultrasensitive colorimetric carcinoembryonic antigen biosensor based on hyperbranched rolling circle amplification, Analyst 139 (2014) 4330e4334. [26] X.M. Zhou, Q. Su, D. Xing, An electrochemiluminescent assay for high sensitive detection of mercury (II) based on isothermal rolling circular amplification, Anal. Chim. Acta 713 (2012) 45e49. [27] J. Zhao, Y.M. Lei, Y.Q. Chai, R. Yuan, Y. Zhuo, Novel electrochemiluminescence of perylene derivative and its application to mercury ion detection based on a dual amplification strategy, Biosens. Bioelectron. 86 (2016) 720e727. [28] L. Zhou, L.J. Ou, X. Chu, G.L. Shen, R.Q. Yu, Aptamer-based rolling circle amplification: a platform for electrochemical detection of protein, Anal. Chem. 79 (2007) 7492e7500. [29] X.N. Zhang, C.Y. Huang, Y.J. Jiang, Y.X. Jiang, J.Z. Shen, E. Han, Structureswitching electrochemical aptasensor for single-step and specific detection of trace mercury in dairy products, J. Agric. Food Chem. 66 (2018) 10106e10112. [30] H.J. Gu, L.L. Hao, N. Duan, S.J. Wu, Y. Xia, X.Y. Ma, Z.P. Wang, A competitive fluorescent aptasensor for okadaic acid detection assisted by rolling circle amplification, Microchim. Acta 184 (2017) 2893e2899.
Contents lists available at ScienceDirect
Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy journal homepage: www.elsevier.com/locate/saa
Colorimetric aptasensor for the detection of mercury based on signal intensification by rolling circle amplification Shijia Wu a, b, c, Qianru Yu b, Chuxian He b, Nuo Duan a, b, c, * a
State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, China School of Food Science and Technology, Jiangnan University, Wuxi 214122, China c International Joint Laboratory on Food Safety, Jiangnan University, Wuxi 214122, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 May 2019 Received in revised form 7 July 2019 Accepted 13 July 2019 Available online 20 July 2019
Techniques that are sensitive to detect mercury ion (Hg2þ) are very important, due to its serious threat to public health and food security. In this work, a colorimetric aptasensor was fabricated for the detection of Hg2þ based on rolling circle amplification (RCA). The aptamer was immobilized onto the microplate and hybridized with its complementary strand (cDNA1) which linked with a primer for triggering the RCA reaction of circular template. The successfully RCA process led to the formation of long ssDNA chains on the microplate, which created many hybridized DNA fragments for bio-cDNA2. The tagged amount of horseradish peroxidase (HRP) was enhanced through the avidin/biotin binding between avi-HRP and bio-cDNA2. In the addition of TMB-H2O2, HRP was catalyzed and generated an optical signal. However, in the presence of target, Hg2þ specifically and preferentially bound with aptamer and formed a strong and stable T-Hg2þ-T complex, which led to the release of cDNA1 and HRP cluster. Consequently, the optical signal decreased. Our results showed that the limit of detection (LOD) of this system was 1.6 nM with excellent specificity, and that the detection signals were enhanced by up to 18 times under RCA conditions when compared with detections without RCA. This method has been successfully used to detect Hg2þ in water samples with a recovery of 98%e105.74%. © 2019 Elsevier B.V. All rights reserved.
Keywords: Aptamer Hg2þ Colorimetric RCA Signal amplification Water
1. Introduction The pollution of heavy metals has become a worldwide agricultural eco-environment problem, posing a serious threat to modern agriculture, ecological safety, and especially to food security. Some of the heavy metals, such as cadmium (Cd), lead (Pb), mercury (Hg), and arsenic (As) are considered to be highly toxic and hazardous to human health even at trace levels. They may enter soils and groundwater and bio-accumulate in both animals and plants, then, enter the human body through food chain. Among the heavy metal ions, mercury ions (Hg2þ) are strongly toxic and widespread in the environment. Upon exposure, Hg2þ can cause a variety of adverse health effects, such as brain damage, kidney failure, immune system disruption, muscle weakness and paralysis of the limbs [1,2]. The maximum residue limit of total Hg is 0.02 mg/ kg in cereals and derived products as stipulated by the People's
* Corresponding author at: State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, China, School of Food Science and Technology, Jiangnan University, Wuxi 214122, China, International Joint Laboratory on Food Safety, Jiangnan University, Wuxi 214122, China. E-mail address: [email protected] (N. Duan). https://doi.org/10.1016/j.saa.2019.117387 1386-1425/© 2019 Elsevier B.V. All rights reserved.
Republic of China Standard (GB 2762-2017). The World Health Organization (WHO) permits the maximum mercury level of 6 ppb in drinking water [3]. This leads to the requirement of fast, accurate and reliable techniques for the detection of heavy metal ions. Aptamers are single-stranded oligonucleotides that can bind with high affinity and specificity to target molecules similar to antigeneantibody interactions [4]. They are selected in vitro using a method known as the systematic evolution of ligands by exponential enrichment (SELEX) [5,6]. Compared with antibodies, aptamers hold significant advantages such as better stability, great reproducibility, flexible labeling, and easy storage [7]. Especially, the aptamers are easily synthesized in vitro, their production eliminates the use of animals and allows for the selection of aptamers against poor immunogenic molecules. Heavy metal ions have no immunogenicity, which makes it very difficult to prepare monoclonal antibodies. The emergence of aptamer has benefited the detection of heavy metal ions. Since Hg2þ can selectively bind between two DNA thymine (T) bases and promote T-T mismatches to form stable T-Hg2þ-T base pairs, aptamer-based biosensors for the detection of Hg2þ has been extensively studied, including fluorescent sensors [8,9], colorimetric sensors [10], and electrochemical sensors [11]. Among these techniques, colorimetry has
2
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
attracted much attention owing to their conveniences of visual observation and simple operations. In recent years, a variety of colorimetric biosensors based on gold nanoparticles (AuNPs) have been developed for the selective detection of Hg2þ [12e14]. The quantification principle is associated with AuNPs aggregation that is AuNPs can be aggregated to induce the red shift of the surface plasmon resonance depending on the aggregation degree. However, the red shift is too slight to be distinguished in low concentration of target, which limits the sensitivity of colorimetry. To improve the sensitivity of the detection methods, rolling circle amplification (RCA) strategy can be adopted for signal amplification. RCA is an isothermal amplification technology involving numerous copies of the complementary sequence toward original circular template with tandem periodic oligonucleotides to produce a long ssDNA [15]. Since it was first established and applied for signal amplification by Landegren et al. in 1998 [16], it has been widely used in biomedical field, such as protein profiling [17], microRNA and DNA detection [18,19] whole-genome analysis [20], and foodborne pathogens detection [21,22] due to its simplicity, specificity, and sensitivity. Moreover, many highly sensitive and selective sensors have been developed by constituting the aptamer (high affinity target recognition) with RCA (signal amplification). Jiang et al. have constructed an aptamer-based RCA platform for fluorescent detection of pathogenic bacteria [23]. Shen et al. developed an electrochemical aptasensor for adenosine detection based on RCA strategy with a detection limit as low as 0.032 nM [24]. In addition, Liang et al. established a RCA-based colorimetric aptasensor for carcinoembryonic antigen (CEA) detection and the detection limit is 2 pM [25]. Up to date, the RCA-based aptasensors for Hg2þ detection have been focused on combining with electrochemiluminescence technology [26,27]. There is no report on RCAbased colorimetric aptasensor for Hg2þ detection. Therefore, in this work, we employed aptamers as recognition elements and RCA as a signal amplification platform for sensitive quantitative detection of Hg2þ. Aptamer specific to Hg2þ was immobilized onto the microplate and hybridized with bio-cDNA1primer (cDNA1), which was applied to RCA reaction. The introduction of RCA was expected to enhance the conjugated amount of HRP through specific binding between the bio-cDNA2 which was complementary with the RCA products and avi-HRP. In the addition of TMB-H2O2, HRP was catalyzed and generated an optical signal. When Hg2þ was introduced, a rigid hairpin-shaped structure of THg2þ-T was formed due to the recognition of aptamers and target, leading to the release of HRP cluster and the decrease of the optical signal. Our results showed that the LOD of this system was 1.6 nM enhanced by up to 18 times compared with detections without RCA strategy. 2. Materials and methods 2.1. Reagents and materials Avidin, streptavidin-conjugated horseradish peroxidase (aviHRP), and 3,3,5,5-tetramethylbenzidine TMB-H2O2 were obtained from Sigma-Aldrich (U.S.A.). T4 DNA Ligase (5 U/mL) and buffer, phi29 DNA polymerase (10 U/mL) and 10 phi29 DNA polymerase buffer, and dNTP mixture (each 25 mM) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Mercuric chloride and other reagents were of analytical grade and were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Ultrapure water processed by a Milli-Qsystem (Millipore, Bedford, USA) was used in all aqueous solutions. The DNA strands were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China). According to the previous report [28,29], the Hg2þ aptamer and the related sequences were designed and shown in Table 1. The 5’end of the circular DNA template was phosphorylated to form an open loop.
Table 1 Sequences of sensing probes used in this study. Probes
Sequences (50 e30 )
Aptamer Aptamer complementary-primer (cDNA1) Circular template
TTCTTTCTTCCCCTTGTTTGTT-bio AAGAAAGAATTTTTTTGTCCGTGC TAGAAGGAAACAGTTAC p-TAGCACGGACATATATGATGGT ACCGCAGTATGAGTATCTCCTATC ACTACTAAGTGGAAGAAAT GTAACTGTTTCCTTC bio-GTTTCCTTCTAGCAC
Signal probe (cDNA2)
The italic and bold portion of aptamer complementary-primer was complementary to the sequences respectively italic in the circular template. The signal probe was identical to the underlined portion of circular template. 2.2. Equipment UVeVis spectra and absorbance were determined by a UV-1800 spectrophotometer (Shimadzu Co., Kyoto, Japan) and SpectraMax M5 (Molecular Devices Co., U.S.A.). Inductively Coupled PlasmaMass Spectrometry (ICP-MS) NexION 350 (PerkinElmer, U.S.A.) was used for the detection of Hg2þ in real samples. 2.3. Assay procedure 2.3.1. Immobilization of capturing aptamers The microplates were coated with 50 mL/well of avidin at the concentration of 25 mg/mL in coating buffer (15 mM Na2CO3 and 35 mM NaHCO3, pH 9.6) at 4 C overnight. Then the wells were washed three times with phosphate-buffered saline (PBS) buffer (10 mM, pH 7.4) containing 0.05% Tween 20 (PBST). Subsequently, biotin modified aptamer (100 nM/well) were added to the wells at 37 C for 1 h and washed three times with PBST. The wells were then blocked with 2% BSA in PBS buffer (10 mM, pH 7.4) at 37 C for 2 h and washed three times with PBST. 2.3.2. Optimization of experimental conditions Aptamer concentration: 100 mL of a series of aptamer concentration (25, 50, 75, 100, 150, 200, and 250 nM) were added to the avidin coated wells and measured the initial absorbance intensity at 260 nm (A0). After incubating at 37 C for 1 h, the solution was removed to other wells to measure the supernatant absorbance intensity at 260 nm (A). The effects of aptamer conditions were evaluated by measuring the change of (A0-A)260. cDNA1 concentration: The aptamer concentration was set at 100 nM. Then, 100 mL of cDNA1 (set at 25, 50, 75, 100, 150, 200, and 250 nM) in STE buffer (10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA) were added to the plate and measured the initial absorbance intensity at 260 nm (A0). After hybridizing for 1 h at 37 C, the solution was removed to other wells to measure the supernatant absorbance intensity at 260 nm (A). The effects of cDNA1 conditions were evaluated by measuring the change of (A0-A)260. Signal probe (bio-cDNA2) concentration: After the RCA reaction, 100 mL of bio-cDNA2 (0.25, 0.5, 1.0, 1.5, 2.0, 2.5, 5 mM) in STE buffer were added to the plate and hybridized for 1 h at 37 C. Following washed three times with PBST, 100 mL of avi-HRP (diluted with water to the ratio of 1:1000) was added the plate and incubated for 30 min at 37 C. The plates were washed three times with PBST, and TMB-H2O2 (100 mL/well) was added, and the plate was incubated for 10 min, which was followed by the addition of 50 mL of H2SO4 (1 M) in order to stop the reaction. The effects of signal probe concentration were evaluated by measuring the absorbance at 450 nm.
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
3
Fig. 1. Schematic representation of the aptamer-based colorimetric sensor for detection of Hg2þ with rolling circle amplification.
Avi-HRP concentration: After the signal probe hybridizing with RCA products, 100 mL of avi-HRP (diluted with water to the ratio of 1:20,000, 1:15000, 1:10,000, 1:7500, 1:5000, 1:2500, 1:1000) was
added the plate and for 30 min at 37 C, respectively. The following procedures were the same as above mentioned. The effects of aviHRP concentration were evaluated by measuring the absorbance at
Fig. 2. The effects of aptamer concentration (A), cDNA1 concentration (B), signal probe concentration (C), and diluted ratio of avi-HRP (D) on the analytical performance of colorimetric aptasensor.
4
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
450 nm. 2.3.3. Hg2þ detection assay For Hg2þ detection assay, 150 nM/well of cDNA1 in STE buffer was added to the plate and hybridized for 1 h at 37 C. Then, the solutions in the microplate were discarded and washed three times with PBST. Afterwards, bio-cDNA2 (1 mM) was added and incubated for 1 h at 37 C. After washing three times with PBST, 100 mL of aviHRP was added and incubated for 30 min at 37 C. Following washed three times with PBST, 100 mL of PBS buffer containing different Hg2þ concentrations was added to the wells for incubation at 37 C for 1 h. The plates were washed three times with PBST, and (TMB)-H2O2 (100 mL/well) was added, and the plate was incubated for 10 min, which was followed by the addition of 50 mL of H2SO4 (1 M) in order to stop the reaction. The absorbance was measured using a microplate reader at 450 nm. All measurements were performed in triplicate. 2.3.4. Hg2þ detection with signal amplification assay For Hg2þ detection with signal amplification assay, 150 nM/well of cDNA1 in STE buffer was added to the plate and hybridized for 1 h at 37 C. Then, the solutions in the microplate were discarded and washed three times with PBST. Then, rolling circle amplification was performed basically followed our previous studies [30]. Briefly, the ligation reaction was carried out in each well by adding 20 mL of circular template (1 mM), 2.5 mL of T4 DNA ligase (5 U/mL), 2.5 mL of T4 DNA ligase buffer and incubated at 37 C for 1 h. The plates were washed three times with PBST, then, the RCA reaction was carried out in each well by adding 1 mL of phi29 DNA polymerase (10 U/mL), 2.5 mL of 10 phi29 DNA polymerase buffer, 1 mL of dNTP (25 mM), 1 mL of BSA and 19.5 mL of ultrapure water and incubated at 37 C for 2 h. Then, bio-cDNA2 (1 mM) was added to hybridize with RCA product at 37 C for 1 h. Following washed three times with PBST, 100 mL of avi-HRP was added the plate and incubated for 30 min at 37 C. Afterwards, 100 mL of PBS buffer containing different Hg2þ concentrations was added to the wells. After incubation at 37 C for 1 h, the solutions in the microplate were discarded and washed three times with PBST. TMB-H2O2 (100 mL/well) was added, and the plate was incubated for 10 min, which was followed by the addition of 50 mL of H2SO4 (1 M) in order to stop the reaction. The absorbance was measured using a microplate reader at 450 nm. All measurements were performed in triplicate.
structure is formed due to the formation of T-Hg2þ-T complex, which leads to the release of cDNA1 and HRP cluster. The optical signal is decreased accordingly. Moreover, to enhance the sensitivity, a signal amplification technology based rolling circular amplification is employed. The successfully RCA process leads to the formation of long ssDNA chains on the microplate, which creates many hybridized DNA fragments for cDNA2, resulting in an increase of labeled avi-HRP to the duplex. Thus, the amplified optical signal of HRP and TMB-H2O2 can be measured for sensitive detection of Hg2þ. 3.2. Optimization for the assay To achieve an optimal analytical performance of the colorimetric aptasensor for Hg2þ detection, several experimental conditions have been investigated, including the concentration of aptamer, cDNA1, circular template concentration, T4 DNA ligase interaction time, incubation time of Phi29 DNA polymerase, and avi-HRP diluted ratio. The concentration of the aptamer immobilized onto the micro-wells is vital for the capture of Hg2þ to the maximum extent. The effects of aptamer concentration were evaluated by measuring the change of (A0-A)260, where A0 was the initial aptamer solution absorbance intensity at 260 nm, and A was the supernatant solution absorbance intensity at 260 nm. As shown in Fig. 2A, with increasing concentration of the aptamer, (A0-A)260
2.4. Real samples treatment The lake water samples were collected from Tai Lake, China. The water samples were filtered through a 0.22 mm membrane syringe filter and were diluted 10 times with buffer, and then spiked to desired concentrations of Hg2þ (2.5e100 nM). The succeeding detection operation was the same as described above. 3. Results and discussion 3.1. Mechanism of the developed aptasensor Fig. 1 depicts the complete detection process and the sensing principle of this colorimetric aptasensor for the detection of Hg2þ. Firstly, the Hg2þ aptamer is immobilized onto the microplate through the specific reaction between biotin tagged to aptamer and avidin coated onto the microplate. Then, the cDNA1 is added to hybridize with aptamer. The primer linked to cDNA1 is then hybridized with bio-cDNA2. With the addition of avi-HRP, HRP is tagged to the duplex through the avidin/biotin binding. In the absence of target, HRP is catalyzed with the addition of TMB-H2O2, and generated an optical signal. In the presence of Hg2þ, aptamer preferentially bind with the target and a rigid hairpin-shaped
Fig. 3. Agarose gel electrophoresis image for the resulting RCA products. Lane 1: marker (250e15,000 bp), lane 2 and 3: two replicate reactions in the presence of T4 DNA Ligase and polymerase, lane 4 and 5: two replicate reactions in the absence of T4 DNA Ligase and polymerase.
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
5
and obtaining improved results, the optimum aptamer concentration is determined as 100 nM. Similarly, the concentration of cDNA1 was studied in the same way. As shown in Fig. 2B, the maximum (A0-A)260 is found at 150 nM cDNA1 concentration. Therefore, the optimum cDNA1 concentration is chosen at 150 nM in the study. In addition, to achieve high amplification efficiency of RCA, the effects of circular template concentration, T4 DNA ligase, and Phi29 DNA polymerase interaction time were evaluated by measuring the change of the solution absorbance intensity at 450 nm (A450). As shown in Fig. S1A, the absorbance intensity increases with the increasing amount of circular template concentration and reaches a maximum value at 1 mM. Thus, the optimal concentration of circular template is selected at 1 mM. As shown in Fig. S1B and C, the absorbance intensity increases rapidly with the T4 DNA Ligase reaction time and phi29 DNA polymerase reaction time. The maximum absorbance intensity is achieved at 1 h of T4 DNA Ligase reaction and 2 h of DNA polymerase reaction. Further reaction does not increase the absorbance intensity. Thus the optimal reaction time of T4 DNA Ligase is chosen as 1 h and polymerase as 2 h. Under this optimal RCA reaction conditions, the RCA products were analyzed by agarose gel electrophoresis. It is observed that the RCA products in two replicate reactions show extremely low mobility (Fig. 3), which indicates that the products are high molecular weight and can provide enormous signal amplification in the assay. After the amplification products obtained, the concentration of signal probe and avi-HRP were optimized to achieve a sufficient hybridization and labeling. As shown in Fig. 2C and D, the absorbance intensity reaches a maximum when the signal probe concentration is 1 mM and the diluted ratio of avi-HRP is 1:1000. The absorbance intensity does not increase obviously when the signal probe concentration and the diluted ratio of avi-HRP exceeded. Thus, the optimum signal probe concentration is chosen at 1 mM and the diluted ratio of avi-HRP is 1:1000 in the study. 3.3. Analytical performance Under the optimal experimental conditions, a series concentration of Hg2þ was detected using the established assay. According to the detection principle, the absorbance intensity was maximized in the absence of target. With the increase of Hg2þ, the absorbance intensity is gradually decreased both in with RCA and without RCA conditions (Fig. 4A). The color in RCA conditions is obviously darker than that of without RCA conditions visually (Images inset in Fig. 4A).We used the relative absorbance intensity at 450 nm (A0eA)450, where A0 and A represent the absorbance intensities in
Fig. 4. UV/Vis spectrum of different concentration of Hg2þ in aptamer-based colorimetric sensor. Inset images are visual color changes with different concentration of Hg2þ with or without RCA, respectively (A), plot of the relative absorbance intensity (A0eA)450 versus Hg2þ concentration (B), UV/Vis spectrum of the same concentration of Hg2þ in aptamer-based colorimetric sensor with or without RCA (C).
increases and reaches a maximum at 100 nM, then tends to be stable at higher concentration. Therefore, for conserving material
Fig. 5. Change in absorbance intensity (A0eA)450 of the developed sensor with different interferents. The concentration of Hg2þ was 50 nM, while the concentration of the other interferents was 1 mM.
6
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387
Table 2 Detection results and recoveries of spiked water samples. Sample
Added (nM)
ICP/MS Mean ± SD (nM) (n ¼ 5)
The present method mean ± SD (nM) (n ¼ 5)
Recovery%
1 2 3 4 5 6
2.5 5 10 25 50 100
2.65 ± 0.12 4.56 ± 0.27 10.14 ± 0.54 27.13 ± 1.18 47.32 ± 1.23 96.72 ± 2.12
2.45 ± 0.20 5.11 ± 0.45 10.32 ± 1.10 24.55 ± 1.77 49.8 ± 2.85 105.74 ± 6.56
98% 102.2% 103.2% 98.2% 99.6% 105.74%
the absence and presence of target analyte, as y-axis, the Hg2þ concentration as x-axis to get linear curve fitting. As presented in Fig. 4B, the (A0eA)450 value is proportional to the concentration of Hg2þ, with a linear range of 2.5e100 nM and a linear correlation coefficient of 0.9971 based on the RCA signal amplification strategy. The detection limit can be as low as 1.6 nM, estimated by the equation LOD ¼ 3SD/slope, where SD represents the standard deviation of blank samples, and the slope was obtained from the calibration curve. However, with no signal amplification strategy, the (A0eA)450 value exhibits a linear relationship with the Hg2þ concentration in the range of 50e300 nM (R ¼ 0.9960). The limit of detection is 28.4 nM. Moreover, as shown in Fig. 4C, the (A0eA)450 value with RCA intensification is much larger than that of without RCA intensification under the same concentration of 50 nM of Hg2þ. The results revealed that use of RCA-based colorimetric aptasensing strategy enabled a high sensitivity and a low detection limit for the detection of Hg2þ. Such a high sensitivity was ascribed to the high quantity HRP labeling based on the rolling circle amplification. Compared with published Hg2þ detection methods, our method exhibits comparable sensitivity to instrumental methods and fluorescence and electrochemical sensors (Table S1). Moreover, due to both the high affinity of the aptamer and the signal amplification strategy of RCA, it demonstrates much improved sensitivity in colorimetric-based sensors. 3.4. Selectively and practical performance of the assay A variety of interfering ions were used to evaluate the specificity of this aptasensor. The absorbance in the presence of Kþ, Ca2þ, Mg2þ, Cd2þ, Pb2þ, Zn2þ, Naþ, and Cu2þ (1 mM), were individually measured under the same condition of Hg2þ (50 nM). As shown in Fig. 5, the (A0eA)450 value increases significantly with the addition of the Hg2þ, while there are no obvious changes in absorbance intensity for these interfering ions, respectively. It suggests that there is no serious cross reaction and the developed aptasensor has good specificity for the detection of Hg2þ. To further investigate the applicability of this system in practical sample analysis, we evaluated its accuracy using lake water (collected from Tai Lake, China) spiked with Hg2þ. There was no Hg2þ detected in samples. The accuracy of the established assay was evaluated by the comparison with ICP-MS. As shown in Table 2, the results obtained by our developed method are consistent with the results obtained by the ICP-MS. The recoveries are in the range of 98e105.74%. These results indicate that the fabricated aptasensor has great potential for Hg2þ detection in the real samples. 4. Conclusion In this study, a high sensitive colorimetric detection strategy based on aptamer as a recognition element and RCA as a signal intensification strategy was developed for Hg2þ detection. The aptamer has high affinity (low detection limit) and high specificity (low interference) to Hg2þ. The introduction of RCA was expected to
enhance the conjugated amount of HRP through specific binding between the bio-cDNA2 which was complementary with the RCA products and avi-HRP. Our results showed that the LOD of this system was 1.6 nM with excellent specificity, and that the detection signals were enhanced by up to 18 times under RCA conditions when compared with detections without RCA. In terms of these advantages, it can be expected that the enhancement of HRP labeling based on RCA signal amplification strategy may offer a new direction in the development of high performance colorimetric aptasensors for sensitive and selective detection of a wide range of analytes. Although RCA is good strategy for signal amplification, the operation time for RCA is relative long. It is necessary for us to further investigate the RCA reaction system and conditions to improve the amplification efficiency and reduce the reaction time in the future. Acknowledgement This work was partially supported by Project funded by National Key Research and Development Program of China (2018YFC1602905), China Postdoctoral Science Foundation (2017M610299, 2018T110443), National Natural Science Fund of China (NSFC 31871721, 31772086) and Young Elite Scientists Sponsorship Program by CAST (2017QNRC001). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.saa.2019.117387. References rea, E. McSorley, M. Sakamoto, H.M. Chan, [1] E. Ha, N. Basu, S. B-O'Reilly, J.G. Do Current progress on understanding the impact of mercury on human health, Environ. Res. 152 (2017) 419e433. [2] K.H. Kim, E. Kabir, S.A. Jahan, A review on the distribution of Hg in the environment and its human health impacts, J. Hazard. Mater. 306 (2016) 376e385. [3] WHO, Guidelines for drinking-water quality. http://www.who.int/water_ sanita-tion_health/water-quality/guidelines/en/2008. [4] N. Aozadeh, M.Y. Memar, S.R. Moaddab, H.S. Kafil, Aptamer-assisted novel technologies for detecting bacterial pathogens, Biomed. Pharmacother. 93 (2017) 737e745. [5] A.D. Ellington, J.W. Szostak, In vitro selection of RNA that bind specific ligands, Nature 346 (1990) 818e822. [6] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505e510. [7] S.M. Nimjee, C.P. Rusconi, B.A. Sullenger, Aptamers: an emerging class of therapeutics, Annu. Rev. Med. 56 (2005) 555e583. [8] X.L. Song, B.C. Fu, Y.F. Lan, Y.X. Chen, Y.L. Wei, C. Dong, Label-free fluorescent aptasensor berberine-based strategy for ultrasensitive detection of Hg2þ ion, Spectrochim. Acta A 204 (2018) 301e307. [9] D.D. Tan, Y. He, X.J. Xing, Y. Zhao, H.W. Tang, D.W. Pang, Aptamer functionalized gold nanoparticles based fluorescent probe for the detection of mercury (II) ion in aqueous solution, Talanta 113 (2013) 26e30. [10] L. Li, B.X. Li, Y.Y. Qi, Y. Jin, Label-free aptamer-based colorimetric detection of mercury ions in aqueous media using unmodified gold nanoparticles as colorimetric probe, Anal. Bioanal. Chem. 393 (2009) 2051e2057. [11] Y. Zang, J.P. Lei, Q. Hao, H.X. Ju, “Signal-On” photoelectrochemical sensing strategy based on target-dependent aptamer conformational conversion for selective detection of lead(II) ion, ACS Appl. Mater. Interfaces 6 (2014) 15991e15997. [12] L.L. Tan, Y.M. Zhang, H. Qiang, Y.H. Li, J.Y. Sun, L.Y. Hu, Z.B. Chen, A sensitive Hg (II) colorimetric sensor based on synergistic catalytic effect of gold nanoparticles and Hg, Sensors Actuators B Chem. 229 (2016) 686e691. [13] F.Y. Wang, J.W. Sun, Y.X. Lu, X.X. Zhang, P.S. Song, Y.Y. Liu, Dispersion-aggregation-dispersion colorimetric detection for mercury ions based on an assembly of gold nanoparticles and carbon nanodots, Analyst 143 (2018) 4741e4746. [14] A.G. Memon, X.H. Zhou, J.C. Liu, R.Y. Wang, L.H. Liu, B.F. Yu, M. He, H.C. Shi, Utilization of unmodified gold nanoparticles for label-free detection of mercury (II): insight into rational design of mercury-specific oligonucleotides, J. Hazard. Mater. 321 (2017) 417e423. [15] F.B. Dean, J.R. Nelson, T.L. Giesler, R.S. Lasken, Rapid amplification of plasmid and phage DNA using phi29 DNA polymerase and multiply-primed rolling
S. Wu et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 224 (2020) 117387 circle amplification, Genome Res. 11 (2001) 1095e1099. [16] J. Baner, M. Nilsson, M. Mendel-Hartvig, U. Landegren, Signal amplification of padlock probes by rolling circle replication, Nucleic Acids Res. 26 (1998) 5073e5078. [17] B. Schweitzer, S. Roberts, B. Grimwade, W.P. Shao, M.J. Wang, Q. Fu, Q.P. Shu, I. Laroche, Z.M. Zhou, V.T. Tchernev, Multiplexed protein profiling on microarrays by rolling-circle amplification, Nat. Biotechnol. 20 (2002) 359e365. [18] Y.Q. Cheng, X. Zhang, Z.P. Li, X.X. Jiao, Y.C. Wang, Y.L. Zhang, Highly sensitive determination of microRNA using target-primed and branched rolling-circle amplification, Angew. Chem. Int. Ed. 48 (2009) 3268e3272. [19] W. Xu, X.J. Xie, D.W. Li, Z.Q. Yang, T.H. Li, X.G. Liu, Ultrasensitive colorimetric DNA detection using a combination of rolling circle amplification and nicking endonuclease-assisted nanoparticle amplification (NEANA), Small 8 (2012) 1846e1850. [20] X.H. Pan, A.E. Urban, D. Palejev, V. Schulz, F. Grubert, Y.P. Hu, M. Snyder, S.M. Weissman, A procedure for highly specific, sensitive, and unbiased whole-genome amplification, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 15499e15504. [21] J.L. Zhong, X.H. Zhao, Isothermal amplification technologies for the detection of foodborne pathogens, Food Anal. Methods 11 (2018) 1543e1560. [22] Z.Y. Wang, Q. Yang, Y.Z. Zhang, Z.X. Meng, X.Y. Ma, W. Zhang, Saltatory rolling circle amplification (SRCA): a novel nucleic acid isothermal amplification technique applied for rapid detection of Shigella Spp. in vegetable salad, Food Anal. Methods 11 (2018) 504e513.
7
[23] Y.Q. Jiang, S. Zou, X.D. Cao, A simple dendrimer-aptamer based microfluidic platform for E. coli O 157:H7 detection and signal intensification by rolling circle amplication, Sensors Actuators B Chem. 251 (2017) 976e984. [24] J. Shen, H.Y. Wang, C.X. Li, Y.Y. Zhao, X.J. Yu, X.L. Luo, Label-free electrochemical aptasensor for adenosine detection based on cascade signal amplification strategy, Biosens. Bioelectron. 90 (2017) 356e362. [25] K. Liang, S.T. Zhai, Z.D. Zhang, X.Y. Fu, J.W. Shao, Z.Y. Lin, B. Qiu, G.N. Chen, Ultrasensitive colorimetric carcinoembryonic antigen biosensor based on hyperbranched rolling circle amplification, Analyst 139 (2014) 4330e4334. [26] X.M. Zhou, Q. Su, D. Xing, An electrochemiluminescent assay for high sensitive detection of mercury (II) based on isothermal rolling circular amplification, Anal. Chim. Acta 713 (2012) 45e49. [27] J. Zhao, Y.M. Lei, Y.Q. Chai, R. Yuan, Y. Zhuo, Novel electrochemiluminescence of perylene derivative and its application to mercury ion detection based on a dual amplification strategy, Biosens. Bioelectron. 86 (2016) 720e727. [28] L. Zhou, L.J. Ou, X. Chu, G.L. Shen, R.Q. Yu, Aptamer-based rolling circle amplification: a platform for electrochemical detection of protein, Anal. Chem. 79 (2007) 7492e7500. [29] X.N. Zhang, C.Y. Huang, Y.J. Jiang, Y.X. Jiang, J.Z. Shen, E. Han, Structureswitching electrochemical aptasensor for single-step and specific detection of trace mercury in dairy products, J. Agric. Food Chem. 66 (2018) 10106e10112. [30] H.J. Gu, L.L. Hao, N. Duan, S.J. Wu, Y. Xia, X.Y. Ma, Z.P. Wang, A competitive fluorescent aptasensor for okadaic acid detection assisted by rolling circle amplification, Microchim. Acta 184 (2017) 2893e2899.