A complex nucleoprotein structure involved in activation of transcription of two divergent Escherichia coli promoters

J. Mol.

Biol.

(1989)

205.

471-485

A Complex Nucleoprotein Structure Involved in Activation of Transcription of Two Divergent Escherichia coli Promoters Olivier Raibaud, Dominique

Vidal-Ingigliardi

and Evelyne Richet

Unit6 de Gk&tique Molkulaire lnstitut Pasteur 25 rue du Dr Roux 75724 Paris Cedex 15, France (Received

7 July

1988, and in revised form

7 September

1988)

Tnitiation of transcription at rnalEp and malKp, two divergent Escherichia coli promoters, depends on the presence of both CRP, a pleiotropic activator, and MalT, the maltose regulon activator. We carried out in vivo genetic and functional analysis of these promoters and characterized their interaction with MalT and CRP using DNase I footprinting. The functional limits of the promoters are located about 240 base-pairs (bp) upstream of their transcription start sites, which are 271 bp apart. These promoters therefore overlap by about 210 bp. The overlapping region encompasses four CRP-binding sites and at least four MalT-binding sites. Insertions in the centre of this region are tolerated provided that they correspond to an integral number of DNA helix turns. In DNase I footprinting experiments performed on the complex formed by MalT with malEp-malKp, the DNA appears to be wrapped around the protein. We propose a model for the nucleoprotein structure that might be involved in transcription activation at these divergent promoters.

reminiscent of eukaryotic enhancers (Buck et al., 1986; Ninfa et al., 1987). Finally, more complex systems are exemplified by promoters that are directly controlled by two positive regulators (Schleif, 1987; Schwartz, 1987). In these cases, the respective roles of the activators have not been determined and it is not clear whether they act independently or in concert. Most of these properties, while found individually in bacterial promoters. are present’ together in many eukaryotic promoters. Thus, eukaryotic promoters may be distinguishable from their prokaryotic counterparts not’ so much bv functional differences as by their level of complexity. The maltose regulon of E. coli and Klebsiella pneumoniae comprises several operons whose expression is regulated with regard to the availability of maltodextrins, the products of starch degradation, and glucose, the preferred carbon source for the bacteria. The promoters of the regulon, which are positively regulated, are apparently quite different from the CI or CRP model systems (Schwartz, 1987). Their study may therefore provide new insights into alternative mechanisms for activation of transcription initiation. All of the maltose regulon promoters are specifically activated by the product of the malT

1. Introduction The mechanisms underlying the activation of transcription initiation at specific promoters are far from being elucidated, not only in eukaryotes but also in a simple organism such as Escherichia coli For prokaryotes, a simple model has emerged from extensive studies of transcription activation by the E. coli CRP protein (CAMP receptor protein) (De Crombrugghe rt al., 1984) and the lambda CI protein (Ptashne, 1986: (1) the activator, a dimeric protein, binds to a recognition sequence charact.erized by a dyad symmetry and located slightly upstream from the - 35 region of the RNA polymerase protein-protein binding site, and (2) t’hrough contacts or/and a DNA conformational change, the activator facilitates one or several steps in the initiation process. However, recent analysis of other activation systems show that this model is strictly valid only for a limited class of promoters. The activator often seems to bind to an asymmetric, tandemly repeated sequence (Ho et al., 1983; Maeda et al., 1988; Miller et al., 1987; Lee et aE., 1987). In some cases, the activator binding sites can be positioned in either orientation, several hundred base-pairs upstream or downstream without affect,ing transcription activation, a property (H)%-“-IX:~HiX9!0304i

I- 15 ~o:~.oo/o

471

0

1989 Academic

Press Limited

0. Raibaud et al.

472 EcoRI

Hindrn

roqr

Pst1

5'-~GAT~~GCATGC~G~TTTTGGCGAGAGCCGAGGCGG-CATCATCGTCGTTAATGCGGATAATGCGAGGA

TGCGTGCACCTGTTTTTATTTTCATAATCTATGGTCCTTGCGGACTC

TTATACGGCAACCTCT I I Kp250 Kp245

Kp302

Ep122

EptOgO GTGGAGATGCGCAC

AAAATCGCCACGATTT

' + Kp162 Ep1134 lEP13" 0 GCAAGCAACATCAC

' Kp146 '

TTCCTTACATGA

Ep261

Ep270 AGCCCATCATGAATGTTGCTG~CTCTAG~GGATCC,CCGGGTACCGAGCTC~~TTC,-3' TbqI

BomHI

EcoRI

molKp Figure 1. Deletion end-points. The pOM18 sequence shown here is that of the E. coli Taq-Tag1 malEp-malKp fragment flanked by the pSB118 polylinker moieties. The start sites of transcription (black arrows), the Pribnow boxes (hatched boxes), the MalT boxes numbered from 1 to 5 (arrowed boxes) and the putative CRP-binding sites numbered from 1 to 4 (open rectangles) are also indicated. MalT boxes 2 and 3 overlap. Epx and Kpx represent respectively the endpoints of the various malEp and malKp upstream deletions where x denotes the position where the deletion stops, i.e. the position abuting the EcoRI linker (e.g. Ep92 corresponds to a malEp promoter deleted for the sequence lying upstream from residue -92). Following this numbering system, the wild-type malEp and malKp promoters present in pbMl8 are Ep301 and Kp402, respecti;ely.

gene. The MalT protein, which has been recently purified in an active form, appears to be a monomer in solution (M,= 102,000) (Richet & Raibaud, 1987). The protein has two effecters: maltotriose, the inducer of the maltose regulon, and ATP (Raibaud & Richet, 1987; Richet & Raibaud, 1987; E. Richet, unpublished results). The MalTdependent promoters that have been sequenced characteristically contain the hexanucleotide 5’GGAT/GGA-3’ repeat’ed several times upstream from the transcription start site, the closest to the transcriptional start site invariably being at position -35 (Bedouelle et al., 1982; Chapon & Raibaud, 1985; Raibaud et aZ., 1985). Genetic data strongly suggest that this sequence is part of the MalT binding site (Bedouelle, 1983; Gutierrez & Raibaud, 1984; Raibaud et al., 1985), but direct evidence that MalT binds to the “MalT box” is so far lacking. The work described in this paper concerns malEp and malKp, a pair of divergent promoters directing the expression of the malEFG and malK 1amB malM operons, which encode the components of the maltodextrin transport system. In contrast to other maltose operon promoters, which are regulated only t Abbreviations or base-pairs.

used: bp. base-pair(s);

kb, IO3 bases

by MalT: malEp and malKp are also positively controlled by CRP, a pleiotropic regulator involved in the control of carbon source utilization (De Crombrugghe et al., 1984; Chapon, 1982; Richet & Raibaud, 1987). The 271 bpt intergenic region separating the malEp and malKp transcription start sites consists of a continuous stretch of putative binding sites for both activators (see Fig. 1). Preliminary observations made by Bedouelle (1983) and Rasmussen et al. (1985) indicate that some regulatory elements might be common to both promoters. In this paper, we present a detailed in vivo and in vitro structural analysis of malEp and malKp. The data obtained suggest that transcription initiation at these promoters involves the formation of a complex nucleoprotein structure. 2. Materials and Methods (a) Bacterial

strains and plasmids

All the strains used are derivatives of E. coli K12 MC4100 (F-araD139 AlacUl69 rpsL relA thiA) (Casadaban, 1976). AcrpTR. a 1.5 kb deletion encompassing the crp gene (P. Cossart and B. Gicquel-Sanzey, personal communication) was introduced by Pl transductions. pOM18 is plasmid pSB118 (a derivative of pUC18) with a 418 bp TaqI-Tag1 fragment containing malEp and malKp inserted into its AccI site (see Fig. 1)

Transcription

activation

of two divergent E. coli promoters

(Vidal-Ingigliardi & Raibaud, 1985). Plasmid pOM2 is a pBR322 derivative with a 3.5 kb P&I-EcoRI fragment containing the maZT gene (Raibaud et al., 1985).

independent cultures exceed 10%). (d) DNase

(b) (‘onstruction

of upstream spacing mutation8

deletions

and

Series of deletions upstream from malEp and malKp were constructed by linearizing pOM18 at the unique BamHI or Hind111 site (Fig. l), followed by BaZ31 nuclease treatment for various times and ligation in the presence of an excess of EcoRI linker (5’.GGAATTCC-3’). The plasmids containing appropriate deletions were select,rd after transformation. The spacing mutations were obtained as follows. The EcoRI-EcoRI fragments of Ep122 and Kp146 (see Fig. 1) were separately ligated to a single-stranded oligonucleotide (5’-AATTGCTCGAGC-3’) annealing with the protruding end of the EcoRI extremities, and then cut respectively by Hind111 and BarnHI. The resulting 273 bp and 180 bp fragments were purified by electrophoresis on a polyacrylamide gel and ligated together with plasmid pSB118 linearized by digestion with Hind111 and BamHI. Bacteria were then transformed with the reaction mixture and the correct clone was selected. This construction introduces a XhoI site at the junction between the Ep122 and Kp146 fragments and destroys the EcoRI sites originally present at the deletion endpoints; it results in a total insertion of 17 bp, called 117, which is the sum of a 3 bp deletion (from positions - 122 to - 124 upstream from malEp) and a 20 bp insertion. The insertion 131 (corresponding to a total insertion of 31 bp) was generated by inserting a oligonucleotide containing an MZuI site synthetic (.i’-TCGAACACaCGTCT-3’) into the XhoI site of 117. The insertions 112. Il6. 121. 123 and 126 were obtained by opening 731 with MZuT. followed by limited digestion with mung bean nuclease. The deletion endpoints and the sequence of the insertions were determined by dideoxynucleotidr sequencing (Sanger et al., 1977) after rloning of the EcoRI fragments rontaining these constructions into Ml3mp11. (c)

In vivo assay of promoter

473

(the observed

I protection

variations

do not

experiments

Purified EcoRI-BamHI or PstI-Hind111 fragments were specifically labelled at one end by filling in with the DNA polymerase I Klenow fragment in the presence of the appropriate [m-32P]dNTP, followed by precipitation with ethanol. The DNase I protection experiments were done essentially as described by Galas & Schmitz (1978). The 20 ~1 reaction mixture contained 40 mM-Tris . HCl 40 mM-KCI, 10 miw-MgCl,, 1 mM-CaCl,, (PH f+OL 0.1 mM-EDTA, 1 mw-dithiothreitol; 100 pg acetylated bovine serum albumin/ml, 1 miw-maltotriose, 0.2 mM-ATP, w 1 niv-end-labelled DNA fragment and various concentrations of purified MalT protein. After a lo-min preincubation at 25”C, 2~1 of lpg DNase I/ml (in 40 m&l-Tris. HCl (pH 8.0), 40 m&I-KCI, 1 mM-C&l,) were added and the reaction mixture further incubated for 1 min at 25°C. The digestion was stopped by adding 20 ~1 of a solution containing 0.6 M-sodium acetate, 50 mM-EDTA, 20 pg sonicated plasmid D?l’i\/ml. The DNA was recovered by precipitation with ethanol and resuspended in 4 ,ul of 94% formamide, 10 mM-EDTA (pH 7.5), 0.1 Y0 (w/v) xylene cyanol, 0.1 qb (w/v) bromophenol blue. The samples were electrophoresed through an 8% (w/v) polyacrylamide sequencing gel (0.3 mm thick) in the presence of 8.3 M-urea. The gel was fixed, dried and autoradiographed on Kodak XAR-5 film without a screen. (e) Proteins

The MalT protein was purified as described (Richet & Raibaud, 1987). The E. coli CRP protein. kindly provided by D. Kotlarz (Institut Pasteur), is about 15”/” active as determined by titration with a DNA fragment containing la&p; the concentrations indicated in Fig. 8 represent active form concentrations. The E. coli RNA polymerase holoenzyme (60% active) was provided by the laboratory of H. But (Institut Pasteur).

activity

The EcoRI fragments containing the altered promoters were cloned into the EcoRI site of pOM41 and transferred onto the chomosome in front of the mulPQ operon as described (Vidal-Ingigliardi & Raibaud, 1985). The transfer of fragments containing an inactive promoter was done following the procedure outlined by Raibaud et al. (1984), except that pOM41 was used instead of pOM40. The cells were grown at 37°C in M63 minimal medium (Miller, 1972) supplemented with 1 Pg thiamin/ml. 0.4% glycerol, 0.4% (w/v) maltose. The level of amylomaltase, the product of the maZQ gene, was determined as described (Raibaud et al., 1985), except that the commercial glucose reagent, which sometimes contained traces of maltase, was replaced by a glucose reagent reconstituted in the laboratory. Amylomaltase activity is expressed as units/mg of soluble cellular proteins and 1 unit amylomaltase is defined as the amount of enzyme producing 1 nmol of glucose per min at 30°C’. A background of 15 units of soluble cellular proteins/mg. due to a secondary MalT-dependent promoter located at the end of the maZP gene. was subtracted from all the values obtained (the background was measured in the MC4100 derivative containing AmaZPp:J34. a deletion of the ,maZPp promoter). Each value is the average obtained from at least 2

3. Results (a) Promoter activity dependson “MalT boxes” located up to 240 bp upstream from the transcription startpoint Deletion analyses were performed to determine upstream functional limit of the malEp and maZKp promoters. Starting with a plasmid bearing the E. coli Taq-TaqI malEpmalKp fragment, we

the

generated Bal31 deletions from a restriction site located upstream from the particular promoter being analysed (Fig. 1). The activity of the truncated promoter was then measured in vivo. For this purpose, the DNA fragment containing the promoter was transferred onto the chromosome in place of malPp, the promoter of the malPQ operon, and amylomaltase, the product of the malQ gene, was assayed. In these operon fusions, the expression of malPQ is driven only by the promoter present on the inserted fragment and the amount of amylomaltase synthesized reflects the efficiency of this promoter (Vidal-Ingigliardi & Raibaud, 1985). This technique of transfer onto the chromosome

474

0. Raibaud et al

I

I

(0) IY

lllIIIll s

I

f’

I

I

I KP

I w

al*

2

I

4

3

2.3 4

5

I

1 (b)

I

III

I

500

I

I

III

1,

llllll

II

EP I

2

3

4

2,3 4

5

-

Figure 2. Effect of upstream deletions on the in viva activity of wdEp and malKp. The truncated promoters were transferred onto the chromosome in front of the malPQ operon, and their activity determined by assaying amylomaltase as described in Materials and Methods. Deletion endpoints are indicated on the abcissa in the same scale as for the maZEp-maEKp region drawn at the top of the Figure (see legend to Fig. 1 for symbols). (a) mdKp; (b) malEp.

eliminates the problem of MalT titration observed when the malEpmalKp region is present on a multiple-copy number plasmid (Duplay et al., 1985; Rasmussen et al., 1985). Figure 2(a) shows the results obtained for malKp. Deletions up to position -240 have no significant effect on promoter efficiency. However, the deletion that ends at position -228 and removes the MalT box located at position -35 upstream from malEp (Kp228) completely abolishes the malKp activity. Similar results were obtained for maZEp (Fig. 2(b)). Whereas deletions extending to position -261 of malEp have no effect, deletions removing the MalT boxes proximal to malKp progressively reduce the activity of malEp, the removal of the MalT boxes 5, 4 and part of box 3 resulting in an 80% reduction of its efficiency. The residual activity was not affected by longer deletions until they removed the

CRP binding site closest to malEp, the deletion of which (Ep64) completely inactivates the promoter. Deletion Ep92 (Fig. 2(b)) therefore defines a minimal malEp promoter. It is 20% as efficient as the wild-type, and includes the first MalT box and the first CRP-binding site. The activity of the Ep92 promoter still depends on MalT; its dependence on CRP has not been tested. These results thus show that the functional limit of each promoter lies at about 240 bp upstream from the transcription start site and hence that malEp and malKp overlap over 210 bp. Moreover, the correlation observed between the removal of MalT box(es) and the reduction of promoter activity strongly suggests that the requirement for upstream sequences reflects the involvement of the distal MalT box(es) in transcription activation. Genetic evidence indicates that at least t)he most

Transcription

activation

of two divergent E. coli promoters

m 400

11

-

Insertion

(0)

1 EPE

KP

=

M-

Insertion

(b)

500

&l-m

475

-

z . .$

400

-

x t .> $l

300

-

9 b 5

200

-

I

12

I

1

I

16 17 21 Size of the insertions

I

1

1

23

26

31

(bp)

Figure 3. EfFeect of insert,ions on the in viva activity of malEp and maZKp. The EcoRI-EcoRI DNA fragments of pOM18 or derivatives carrying the different insertions were transferred in both orientations in front of the mulPQ operon onto the chromosome. The activity of the altered maZEp and of malKp promoter was then measured by assaying amylomaltase. (a) maZKp: (b) malEp.

proximal one, centred on position -38.5, is also essential for promoter activity. First, the fact that the presence of a MalT box at this position is the unique feature common to all the MalT-dependent promoters suggests that this binding site plays a key role in transcription activation (Chapon & Raibaud, 1985). Second, a point mutation within MalT box 5 inactivates maZKp (Bkdouelle, 1983). While these divergent promoters are coregulated, the observation that the deletion of the Pribnow box of one promoter (hence its inactivation) does not depress the activity of the other one, indicates that they are not functionally coupled. (b) Ejfect of insertions in the middle of

the regulatory region To determine whether the distance and the angular orientation between the proximal and distal binding sites in both promoters was critical for their activity, we inserted DNA fragments of various lengths into the middle of the intergenic

region between the second and the third CRPbinding site as first done by Dunn et al. (1984). We then measured the activity of the altered promoters in viva as above. Insertion of 12, 21 or 31 bp (equivalent to about 1, 2 and 3 turns of DIVA helix, assuming 10.5 bp/turn) causes only a moderate decrease of malKp activity (Fig. 3(a)). Tn marked contrast, insertion of 16, 17 or 26 bp (equivalent t,o 1.4, 1.5 and 2.5 helix turns) results in a dramatic reduction of promoter efficiency. The malKp promoter can thus accommodate insertions of at least 31 bp in the middle of its regulat,ory region provided that their size represents an integral number of helix turns. The differential effects of the insertions also indicate that efficient activation of transcription at malKp requires the stereospecific alignment of some distal and proximal proteinbinding sites. Insertions of increasing length have the same cyclic effect on SmalEp, except, that promoter activity is relatively less depressed (Fig. 3(b)). This difference may result from the fact that, in contrast to malKp, malEp is st’ill 20%

476

0. Raibaud et al.

active when the regulatory elements located beyond the insertion point are deleted (see Fig. 2(b)). (c)

Effect of deletions and insertions the absence of CRP

in

To determine whether the involvement of the distal MalT binding sites depended on the presence of CRP and to study their role in the DNA-turn dependence, we examined the effect of deletions and insertions on promoter activity in the absence of CRP. malEp and malKp are inactive in the absence of CRP, but their activity can be partially restored by overproducing MalT (Chapon, 1982). The efficiency of the mutant promoters was therefore measured in a Acrp strain harbouring pOM2, a multiple-copy number plasmid carrying the m&T gene. Under these conditions, malEp and malKp activity were 20% and lo%, respectively, of the levels observed in a wild-type background (Table 1). In both cases, deletion of the distal MalTbinding sites impaired promoter function to about the same extent as in a crp’ strain (compare Kp228 to Kp240, and Epl99 to Ep236), showing that in the absence of CRP MalT boxes located between positions -200 and - 240 upstream from the transcription start site are still involved in transcription activation. A DNA insertion of two turns (121) has no effect on ,malKp activity, whereas an insertion of 1a5 turn (116) reduces its activity by 90% (Table 1), indicating that in the absence of CRP the distal MalT binding sites have to be in phase with some proximal regulatory elements of malKp. The fact that the insertions have the same qualitative effect on malKp activity whether or not CRP is present suggests that in the presence of CRP the distal MalT binding sites have also to be stereoaligned with some downstream regulatory elements. On the other hand, malEp activity was stimulated by both insertions (Table 1). We have no simple explanation for the differences in the effects of insertions on malEp in crp’ and Acrp backgrounds (compare Table 1 and Fig. 3(b)).

(d) DNase I footprint of MalT bound to malEpmalKp To determine where the MalT protein binds in the regulatory region, we carried out DNase I protection experiments with end-labelled DNA fragments containing the wild-type malEpmalKp sequence. The footprinting assays were performed in the presence of ATP and maltotriose, both of which are required for MalT to bind to DNA (E. Richet, unpublished results). Figure 4 shows the footprints obtained for each DNA strand in the presence of various concentrations of MalT. The activator specifically protected two large regions encompassing the MalT boxes. The protected areas stretch from positions -28 to -66 upstream from malEp and from positions -33 to -85 upstream from malKp (Fig. 5). The former was occupied by MalT at a twofold higher concentration than for the latter. The fact that the concentration of MalT at which half-protection was observed was not changed in the presence of a fivefold excess of unlabelled DNA fragment indicates that active MalT protein was present in excess in t’hese experiment,s. Therefore, the relatively high concentration required to achieve protection probably reflects the low affinity of the protein for its DNA binding sites. It should be noted that the concentrations of the promoter and MalT used in these in vitro experiments are of the same order of magnitude than those found in vivo in the bacterium cell (in the nM and PM range, respectively) (Debarbouille & Schwartz. 1979). (e) MalT binding to malEp-malKp induces DNA bending in the central region A close examination of the central region separating the protected areas reveals a regular pattern of alternately increased and decreased sensitivity to DNase I cleavage, which spans -110 bp on both st,rands (Figs 4 and 5). The clusters of enhancements and diminutions have periodicities of 10.5 nucleotides, and are separated

Table 1 EJect of deletions and insertions on activity of malEp and malKp in the absenceof CRP Promoter in front Kp402 Kp240 Kp228 Kp402 Kp402

inserted of m&P&

: : 12 1 :: 116

Amylomaltase (units/mg)

Promoter in front

42 57 6 38 8

Ep301 Ep236 Ep199 Ep301:: Ep301

inserted of m&P&

121 :: 116

Amylomaltase (units/mg) 109 97 37 140 214

The EcoRI-EcoRI fragments containing a wild-type or an altered promoter (Fig. 1) were transferred in front of the maZPQ operon on the chromosome of a AcrpT8 strain harbouring pOM2. Promoter efficiency was then determined by assaying amylomaltase as described in Material and Methods, except that the bacteria were grown in a complete medium (ML) supplemented with 0.4% (w/v) maltose and 5 pg tetracycline/ml. A background of 30 units/mg, as measured with a AmulPp534 AcrpTX strain transformed with pOM2 and grown under identical conditions, was subtracted from all the values obtained. Kp402 and Ep301 correspond to the wild-type maZKp and maZ7p promoters present in pOM18.

Transcription

NM TNL” oooo-

zu-l MALT

477

activation of two divergent E. coli promoters

(PM)

--_---,

066

20

MALT

(/a)

-KP

-160 -140

- 160

-60 13 ‘7

I I I

I

I I

-80

I

I I I I

I

I I I I

2,?

-60

KP -260.

(a)

(b)

Figure 4. DPu’ase I footprint of MalT bound to the mulEp-malKp region. The fragments used are the EcoRI-BamHI fragment of pOM18 with the upper strand 3’ end-labelled at the BamHI site (a) and the EcoRI-BamHI fragment of Kp302 with the bottom strand 3’ end-labelled at the EcoRI site (b) (see Fig. 1). The DBase I protection experiments were carried out as described in Materials and Methods in the presence of the indicated concentrations of MalT. A wellresolved footprint of the entire region was obtained by subjecting the samples to a short and a long electrophoretic run. The black arrowed boxes indicate the position of the MalT boxes. The open and the black arrowheads mark clusters of diminished and enhanced bands, respectively. The sequence is numbered from the maZEptranscription startpoint (see Fig. 5).

by five residues. Such a phenomenon of cyclic DNase I susceptibility has already been observed for smoothly bent DNA, e.g. wrapped around a protein core (Drew & Travers, 1985; Richmond et al., 1988) or looped out due to interactions between proteins bound to sites far apart (Hochschild & et al., 1987). In both cases Ptashne, 1986; KrGmer the exposed minor grooves are enlarged as a result

of DNA curvature and are thus more susceptible to DNase I attack, whereas the minor grooves lying inside are narrower and hence less susceptible or inaccessible to the nuclease. To determine whether MalT binding to both malEp and malKp is essential for the intervening DNA to loop, we carried out similar DNase I protection assays with DNA fragments from which one set of MalT boxes had

478

0. Raibaud

W

ENHANCED

V

DIMINISHED

et al.

CLEAVAGE CLEAVAGE

-PROTECTED

mal Ep

REGION +

,a5

+

10.6

+

+

10.5

-

'VW m I . . . . . ..I. w CCTCTTTC~TCCTCCTTGCCCCTACGCC~CC~~~~CTTTGTGTGATCTCTG~~~o~G~T~G~GT~~~~~~~T~~C~=-T~C~cG~~~~TT~ . . . ..-I .

w

~GGACTCTAGTTTCTTTATACGGCAA . s-20 GCCTG.AGATCAAAGAAATATGCCGTT

.

10.5

+

+

10.5

.

a-120

.

l

10.5

GGAGAAAGGTAGGM;GAACGGGGATGCGGGGTGCGGGGTGGCAGCG-CA~~~GAC~T~T~~G~ACACC~T~CGCG~T~T~AG~GT~CT~CGTT

I-+

10.5

+

,a5

+

10.5

-+--

10.5

10.5

W-V

A 10.5

+

10.5

+

CTCCTGATGACGCATAGTCAGCCCA+ . . m-260 GAGGACTACTGCGTATCAGTCGGGT-5'

10.5

+

10.5

la5

+

A4M 10.5

-t-

m5

+

10.5

+

to.5

-

+

G%CAT~CGAAA~TCCTTAC~T~CCTCGGT%AGTTCA~~GCCGTGTT . . a-160 *-180 s-140 CGTTGT~GTGC&TTAA~Gi!A&TACTGGAG~CA&ATCAAGTGT&TTCGGCACTT +

+

.

. ..P CCTCCTCCCCCAT AAATMGCCAGGGGGTG . G&fgTgcAT m-220 GGAGGAGGGGGTATT~TCGGTCCCC~CCTCCTAW~~CGGTA

-I

malKp

Figure 5. Schematic representation of the MalT footprint on malEp-malKp. The sequence shown extends from malEp position + 1 to maZKp position + 1 and is numbered from the maZEp transcription startpoint. The black arrowed boxes represent the position of the MalT boxes. Enhancements, diminutions of DNase I cleavage and protection against DNase I attack are marked as indicated in the inset. The broken lines denote partial protection. The unmarked bases correspond either to sites that are insensitive to DNase I or to sites of unaltered nuclease susceptibility. Protection or enhancement refer to the reactivitv of the bond on the 3’ side of the marked residue. The data were obtained from 2 different experiments including that shown in Fig. 4.

been deleted. As shown in Figure 6(a), the complete deletion of the MalT-binding sites on the malKp side affects neither MalT binding to the malEp region, nor the periodic variation of DNase 1 sensitivity. Similar results were obtained with DNA fragments deleted for the MalT binding site proximal to malEp (Fig. 6(b)). The above observations argue against a strict DNA loop model (Hochschild & Ptashne, 1986) and are more consistent with a scenario whereby MalT binding to malEp-malKp results in the wrapping of the int,ervening DNA around a core of MalT proteins, this phenomenon occurring whether or not one set of MalT binding sites is missing. This conclusion was further strengthened by results obtained from DNase I protection experiments done with DNA fragments containing different inserts. Insertions corresponding to two or three turns of.DNA helix (121 and 131) did not alter MalT binding to malEp-malKp, as compared to the wild-type. DNase I protection was observed at the same concentration of MalT and the positions of the alternately enhanced and diminished DNase T cleavage were unchanged (Fig. 7 and data not shown). In contrast, insertions of 1.5 or 2.5 turns of DNA helix (116 and 126) dramatically affect the way in which MalT interacts with malEp-malKp (Fig. 7 and data not shown). At a low concentration of MalT (O-25 PM), only the malKp proximal region is protected, and the periodic pattern of DNase I cleavage extends over more than 200 bp from the left of the protected area. The cutting pabtern is initially iientical with the wild-type pattern and then appears to be shifted by 5 bp beyond the insertion.

MalT binding to only the maEKp region would therefore induce wrapping of the adjacent sequence around a core of MalT protein, as observed with DNA fragments deleted for the malEp proximal region (see the schema in Fig. 7). At 1 PM-MalT, a concentration at which the malEp proximal region is also protected, the aberrant pattern of DNase I cleavage in the section proximal to malEp becomes identical with that observed in a wild-type context. We interpret these results as meaning that’ this segment is now wrapped around the core formed by the MalT proteins bound to the malEp side. It must be recalled that, because of the insertion of a nonintegral number of helix turns, the malEp and malKp sets of MalT-binding sites are no longer in phase and hence that the direction of the wrapping induced by MalT binding to one set is opposite to that resulting from MalT binding to the other set. It is worth pointing out that MalT is therefore able to force a DNA sequence to bend either way depending on the context. (f) The MalT MalT-binding

boxes are sites

As mentioned above, the DNase I protected areas encompass the different MalT boxes. However, this correlation was not sufficient to conclude that the hexanucleotide 5’-GGAT/GGA-3’ represents a MalTbinding site. More compelling evidence was provided by examining the effects of deletions on MalT binding. Comparison of Kp240 and Kp228 (Fig. 6(b)) shows a correlation between deletion of MalT box 1 and the absence of MalT binding to the

Transcription

Ep236 -+

activation

Ep225

Ep204

Ep193

Epl68

-+

-+

-+

-+

of two divergent E. cob promoters

Ep92

Ep47

-++

-+

479

I -.

I \r

-230

’

4

KP

Figure 6. Interaction of MalT with truncated mdEp-muEKp fragments. (a) Fragments deleted on the malKp side. The PstI-EcoRI Epx fragments (Fig. 1) were cloned between the corresponding sites of pBR322. Purified PstI Hind111 fragments were 3’ end-labelled at the Hind111 extremity (upper strand in Fig. 5) and used for DNase I protection experiments. The assays were carried out as described in Materials and Methods except that the reaction mixture contained 1 mM-MgCl, instead of 10 mM. This reduction of MgCl, concentration results in a 2-fold increase of MalT affinity for its DNA binding sites. Because of the low affinity of MalT for Ep47, the assays involving this fragment were performed in the presence of 75% polyethylene glycol 6000 (Zimmerman & Harrison, 1987). The absence or presence of MalT (0.5 PM for Ep236, Ep225, Ep204, Ep193 and Epl68; 0.5 and 1.0 PM for Ep92; and 1.0 FM for Ep47) are marked with -and + signs, respectively. The continous lines denote pBR322 sequence. The other symbols are the same as those used in Fig. 4. For the sake of clarity, only some of the clusters of enhancements or diminutions are indicated. (b) Fragments deleted on the maZEp side. DBase I protection experiments were carried out in the presence of 1 PM-MalT and IO mM-MgCl,, with E’coRI-BamHI Kpx fragments 3’ end-labelled at the BamHI extremity (upper strand in Fig. 5). In these assays, the final DBase I concentration was 0.3 pg/ml except for the control without, MalT (the leftmost lane) where it was 0.075 gg/ml. Only some of the enhancements and diminutions are indicated.

480

0. Raibaud

et al.

\

\

\

\ \

\

\

\ \

\

\ \

\

i \ 1 \

! , \ \

\ \

\

“.

\ \

\

L 116

KP

I21

W.T.

116

MALT:

025

/.a

Figure 7. Effect of insertions on MalT interaction with the nudEp-maZKp region. EcoRI-+?amHI fragments of pOM18 (W.T.) or derivatives carrying insertions of 16 bp (116) or 21 bp (121) were 3’ end-labelled at the BamHI extremity (upper strand in Fig. 5). The assays were carried out in the presence of the indicated concentrations of MalT as described in Materials and Methods, except that the concentration of MgCl, was 1 mnr. The continuous lines represent the inserted sequences. The other symbols are the same as those used in Fig. 4. Enhancements and diminutions observed for 116 at 0.25 pM and 1 p&r-MalT are indicated on the left and on the right of the lanes, respectively. A schematic representation of the complexes that MalT is thought to form with the different malEp-maEKp fragments is shown at the bottom of the Figure. The black triangles represent the malEp and maZKp sets of MalT binding sites, which are postulated to lie on the same side of the DNA helix in a wild-type context (see Discussion). The black squares represent the insert. malEp region. Likewise, Ep47 but not Ep36 binds MalT (Fig. 6(a) and data not shown). Altogether these deletions strictly define MalT box 1 as an

important

determinant

for MalT

interaction

with

the DNA. DNase I footprints of MalT bound to the Ep236, Ep225, Ep204 or Ep193 fragments, which

Transcription

activation

of two divergent E. coli promoters

present different deletions on the malKp side, are consistent with the notion that MalT individually recognizes MalT boxes 2/3, 4 and 5 (Fig. 6(a)). However, these experiments do not tell us whether protection of the - lSS/-202 region results from MalT binding to box 2 or to box 3. Moreover, these footprints indicate that MalT binding to one recognition sequence results in the protection from DNase I attack of an N 16 bp stretch centred on the MalT box. Comparison of the sizes of the footprints obtained with Ep92 and Ep64 (~32 bp) and Ep47 (18 bp) suggests the existence of an additional lMalT binding site, poorly recognizable, between -47 and -64 (Fig. 6(a) and data not positions shown). Indeed, DNase I footprinting done with the -44/152 fragment cloned away from the identified MalT boxes shows that MalT protects against DNase I attack an N 15 bp region extending from positions -44 to -58 (data not shown).

-200

-160

481

Q . l

4

. -160

l .

(g) Presenceof four CRP-binding sites in the intergenic region The CRP protein is presumed to activate transcription initiation at malEp and malKp by binding to one or several of the four putative CRPbinding sites revealed by sequence comparison (see Fig. 1) (Bedouelle, 1983). We carried out DNase I protection experiments with a wild-type malEpmalKp DNA fragment to examine whether CRP binds to these sites. Figure 8 shows that CRP effectively forms a stable complex with each of them and that the sites are filled in the following order: site 1, sites 2 and 3, site 4. DNase I protection experiments carried out with 150 nM of RNA polymerase holoenzyme present alone

show

no footprint

in the proximal

regions

of

malEp and malKp. This result was expected because these promoters lack a canonical “ - 35” region. However, they reveal an RNA polymerase binding site located in the middle of the intergenic region and overlapping the CRP-binding site 3. The protected area extends from positions - 103 to - 155 upstream from malEp (data not shown). No “-

10” and (‘- 35” consensus

recognizable transcription transcription

in

sequences are clearly In vitro run-off have revealed no significant in either direction from this

this

assays initiation

region.

site, either in the presence or absence of MalT and CRP. We therefore do not know whether this site has any physiological

-60.

Figure 8. CRP binding to the malEp-maEKpregion. DBase I protection experiments were done with an EcoRI-BamHI Kp271 fragment 3’ end-labelled at the EcoRI extremity (lower strand in Fig. 5). The reaction mixture contained 0.2 mM-CAMP instead of ATP and maltotriose and various concentrations of CRP. The open boxes represent the positions of the sequences homologous to the CRP consensus recognition sequence (see Fig. 1). The sequence is numbered from the wzdEp transcription startpoint.

significance.

4. Discussion (a) MalT is a specific DNA binding

protein

around which DNA can wrap In this paper we present direct evidence that MalT, the transcriptional activator of the E. coli maltose regulon, specifically binds to the hexanucleotide 5’-GGAT/GGA-3’, which has previously been genetically defined as the site of action of MalT. The studies reported here, which consist of

DNase I footprinting of MalT bound to DNA fragments containing various segments of malEpmulKp, clearly indicate a close correlation between MalT binding and the presence of this hexanucleotide. MalT protects a stretch of about 16 to 18 bp, centred on the hexamer, against DNase I attack.

Several

earlier

observations

lead

to

the

notion that this hexanucleotide represented the MalT binding site. First, sequence comparisons revealed the presence of this motif in all the MalTcontrolled promoters (Chapon & Raibaud, 1985).

482

0. Raibaud

et al.

Second, deletion analysis of malPp involving a set’ around a core of protein. This core could consist of deletions with closely spaced endpoints also only of MalT monomers bound to their recognition pointed to the importance of this motif in promoter sites or it could be formed of additional MalT activity (Raibaud et al., 1985). Third, five out of six proteins whose aggregation is nucleated by those known point mutations that reduce the efficiency of bound to the MalT boxes. The fact that the periodic MalT-dependent promoters without altering their DNase I pattern extends over 200 bp from the Pribnow-box map in a MalT box (Bedouelle, 1983; MalT binding sites under certain conditions is in Gutierrez & Raibaud, 1984). Altogether, these favour of the latter possibility (seeFig. 7). results and the data presented here are strong evidence that the 5’-GGAT/GGA-3’ sequence forms (b) malEp and malKp eficiency depends on a the core of the MalT recognition sequence and that 240 bp region encompassing multiple MalT it mediates transcription activation by MalT. This and ORP binding sites sequence is often embedded in a purine-rich region (Bedouelle, 1983), suggesting that additional, less The in wivo structural analysis of the divergent well-conserved residues on both sides of the malEp and malKp promoters reported here shows that, although the situation is not’ quite hexamer might contribute to the specificity of MalT symmetrical, the upstream functional limit of each binding. promoter lies at’ about position -240. They, DNase I footprints of MalT bound to its therefore, share a common 210 bp long regulatory recognition site are often characterized by the presence of two bands in the middle of t’he region. Footprinting experiments show that’ this protected area which result either from an enhanced region encompassesa series of effective binding sites cutting or from a partial protection (see boxes 213 for both MalT and CRP. This multiplicity of and 4 in Fig. 4(a)). Such a feature, which is also protein binding sites involved in transcription observed for some MalT boxes present in pulAp and activation at malEp and malKp in addition to the malXp, two other MalT-dependent promoters Pribnow box means that the process is a complex one and probably relies on the formation of a large (unpublished results), suggests that MalT interacts nucleoprotein structure. As suggested by the results with the 5’-GGAT/GGA-3’ sequence essentially through the major groove and that the minor obtained from the insertion analysis, the formation of such a complex would be rather sensitive to a groove lying on the opposite side of the DNA helix change in the relative spatial orientation of remains accessible to DNase I. The fact that most upstream and downstream binding elements. of the Gs but none of the As of the MalT box are It should be pointed out that, although both protected from DMS attack in the presence of MalT promoters function only in the presence of CRP in a further supports this hypothesis (unpublished wild-type strain, they are partially active in a crpresults). background provided that MalT is overproduced. The DNase I footprinting analysis of the MalTIn this genetic context, i.e. in the absence of CRP, DNA complexes revealed an additional property of transcription activation shows the same dependence the protein that may have a functional significance. When bound to both sets of binding sites in the , on the presence of the MalT-binding sites located 200 to 240 bp upstream from the transcription malEp-malKp fragment, the protein induces a startpoint and, at least for malKp, shows the same conformational change of the central region, as requirement for a correct phasing between the indicated by the appearance of a regular pattern of distal MalT-binding sites and proximal elements. alternately enhanced and diminished DNase I The 210 bp regulatory region common to both cleavage over 110 bp. Such a pattern has already promoters can therefore form an active nucleobeen observed in different systems involving DNA protein complex not only with CRP and MalT, but bending; these include DNA minicircles (Drew & also with MalT alone, and any structural model Travers, 1985), DNA loops resulting from binding must take this property into account. of the lambda CI repressor or the Ii=. coli lac repressor to sites far apart (Hochschild & Ptashne, 1986; Griffith et al., 1986; Kramer et al., 1987), and (c) A model for the nucleoprotein structure involved DNA-protein complexes where the DNA is in activation of malEp and malKp wrapped around a core of proteins (Fuller et al., As shown by Figure 9(a), all of the CRP- and 1984; Kirchhausen et al., 1985; Richmond et al., MalTrecognition sequences,except for MalT box 5, 1988). In all of these cases, cyclic sensitivity to have their major grooves located on the same side DNase I, an enzyme that binds in the minor groove, is thought t,o result’ from periodic deformations of DNA helix. CRP is known to contact its induced by DNA curvature (the minor grooves recognition sequence through the major groove facing outwards are enlarged whereas the minor (Ebright et aE., 1984; Weber & Steitz, 1984) and, as grooves facing inwards are narrower) and/or from discussed above, MalT probably also contacts the the hindered accessof DNase I to the minor groove MalT box through the major groove. Most of the lying inside (Suck et al., 1988). As discussed in binding sites for both activators would therefore lie on the same side of the DNA helix. Furthermore, Results, the data obtained with altered DNA fragments argue against a simple looping-out model this side is precisely the one that points in towards the centre of the bend resulting from the DNA and support the idea that the DNA is wrapped

Transcription

activation

of two divergent

E. coli promoters

483

OutsIde

(al

t

MALT I

(b)

MALT CiP

+ MALT

5 EP KP

0 KP

Figure 9. A model for the nucleoprotein complex formed on malEp-wdKp. (a) Axial projection of the malEp-malKp DIVA helix showing the positions of the different activator binding sites with respect to the direction of the bend induced by MalT. All of the positions indicated on the diagram refer to the position of the major groove corresponding to the mentioned base-pair. Base-pairs are numbered from the wuzlEp transcription startpoint (Fig. 5). Only one DNA helix turn is represented; the remainder of the sequence can easily be positioned by extrapolation, assuming 10.5 bp per turn (Goulet et al.. 1987 and references therein). The arrow marks the positions where the major groove faces outwards the bend resulting from DNA wrapping around MalT, as determined from the DNase I cleavage pattern (see Fig. 5). Open triangles show the position of the centre of the 5’-TGTGA-3’ sequences contacted by CRP in each CRP-binding site. Closed triangles indicate the location of the centre of the MalT boxes. The CRP and MalT binding sites are numbered as indicated in Fig. 1. (b) Schematic representation of the nucleoprotein structures formed on mdEp-mdKp. The proteins and the distances between the different binding sites are drawn on the same scale. MalT (M,= 102,000) and CRP (M,= 2 x 23,000) are considered as spheres whose radius (38 and 23 A, respectively) was calculated from the molecular weight. Distances between the 5’-TGTGA-3’ sequences of the CRP binding sites (closed rectangles) and the 5’.GGAT/GGA-3’ MalT boxes (closed triangles) are calculated using a value of 34 a (1 A=O.l nm) for the helix pitch. Although we do not know its exact position, we have also shown the additional MalT binding site located next to site I, as revealed by footprinting data. This diagram depicts the type of nucleoprotein complexes thought to be involved in transcription activation; it is meant to portray neither the exact composition of the protein core nor the path followed by the DNA (i.e. the DNA could be wrapped as in nucleosomes).

wrapping around MalT observed in vitro. These observations, therefore, suggest the following model for the nucleoprotein complexes that MalT alone or MalT and CRP could form in viva with the malEpmalKp regulatory region (Fig. 9(b)). When only MalT is present (and provided it is overproduced), the protein specifically binds to the MalT boxes through their major groove, and initiates the formation of an aggregate of MalT monomers around which the intervening sequence is wrapped.

In the presence of both MalT and CRP, CRP molecules bind to their recognition sites, replacing several of the MalT monomers which nonspecifically contacted the DNA. This model is compatible with the known properties of CRP, since the direction of the bend induced by the binding of CRP to its recognition site (Liu-Johnson et al., 1986) is the same as the one resulting from DNA wrapping around MalT. Most of the in vivo properties of the malEp and

484

0. Raibaud

promoters can be explained by this model if we assumethat the integrity of these nucleoprotein structures, i.e. the anchorage points on both sides and the correct wrapping of the DNA, is essential for transcription activation by this complex and if we assume that the complex involving both MalT and CRP is the most active species. Deletions of the distal MalT boxes destroy the anchorage points. Insertions of an odd number of half a turn, but not of an even number, between the CRP binding sites 2 and 3 completely change the phasing between the sites located on both sides of the insertions and consequently prevent the correct formation of the protein core. This model may also explain the intriguing observation that overproduction of MalT specifically reduces the activity of malEp and malKp, but not that of the CRP-independent malPp promoter (Schwartz, 1987). Indeed, the presence of a large number of MalT molecules in the overproducing cells would be expected to result in the substitution by MalT of the CRP molecules bound to the malEp-malKp regulatory region, leading to the formation of the less active nucleoprotein complex containing only MalT. It should be noted that we have presented the simplest model accounting for our present results and that this model relies on the assumption that the complex MalT forms in vitro with malEp-malKp is closely related to the structure actually responsible for transcription activation in vivo. More complex scenarios can also be imagined. For example, we cannot formally exclude the possibility that two different CRP/MalT nucleoprotein structures exist in equilibrium, each one being specifically involved in activation of only one promoter. It is also possible that the formation of an initiation complex is not a sequential process in which RNA polymerase interacts with a preformed MalT/CRP/DNA complex, but involves the three proteins from the first step. What is the role played by CRP in this system? Is CRP simply required to bend the DNA and assist MalT in the formation of the appropriate higherorder structure? CRP is supposed to bend the DNA by more than 90” (Liu-Johnson et al., 1986), and hence CRP binding to a series of sites (in phase for most of them) is expected to affect DNA folding dramatically. If CRP had such a role, it would be functionally identical with IHF (integration host malKp

factor), a specific DNA binding/bending protein that is believed to facilitate the formation of the intasome at attP by bending the DNA (Robertson &

Nash, 1988). Alternatively,

CRP could act through with either MalT or the RNA polymerase holoenzyme. specific

protein-protein

contacts

(d) The malEp-malKp regulatory region resemblesreplication origins The complexity of malEp-malKp regulatory region contrasts sharply with the simplicity of most of the positively regulated bacterial promoters. In several respects, this region is more like DNA

et al.

replication origins such as those of E. coli or lambda phage. These replication origins (100 to 250 bp) indeed present multiple binding sites for the initiator protein and there is evidence that binding of the initiator to its cognate ori sequence results in the formation of a compact DNA-protein structure with the DNA wrapped around a core of proteins (Fuller et al., 1984; Dodson et al., 1986). It remains to be determined if the apparent similarity between the DNA-protein complexes assembled at malEpmalKp and at these origins of replication is functionally relevant. We are grateful to Anthony Pugsley for his comments on the manuscript, Annie Kolb and Henri But for fruitful discussions and Maxime Schwartz for his constant interest in this work. We also thank our colleagues from the Henri But’s laboratory for providing us with CRP and RNA polymerase. This work was financed by the Institut Pasteur and the Centre National de la Recherche Scientifique (UA 04 1149). References Bedouelle, Bedouelle,

H. (1983). J. ilfol. Biol. 170, 861-882. H., Schmeissner, U., Hofnung, M. & Rosenberg,M. (1982). J. Mol. Biol. 161, 51%531. Buck, M., Miller, S., Drummond, M. 6 Dixon, R. (1986). Nature (London), 320, 374-378. Casadaban, M. J. (1976). J. Mol. BioZ. 104, 54-555. Chapon,C. (1982). J. Bacterial. 150, 722-729. Chapon, C. & Raibaud, 0. (1985). J. Bucteriol. 164, 63% 645. De Crombrugghe, B., Busby, S. & But, H. (1984). Science, 224, 831-838. Debarbouille, M. & Schwartz, M. (1979). J. Mol. BioZ. 132, 521-534. Dodson, M., Echols, H., Wickner, S., Alfano, C., MensaWilmot, K., Gomes, B., Lebowitz, J., Roberts, J. D. & McMacken, R. (1986). Proc. Nat. Acud. Sci., U.S.A. 83, 7638-7642. Drew, H. R. & Travers, A. A. (1985). J. Mol. BioZ. 186, 773-790. Dunn, T. M., Hahn, S., Ogden, S. & Schleif, R. F. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 5017-5020. Duplay, P., Bedouelle, H., Fowler, A., Zabin, I., Saurin, W. & Hofnung, M. (1985). J. BioZ. Chem. 259, 1060& 10613. Ebright, R. H., Cossart, P., Gicquel-Sanzey, B. & Beckwith, J. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 7274-7278. Fuller, R. S., Funnell, B. E. & Kornberg, A. (1984). Cell, 38, 889960. Galas, D. J. & Schmitz, A. (1978). NucZ. Acids Res. 5, 3157-3170. Goulet, I., Zivanovic, Y. & Prunell, A. (1987). NucZ. Acids Res. 15, 2803-2821. Griffith, J., Hochschild, A. & Ptashne, M. (1986). Nature (London), 322, 750-752. Gutierrez, C. & Raibaud, 0. (1984). J. Mol. BioZ. 177, 6986. Ho, Y. S., Wulff, D. & Rosenberg, M. (1983). Nature (London), 304, 703-708. Hochschild, A. & Ptashne, M. (1986). CeZZ,44, 681-687. Kirchhausen, T., Wang, J. C. & Harrison, S. C. (1985). Cell, 41, 933-943. Kramer, H., Niemijller, M., Amouyal, M.. Revet, B..

Transcription

activation

of two divergent E. coli prowmters

von Wicken-Bergmann. B. & Miiller-Hill, B. (1987). EMBO J. 6, 1481-1491. Lee, N., Francklyn, C. & Hamilton, E. P. (1987). Proc. Nat. Acad. Sci., U.S.A. 84, 8814-8818. Liu-Johnson, H. N., Gartenberg, M. R. & Crothers, D. M. (1986). CeZE,47, 9951005. Maeda, S., Ozawa, Y., Mizuno, T. & Mizushima, S. (1988). J. Mol. Biol. 202, 433441. Miller. J. H. (1972). Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Miller, V. L., Taylor, R. K. & Mekalanos, J. J. (1987). Cell, 48, 271-279. Xnfa, A. J., Reitzer, L. J. & Magasanik, B. (1987). CeZZ, 50, 1639-1046. Ptashne, M. A. (1986). A Genetic Switch, Cell and Blackwell Scientific Press, Cambridge and Palo Alto. Raibaud, 0. & Richet. E. (1987). J. Bacterial. 169, 3059 3061. Raibaud, O., Mock, M. & Schwartz, M. (1984). Gene, 29, 231-241. Raibaud, O., Gutierrez, C. & Schwartz, M. (1985). J. Bacterial. 161, 1201-1208. Rasmussen, B. A., MacGregor, C. H., Ray, P. H. & Bassford, P. J., Jr (1985). J. Bacterial. 164, 665-673. Richet, E. & Raibaud, 0. (1987). J. Biol. Chem. 262, 12647-12653.

485

Richmond, T. J., Searles, M. A. & Simpson, R. T. (1988). J. Mol. Biol. 199, 161-170. Robertson, C. A. & Nash, H. A. (1988). J. Biol. Chem. 263, 355443557. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). Proc. Nat. Acad. Sci., U.S.A. 74, 5463-5467. Schleif, R. (1987). The L-Arabinose Operon, In Escherichia coli and Salmonella typhimurium, Cellula~r and MoZecuZar Biobgy (Pu’eidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M. & Umbarger, H. E., eds) pp. 1473-1481, American Society for Microbiology, Washington, D.C. Schwartz, M. (1987). The Maltose Regulon. In Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology (Pu’eidhardt, F. C. et al., eds) pp. 1482-1502, American Society for Microbiology, Washington D.C. Suck, D., Lahm, A. & Oefner, C. (1988). Nature (London), 332, 464-468. Vidal-Ingigliardi, D. & Raibaud, 0. (1985). Nucl. Acids Res. 13, 5919-5926. Weber, I. T. & Steitz, T. A. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 3973-3977. Zimmerman, S. B. & Harrison, B. (1987). Proc. Nat. Acad. Sci., U.S.A. 84, 1871-1875.

Edited by P. Chambon