A cotton NAC domain transcription factor, GhFSN5, negatively regulates secondary cell wall biosynthesis and anther development in transgenic Arabidopsis

Plant Physiology and Biochemistry 146 (2020) 303–314

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

A cotton NAC domain transcription factor, GhFSN5, negatively regulates secondary cell wall biosynthesis and anther development in transgenic Arabidopsis

T

Qianwen Suna,1, Junfeng Huanga,1, Yifan Guoa, Mingming Yanga, Yanjun Guoa, Juan Lia, Jie Zhangb,c, Wenliang Xua,c,∗ a b c

Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan, 430079, China State Key Laboratory of Cotton Biology, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang, Henan, 455000, China Zhengzhou Research Base, State Key Laboratory of Cotton Biology, Zhengzhou University, Zhengzhou, 450001, China

ARTICLE INFO

ABSTRACT

Keywords: Cotton GhFSN5 Secondary cell wall NAC protein Negative regulation Transgenic Arabidopsis

NAC domain transcription factors (TFs) are plant-specific transcriptional regulators, some of which play crucial roles in secondary cell wall (SCW) biosynthesis in plants. Cotton is one of the most important natural fiber producing crops, whose mature fiber SCW contains more than 90% cellulose with very small amounts of xylan and lignin, but little is known about the molecular mechanism underlying fiber SCW formation. We previously identified seven fiber preferentially expressed NAC members, GhFSN1-7. One, GhFSN1, was demonstrated to positively regulate fiber SCW thickening, but the functions of other GhFSN members remain unknown. In this study, roles of GhFSN5 were dissected. qRT-PCR analysis showed that GhFSN5 was predominantly transcribed during the fiber SCW thickening stage. In addition, a large number of fiber SCW biosynthetic genes and SCWrelated TFs were co-expressed with GhFSN5. Heterologous expression of GhFSN5 in Arabidopsis resulted in plants with smaller siliques and severe sterility. Anther dehiscence in transgenic lines was not substantially affected, but most pollen was collapsed and nonviable. Furthermore, cellulose and lignin contents in inflorescence stems as well as roots were reduced in transgenic lines, compared with the wild type. Moreover, a set of SCW biosynthetic genes for cellulose, xylan and lignin and several transcription factors involved in regulation of SCW formation were down-regulated in transgenic plants. Our findings indicate that GhFSN5 acts as a negative regulator of SCW formation and anther development and expands our understanding of transcriptional regulation of SCW biosynthesis.

1. Introduction The shape and function of plant cells are largely defined by the cell wall. Nearly all plant cells have a primary cell wall (PCW) that is thin and extensible to allow for expansion. In contrast to the PCW, thick and rigid secondary cell walls (SCWs) are deposited in specific tissues, such as fibers, vessels, anthers and siliques after cessation of cell elongation. SCWs in fibers provide mechanical strength to support the plants. Secondary walls in vascular vessels help withstand water pressure, whereas secondary walls in anthers and siliques are required for dehiscence. Furthermore, SCWs represent the most abundant renewable plant biomass for biofuel production (Mitsuda et al., 2005; Kumar et al., 2016).

Typical SCWs are mainly composed of three types of biopolymers — cellulose, hemicellulose and lignin. Synthesis of these polymers requires biosynthetic genes to be orchestrated both temporally and spatially by SCW-specific transcription factors. Transcriptional regulation of SCW biosynthesis has been extensively studied in some model plants such as Arabidopsis and rice. A great number of TFs have been identified and act as crucial regulators in SCW formation. A multi-tier transcriptional regulatory network has been proposed, in which the vast majority of TFs belong to two families: the NAC family and the MYB family (Zhong et al., 2010; Kumar et al., 2016). NAC (for NAM, ATAF1/2, and CUC2) domain transcription factors are plant specific and characterized by an N-terminal conserved NAC domain, which is associated with DNA binding, dimer formation and nuclear localization, and a C-terminal

Corresponding author. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan, 430079, China. E-mail address: [email protected] (W. Xu). 1 These authors contributed equally to this work. ∗

https://doi.org/10.1016/j.plaphy.2019.11.030 Received 30 August 2019; Received in revised form 29 October 2019; Accepted 18 November 2019 Available online 20 November 2019 0981-9428/ © 2019 Elsevier Masson SAS. All rights reserved.

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

highly divergent transcription regulatory region (TRR) to activate or repress transcription. In Arabidopsis, 138 NAC genes have been identified, and ten belonging to a same subgroup have been reported to regulate SCW biosynthesis in diverse cell types. These ten NAC domain TFs are VND1-VND7, NST1, NST2 and NST3 (also known as SND1). They are located at the top level of the transcriptional network, in which VND1-7 specifically regulate vessel SCW formation and NST1-3 regulate fiber SCW synthesis. These ten NAC-domain proteins are functionally characterized as master regulators of SCW biosynthesis because overexpression of any one of them is capable of inducing ectopic deposition of SCW in various cells and induces expression of a suite of SCW biosynthetic genes (Kubo et al., 2005; Mitsuda et al. 2005, 2007; Zhong et al., 2006; Endo et al., 2015). Subsequent studies have shown that homologs of VND1-7 or NST1-3 from many other plant species such as poplar, rice, maize, Brachypodium distachyon have a similar regulatory role in SCW formation, as heterologous expression of these VND1-7 related or NST1-3 related genes can induce ectopic SCW deposition (Zhong et al. 2010, 2011; Valdivia et al., 2013). These findings indicate that VND and NST-like proteins are functionally conserved among vascular plants (Zhong et al., 2010). Cotton is one of the most important economic fiber crops in the world. It produces the majority of natural fiber on earth. Cotton seed fibers are differentiated from ovule epidermal cells and its development can be divided into five continuous and overlapping stages: initiation, PCW formation, transition, SCW thickening, dehydration and maturation (Haigler et al., 2012). The normal cotton fiber secondary wall has the highest percentage of cellulose known in plants (> 90%). A key feature of industrially useful cotton fiber is an intermediate thickness of the secondary wall relative to the fiber diameter. The degree of secondary wall thickening is highly correlated with fiber yield, fiber strength, dyeing intensity, and water absorption. In addition, cellulose quantity and physical characteristics are of great importance to almost every aspect of fiber industrial use (Haigler et al., 2012). Furthermore, though very small amount of lignin is present in fiber, Han's work showed that lignin may substantially impact cotton fiber quality as an increase of lignin content could improve fiber fineness and strength (Han et al., 2013). However, the biosynthesis of fiber lignin must be controlled to a desirable level since it might increase the fiber rigidity as well, which is unfavorable for fiber spinnability (Han et al., 2013). These results indicate that improvement of fiber quality and quantity could be achieved by genetic manipulation of genes involved in regulation of fiber SCW biosynthesis. Despite the importance of fiber SCW, our knowledge of the precise regulatory mechanisms that bring about these SCW components is very limited, and TFs involved in cotton fiber SCW thickening remain largely unknown. In 2015, a milestone year for cotton research, two independent research groups separately published the whole genome sequences of G. hirsutum, the most widely cultivated tetraploid cotton species (Li et al., 2015; Zhang et al., 2015). This made the comprehensive analyses of TFs possible at the whole genome level. 306 putative NAC-domain containing TFs were identified in G. hirsutum genome (Zhang et al., 2015). Many NAC genes were isolated and functionally characterized. However, most reported NAC genes have been shown to be involved in modulating cell responses to biotic and abiotic stresses and response to pathogens, such as GhNAC8-GhNAC17 (Shah et al., 2013), GhNAC12 (Zhao et al., 2016), GhNAC2 (Gunapati et al., 2016), GhATAF1 (He et al., 2016), and GhNAC79 (Guo et al., 2017). NAC TFs that control fiber SCW thickening remain to be determined. Recently, Tuttle et al. compared the fiber transcriptomes and metabolomes of Gossypium barbadense and G. hirsutum and demonstrated that cotton fibers express genes that share high identity with Arabidopsis SCW transcriptional regulators namely NST1, SND2 and SND (Tuttle et al., 2015). More recently, MacMillan et al. compared transcriptomes from cotton xylem and pith as well as from a developmental series of seed fibers and found several NAC transcription factors homologous to AtNST1/2/3 as putative regulators of SCW formation in seed fibers (MacMillan et al., 2017).

However, none of these NAC-domain containing genes has been functionally verified. In previous work, we isolated seven putative fiber SCW-related NAC genes, which we designated GhFSN1-7. Of the seven cotton NAC genes, GhFSN1 was shown to participate in modulating SCW biosynthesis of seed fibers as a positive regulator (Zhang et al., 2018). The other six GhFSNs remain functionally uncharacterized. Here, we show that a cotton NAC domain TF, GhFSN5, is a negative transcriptional regulator controlling secondary wall synthesis in transgenic plants. GhFSN5 is expressed preferentially during fiber SCW thickening stage. The activity of GhFSN5 promoter is strong in stems and anthers. Heterologous expression of GhFSN5 in Arabidopsis leads to a reduction in the secondary wall thickening of various tissues and defects in anther development. Moreover, expression of GhFSN5 results in downregulation of the expression of a suite of SCW-associated genes. Taken together, our results demonstrate that GhFSN5 is a transcriptional repressor involved in secondary wall biosynthesis and anther development. 2. Materials and methods 2.1. Plant material and growth conditions Arabidopsis thaliana (ecotype Columbia) seeds were surface-sterilized with 75% ethanol and 5% NaClO, placed on half-strength Murashige and Skoog (MS) solid plates at 4 °C for three days and grown in a growth chamber at 22 ± 1 °C with 16 h light/8 h dark photoperiod. Seven days later the seedlings were transplanted into pots. Tissues for RNA extraction were derived from 6-week-old plants. Cotton (Gossypium hirsutum cvs. Coker 312) seeds were surface-sterilized and grown as described previously (Qin et al., 2017). 2.2. Sequence analysis of GhFSN5 Gh_D08G1172 (named as GhFSN5 in this study) and Gh_A08G0961 is a homoeologous pair in allotetraploid cotton. A pair of consensus primers were employed to amplify both Gh_A08G0961 and Gh_D08G1172 full length coding regions using 20 DPA fiber cDNA as template. The forward primer is 5′-ATGTCAGAAGAAATGAATCTATC AAT-3′, the reverse primer is 5′-TTATACCGACAGGTGGCACAAG-3’. PCR amplified products were subcloned into pBluescript. Four clones were randomly picked and sequenced. The four sequences all correspond to Gh_D08G1172. Multiple sequence alignments were performed with clustal W. A neighbor-joining phylogenetic tree of 19 cotton NAC proteins and homologous NAC proteins from Arabidopsis, maize, rice, poplar and Brachypodium was constructed using MEGA7.0 with 1000 bootstraps. The phylogenetic tree was manifested by iTOL (http://itol. embl.de/) with default settings. Interactive SALAD (Surveyed conserved motif ALignment diagram and the Associating Dendrogram) analysis (http://salad.dna.affrc.go.jp/CGViewer/en/cgv_upload.html) was applied to investigate the conserved motifs of full-length aminoacid sequences of NAC proteins. Co-expression analysis was performed using a database of co-expression networks with functional modules for diploid and polyploidy Gossypium (http://structuralbiology.cau.edu. cn/gossypium/). 2.3. Construction of GhFSN5 overexpression vector and complementation of the nst1nst3 double mutant To construct GhFSN5 overexpression vector, the full-length cDNA was subcloned into pBI121. The vector was introduced into Agrobacterium tumefaciens GV3101 and transgenic Arabidopsis plants were produced by floral dip. Seeds were harvested and stored at 4 °C. Transgenic plants were PCR examined and two independent lines in the T3 generation were selected for further analysis. To construct GhFSN5 complementation vector, the full-length cDNA of GhFSN5 were cloned into modified pCAMBIA1301 under the control 304

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

of Cauliflower mosaic virus (CaMV) 35S promoter. The vector was transformed into the Arabidopsis nst1nst3 double mutant. Hygromycin resistant plants were further PCR checked and two independent lines in the T3 generation were selected for phenotype analyses.

in FAA solution [3.7% (v/v) formaldehyde, 5% (v/v) acetic acid, 50% (v/v) ethanol] at 4 °C for 12 h, dehydrated with an ethanol series [50% ethanol to 92% (v/v) ethanol], then subjected to 1% (w/v) phloroglucinol in 92% (v/v) ethanol for 5 min, then moved to a glass slide. 25% (v/v) HCl in glycerol was used to mount the flowers and red staining was immediately observed under a stereomicroscope.

2.4. Construction of the Promoter::GUS reporter cassette and GUS staining For the construction of the GUS reporter cassette, a 2023 bp sequence before translational initiation codon ATG of GhFSN5 coding region was PCR amplified from cotton genome and subcloned into the pBI101 vector. The forward primer is 5′-GGGGTCGACTTGTATCGTCT GTCAACTAC-3′, the reverse primer is 5′- CTTGGATCCTTCTTCTGACA TTACCCGAT-3’. The GhFSN5 promoter:GUS reporter construct was introduced into Agrobacterium tumefaciens GV3101 and transformed into Arabidopsis. Histochemical assays for GUS activity in transgenic Arabidopsis were conducted as described previously (Xu et al., 2013).

2.10. Data analysis The values shown are means ± SE of three independent biological measurements. All data were analyzed by Student's t-test and a comparison of the means was conducted using the Least Significant Difference (LSD) test at the 0.05 probability levels. 3. Results GhFSN5 is highly expressed during fiber SCW thickening stage and co-expressed with a large number of fiber SCW-related genes. In our previous study, we identified seven fiber SCW-related NAC TFs, namely GhFSN1-7, that were co-expressed with each other (Zhang et al., 2018). In this study, GhFSN5 was selected for functional analysis. qRT-PCR analysis showed that GhFSN5 had the highest transcript level in 15 DPA fibers (Fig. 1A). Although the transcript abundance declined in 18 DPA to 20 DPA fibers, a fairly high level was still maintained, suggesting this gene may function in regulating fiber SCW formation. Besides fiber, GhFSN5 was also highly expressed in the hypocotyl (Fig. 1A). Phylogenetic relationship analysis and SALAD analysis revealed that GhFSN5 was clustered with AtNST1, AtNST2 and AtNST3. Motif comparison indicated that they contain identical N-terminal NAC domains (Fig. 1C, Supplemental Fig. S1). In addition, co-expression analysis showed that GhFSN5 (Gh_D08G1172) was co-expressed with several fiber SCW biosynthetic genes and SCW- associated transcriptional regulators, such as xylan biosynthesis related genes (DUF579, DUF231, GUX and IRX8), lignin related genes (COMT), and SCW regulator-like gene (NST1) (Fig. 1B, Supplemental Table S1). Together, these results imply that GhFSN5 may function in regulating SCW biosynthesis.

2.5. RNA extraction and RT-PCR analysis Tissues such as roots, hypocotyls, and cotyledons for RNA extraction were cut from 5-day-old cotton seedlings, stems and leaves were from 3-week-old plants, while anthers, petals, fibers, and ovules were from cotton plants grown in a greenhouse. On the day of anthesis, flower buds were tagged as 0 day post anthesis (DPA) and the corresponding bolls were harvested at 3, 6, 10, 15, 18, 20 days later. Fibers were separated from ovules, immediately frozen in liquid nitrogen, and stored in −80 °C. Total RNA was extracted as described previously (Xu et al., 2013). Quantitative reverse transcription polymerase chain reaction (qPCR) was performed as previously described (Qin et al., 2017). 2.6. Sectioning of stems and roots and microscopy analysis Paraffin-embedded stems and roots were performed as described previously (Li et al., 2014). For lignin staining, sections were stained with phloroglucinol-HCl. Calcofluor white and pontamine fast scarlet 4B (S4B) were used for cellulose staining. Briefly, sections were stained in 0.01% Calcofluor white for 30 s, washed gently with water, then mounted in 50% glycerol and observed under UV excitation using a Leica confocal laser scanning microscope. Sections were stained for 5 min in S4B [0.1% (w/v) in 150 mM NaCl], washed carefully with water, then mounted in 10% glycerol and excitation at 561 nm using a Leica confocal laser scanning microscope (Huang et al., 2016).

3.1. Promoter::GUS analysis of GhFSN5 in transgenic Arabidopsis To further investigate the spatiotemporal expression patterns of GhFSN5, a 2023-bp fragment upstream of the GhFSN5 translation start codon (ATG) was isolated, and a GhFSN5 promoter:GUS reporter vector was transformed into Arabidopsis. Transgenic Arabidopsis plants harboring GhFSN5 promoter-GUS constructs were generated and histochemical assays were performed in various tissues at different developmental stages using T3 generation plants. In 10-day-old seedlings, GUS staining was only visible in roots. After transition to the reproductive growth phase, in 6-week-old plants, GUS expression driven by the promoter was most intense in stems, anthers and stigma (Fig. 2B and C, 2H). Cross section of stem showed that GUS staining was mainly accumulated in xylem cells, weak staining was also observed in the interfascicular fibers (Fig. 2I). For siliques, GUS staining was strong at the base, and strong GUS staining was also visible in the fruit stalk (Fig. 2G). GUS staining was not observed in rosette leaves but sporadic staining spots were seen in cauline leaves, and weak staining also occurred in lateral roots (Fig. 2A, 2D-F). As xylem and fiber cells in stems and anther endothecium undergo extensive SCW thickening, this expression pattern suggests that GhFSN5 might be implicated in SCW biosynthesis. Expression of GhFSN5 in Arabidopsis decreased SCW deposition in stems and roots and down-regulated the expression of a set of SCWassociated genes. GhFSN5 is highly homologous to AtNST1 and AtNST2, two master switches of SCW biosynthesis in Arabidopsis, and it has been shown that overexpression of AtNST1/2 in Arabidopsis caused ectopic SCW

2.7. Cell wall extraction and crystalline cellulose analysis Extraction of alcohol-insoluble residues (AIR) was performed according to Qin et al. (2017). Cell wall crystalline cellulose content was measured as described previously (Huang et al., 2016). In brief, destarched AIR was hydrolyzed with 2 M trifluoroacetic acid (TFA) for 90 min at 121 °C. The remaining residue was washed with acetic-nitric acid solution (HOAc/H2O/HNO3, 8:2:1, v/v/v). Then the air-dried residue was hydrolyzed with 72% sulfuric acid for 30 min at room temperature, the resulting monosaccharides released quantified with anthrone method. 2.8. Pollen viability assay Pollen viability was examined by double staining with FDA and PI as reported previously (Li et al., 2013). The stained pollen grains were visualized under UV illumination. Pollens displaying green fluorescence were viable and those displaying red were nonviable. 2.9. Histochemical assay of lignin in inflorescences Phloroglucinol-HCl staining of inflorescences was performed as described previously (Mizuno et al., 2007). In brief, flowers were fixed 305

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 1. Molecular characterization of GhFSN5. (A) Expression level of GhFSN5 in different cotton tissues. Cotton ubiquitin gene GhUBI1 was used for normalization. Values shown are means ± SE of triplicate assays. 1 DPA O, Ovule in 1 day post-anthesis; 3 DPA O, Ovule in 3 days post-anthesis; 10 DPA O, Ovule in 10 days post-anthesis; 6 DPA F, Fiber in 10 days postanthesis; 10 DPA F, Fiber in 10 days post-anthesis; 15 DPA F, Fiber in 15 days post-anthesis; 18 DPA F, Fiber in 18 days post-anthesis; 20 DPA F, Fiber in 20 days postanthesis. (B) Co-expressed genes with GhFSN5 (Gh_D08G1172). Protein in yellow elliptic box represents query protein. Proteins in green hexagon boxes represent interaction proteins. Pink interaction line indicates protein has interaction and positive co-expression relationship with target protein. In the network, Gh_A11G0915 was annotated as an AtNST1 homolog, Gh_D11G0506, Gh_D12G0677 and Gh_A11G0434 were annotated as homologs of DUF579 domain proteins. Gh_A13G2180 and Gh_D04G0657 were annotated as homologs of DUF231 domain proteins; Gh_D13G1495, Gh_A01G0568 and Gh_Sca063168G01 were annotated as galacturonosyltransferase homologs; Gh_A12G2227 and Gh_D08G1135 were annotated as caffeic acid/5-hydroxyferulic acid O-methyltransferase homologs. (C) SALAD dendrogram using cotton GhFSN proteins and homologous proteins from other monocot and dicot plants (left panel). (right panel) Motif structure comparison using interactive SALAD analysis (http://salad.dna.affrc.go.jp/CGViewer/en/cgv_upload.html). Green number indicates bootstrap value, gray number denotes node number. . (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

deposition in diverse tissues (Mitsuda et al., 2005). In order to investigate whether GhFSN5 plays a similar role, we constructed an overexpression vector and transformed into Arabidopsis. At least twenty-five independent transgenic lines were obtained. The most striking difference observed was that siliques from most transgenic lines were much smaller and contained much less seeds when compared with the wild type, indicating that overexpression of GhFSN5 resulted in strong sterility (Fig. 3). Two independent transgenic lines with strong expression of GhFSN5 in the T3 generation were selected for further phenotypic analyses (Fig. 3). To investigate if GhFSN5 is also a positive regulator of SCW formation, freehand cross sections from the basal part of 6-week-old stems were visualized under UV illumination. Cells containing lignin show autofluorescence under UV light. Unexpectedly, the fluorescence distribution was similar between transgenic lines and the wild type. No ectopic deposition of lignin was detected in the transgenic lines

(Supplemental Fig. S2). We also constructed a complementation vector carrying GhFSN5 and introduced into the nst1nst3 double mutant, which was pendent due to loss of SCW thickening of interfascicular fibers of inflorescence stems (Mitsuda et al., 2007). Observation of cross sections of nst1nst3 inflorescence stems revealed that lignified materials represented by autofluorescence were completely lost in interfascicular fibers, but present in vascular vessels. Expression of GhFSN5 in the nst1nst3 background did not rescue the autofluorescence in interfascicular fibers of the double mutant, and the complemented lines were pendent resembling the double mutant (Supplemental Fig. S3). These findings indicate that GhFSN5 is not a functional homolog of AtNST1/2. Detailed paraffin-embedded cross sections of 6-week-old stems of GhFSN5-overexpressing transgenic lines were stained with toluidine blue and average wall thickness of xylem and interfascicular fiber cells was measured. As shown in Fig. 4, though thickness of xylem vessel cell 306

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 2. Promoter::GUS analysis of GhFSN5 in transgenic Arabidopsis. (A) 10-day-old seedling. (B) Inflorescence. (C) Flower. (D) 6-week-old root. (E) Cauline leaf. (F) Rosette leaf. (G) 6-week-old silique. (H) Stem. (I) Cross-section of stem. if represents interfascicular fiber, xy denotes xylem cell. Bar = 100 μm. Fig. 3. Phenotypic analyses of GhFSN5 overexpression transgenic plants. (A) Seven-week-old plants. WT represents wild type, L10 and L21 represent two independent transgenic lines. (B) Representative image of a branch carrying siliques. (C) Representative image of siliques. (D) Seeds in one silique. (E) Statistical analysis of seed number per silique, values are means ± SE; n ≥ 15, Significance was determined by Student's t-test, ** indicates significant difference between wild type and overexpression lines, P < 0.01. (F) qRT-PCR analysis of GhFSN5 in stems of wild type and two overexpression transgenic lines.

wall showed no obvious change, the cell wall thickness of both the xylem fibers and interfascicular fibers in transgenic stems was markedly thinner than those of the wild type, suggesting less SCW deposition in transgenic lines. To further examine if cell wall components were affected, cross sections of stems were stained with S4B and Calcofluor white (to visualize cellulose) and observed with laser confocal microscope. For both dyes, the fluorescence intensity was much weaker in the xylem and in the interfascicular fibers in transgenic lines compared to the wild type (Fig. 5), which suggests that cellulose level in the transgenic line was lower. Crystalline cellulose content determination confirmed that reduction in cellulose amount in transgenic plants (Supplemental Fig. S4). Phloroglucinol staining of lignin also had the similar results. Lighter staining was observed in transgenic lines (Fig. 5), indicating that the transgenic lines had less lignin. Additionally, cross sections of 6-week-old primary roots were stained with S4B. As shown in Fig. 6, lighter fluorescence was observed in vessels in transgenic roots as compared with the wild type. Altogether, these results showed that a reduction of SCW deposition occurred in overexpression lines. Given that AtNST1/2 have been linked to SCW regulation and that AtNST1/2 overexpression upregulated a set of transcripts related to SCW biosynthesis, we examined whether or not GhFSN5 influenced

transcript accumulation of SCW biosynthesis-associated genes (Mitsuda et al., 2005; Zhong et al., 2006). qPCR analysis showed that relative expression level of SCW cellulose synthase subunit A genes (CESA4, CESA7 and CESA8), xylan biosynthetic genes (IRX9 and IRX10), and lignin biosynthetic genes (C4H, 4CL1, CCoAOMT, CCR and COMT) in stems of the transgenic lines overexpressing GhFSN5 declined as compared with the wild type (Fig. 7). In addition, several transcription factors involved in regulation of SCW biosynthesis (NST1, NST2, NST3, MYB46 and MYB83) also showed reduced expression in transgenic lines relative to the wild type (Fig. 7). Similar results were obtained in roots (Supplemental Fig. S5), suggesting that expression of GhFSN5 can repress mRNA levels of a set of SCW biosynthetic genes and SCW-related transcription factors. 3.2. Expression of GhFSN5 in Arabidopsis caused defects in anther development It was previously shown that mutation of AtNST1 and AtNST2 caused severe sterility because of anther indehiscence due to absence of secondary wall thickening in anther endothecium, indicating that AtNST1 and AtNST2 regulated anther dehiscence by promoting secondary wall thickening in the anther wall (Mitsuda et al., 2005). As 307

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 4. Cell wall thickness of xylem cells and interfascicular fibers in the 6-week-old stems of wild type and GhFSN5-overexpressing transgenic lines. To determine average wall thickness of xylem and interfascicular fiber cells, the micrographs (A) were analyzed using Image J by measuring the thickness of the cell wall in the middle of the edge of adjacent cells. Values are means (μm) ± SE from 30 cells from wild type and two transgenic lines (B). xv denotes xylem vessel, xf denotes xylem fiber, if denotes interfascicular fiber. Bar = 50 μm ** indicates significant difference between the transgenic lines and the wild type (t-test, p < 0.01).

transgenic plants overexpressing GhFSN5 had shorter siliques and less seeds, we examined if GhFSN5 affected anther dehiscence and pollen emission. Open flowers were observed under a stereomicroscope, and no apparent difference was found for the morphology of pistil or stamen. However, lots of pollen grains were observed to adhere to the surface of the style part below the stigma in wild type, but negligible pollen could be seen for transgenic lines. Pollen grains were easily released from the wild type anthers whereas much less pollen emissions were observed in transgenic anthers (Fig. 8). To examine whether the impairment of pollen emission was due to anther indehiscence, anthers were observed under UV illumination. Wild type anther showed the netlike autofluorescence of lignin under UV light. On the contrary, lighter fluorescent net-like structure of lignified materials was found in the transgenic lines. Thus, it seems that defects in SCW thickening occurred in anther endothecium of transgenic flowers. However, further scanning electron microscopy of anthers showed that anther dehiscence was not substantially affected in transgenic lines, but stomiums in anther endothecium in transgenic lines were not as wide as that of the wild type. Furthermore, many pollen grains in transgenic lines were collapsed and shrunken in transgenic anthers (Fig. 9). To further check the viability of pollens, we stained the pollen grains with FDA/PI and imaged under UV illumination (Fig. 10). It was found that most of the pollen grains (70–85%) from transgenic lines were red (not viable). On the contrary, over 90% wild type pollens are green (viable). To further know if lignin level in pollen was reduced, inflorescences from wild

type and transgenic lines were collected and stained with phloroglucinol-HCl. As shown in Fig. 11, wild type flowers displayed stronger phloroglucinol staining, whereas overexpression lines showed weaker staining, which suggests that more lignin deposited in wild type than in transgenic lines. These findings indicated that expression of GhFSN5 did affect anther development. 4. Discussion Previously we identified seven NST genes preferentially expressed in fibers undergoing SCW thickening (Zhang et al., 2018). In fact there are seven pairs of homoeologous NST genes in G. hirsutum genome (Fig. 1C, Supplemental Fig. S1). For each pair, one is from A subgenome, the other is from D subgenome. When we referred to the gene from A subgenome as GhFSN, the counterpart in D subgenome was named GhFSNL and vice versa (Fig. 1C, Supplemental Fig. S1). It is very interesting to note that all the seven pairs of NST genes showed obvious expression bias, only one gene from one subgenome exhibited fiber preferential expression (Zhang et al., 2018). In this study, both the phylogenetic relationship based on sequence identity and SALAD dendrogram based on motif composition showed that GhFSN1, GhFSN3 and GhFSN4 clustered into a subgroup, and GhFSN2, GhFSN5, GhFSN6 and GhFSN7 clustered into another subgroup. These two subgroups cluster with AtNST1, AtNST2 and AtNST3/SND1 and comprise a group, which suggests that GhFSN1-7 may perform similar functions as their 308

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 5. GhFSN5 overexpression resulted in a decrease in cellulose and lignin levels in stems. (A–F) Stem paraffin-embedded cross sections stained with Pontamine fast scarlet 4B (S4B). (G–L) Cross sections stained with Calcofluor white. (M–R) Phloroglucinol staining of stem cross-sections. WT, wild type; L10 and L21, two overexpression transgenic lines, xy, xylem; if, interfascicular fiber; bar = 50 μm.

Arabidopsis counterparts. Here, we show that GhFSN5 expression in Arabidopsis led to decreased SCW thickening in xylem and interfascicular fiber cells and anther defects, which suggests that GhFSN5 functions as a negative regulator of SCW formation and anther development. This finding contrasts with our initial hypothesis but expands our understanding on transcriptional regulation of SCW biosynthesis as none of AtNST1/2 homologs in various plants has been shown to be SCW transcriptional repressors. Promoter-GUS analysis showed that strong GUS staining was accumulated in stems and anthers that are undergoing secondary wall thickening. The promoter activity observed in stems and anthers suggests that GhFSN5 may be involved in secondary wall formation and anther development. In order to gain insights into its biological roles, due to the labor-intensive and time-consuming process of cotton

transformation, we took advantage of the heterologous Arabidopsis system as Arabidopsis xylem is a preferred model for the secondary wall thickening stage of cotton fiber development (Betancur et al., 2010). It was found that the growth rate and overall size of the GhFSN5-overexpressing (OE) lines were similar as that of the wild type, the OE plants showed severe sterility, much shorter siliques and conspicuously reduced seeds (Fig. 3). Anther indehiscence caused by loss of SCW thickening in anther endothecium, as illustrated in nst1nst2 double mutant, is a reason to result in sterility (Mitsuda et al., 2005). Our results demonstrated that GhFSN5 did not substantially control anther dehiscence, unlike nst1nst2 double mutant, though secondary wall thickening in the anther wall was somewhat inhibited to a certain extent. In addition, several reports have illustrated that SCW biosynthesis is associated with flower development and the two different biological

309

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 6. GhFSN5 expression led to a reduction of cellulose and lignin deposition in roots. (A–C) root paraffin-embedded cross-sections stained with S4B. (D–F) UV-autofluorescence of root paraffin-embedded cross-sections. WT, wild type; L10 and L21, two overexpression transgenic lines, xv, xylem vessel, Bar = 50 μm.

processes can be concomitantly regulated by one transcription factor in Arabidopsis. For example, Chai et al. (2014) identified 81 pairs of R2R3-MYB genes in Populus, in which three pairs: PdMYB10/128 (AtMYB103 homolog), PdMYB90/167 (AtMYB52 homolog), and PdMYB92/125 (AtMYB42 homolog) were predominantly expressed in xylem. Overexpression of PdMYB10/128 in Arabidopsis enhanced SCW deposition in stem fibers and delayed flowering whereas expression of PdMYB90/167 or PdMYB92/125 in Arabidopsis reduced SCW thickening in stem fibers and vessels and promoted flowering. Very interestingly, no matter whether the SCW thickening is increased or decreased, overexpression of these six genes all caused less fertility and less seeds in shorter siliques (Chai et al., 2014). However, in our study, expression of GhFSN5 did not delay or promote flowering in transgenic Arabidopsis. A1though the wild type plants seem to have completed flowering while the transgenic lines are still blooming (Fig. 3A). In fact, flowering of GhFSN5 overexpressing lines and wild type plants began at the same developmental stage. However, transgenic lines had a longer blooming period. As the transgenic lines had a much lower number of seeds compared with the wild type, we hypothesized that the long lasting flowering stage could have been a compensatory mechanism of the impaired seed production in transgenic lines. In addition, Chai et al. (2015) also found that two plant tandem CCCH zinc finger (TZF) proteins, C3H14 and C3H15, when overexpressed, led to ectopic deposition of secondary walls in the epidermal cells of various tissues. But the c3h14c3h15 double mutant had lower fertility not due to defects in secondary wall thickening in anther dehiscence zones but because of few pollen grains. Further microarray analysis indicated that C3H14 and C3H15 affect anther development possibly by regulating genes related to pollen development (Chai et al., 2015). Whether GhFSN5 employs a similar mechanism needs to be further studied. Closely related NAC transcription factors, NSTs and VNDs, which are phylogenetically classified into separate branches but in the same subfamily, function as master regulators of secondary wall thickenings in plants. The members of the VND and NST groups in rice, maize and

Brachypodium distachyon are collectively referred to as secondary wall NAC proteins (SWNs). Heterologous expression of the SWN genes can induce ectopic SCW deposition. For example, rice NAC genes (OsSWN1, OsSWN3 and OsSWN7), maize NAC genes (ZmSWN1, ZmSWN3, ZmNST4, ZmSWN6 and ZmSWN7) (Zhong et al., 2011; Yoshida et al., 2013; Xiao et al., 2018), and Brachypodium NAC gene (BdSWN5) (Valdivia et al., 2013). In addition, when expressed in nst1nst3 double mutant driven by the NST3 promoter, they also can rescue the pendent phenotype of the mutant. These results indicate that they are functional orthologues of AtNST1/2/3 and act as positive regulators of secondary wall formation. Because GhFSN5 and AtNST1/2/3 are quite closely related to each other, we hypothesized that they perform similar functions. By contrast, our results showed that GhFSN5 expression in Arabidopsis did not induce ectopic SCW formation in any cells but inhibits SCW synthesis in both xylem fibers and interfascicular fibers. In this study, expression of GhFSN5 under the control of CaMV 35S promoter did not rescue the drooping phenotype of the nst1nst3 double mutant. Previous studies have showed that overexpression of MYB58, MYB63, MYB103 in Arabidopsis induced ectopic lignification, but they were not able to restore the pendent phenotype of nst1nst3 double mutant. The authors proposed that either these genes lack appropriate co-factors in fibers or they may be transcriptional repressors (Sakamoto and Mitsuda, 2015). In this case, GhFSN5 is more likely to be a transcriptional repressor as its expression in Arabidopsis reduced SCW formation. Our SALAD analyses revealed GhFSN2/5/6/7 clustered into a subclade; GhFSN1/3/4 and AtNST1/2/3 grouped into another subclade (Fig. 1C). These GhFSNs’ motif compositions are identical at the N-terminus, however, their C-terminal regions are highly diversified. For example, with regard to GhFSN1 and GhFSN5, other than three consensus motif 7, 6 and 12, GhFSN1 contains motif 21, 30, 24, 37, 42, whereas GhFSN5 harbours motif 25, 19, 13, 14, 9, 16 (Fig. 1C). Such variation might enable them to interact with different partners. These results implied that functional divergence might have occurred, and it is likely that GhFSN2/5/6/7 evolved subfunctionalization. The

310

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 7. GhFSN5 overexpression reduced the expression of SCW biosynthetic genes and SCW-related transcription factors in transgenic stems. qPCR analysis of expression of genes involved in the biosynthesis of cellulose (CESA4, CESA7 and CESA8), xylan (IRX9 and IRX10), and lignin (C4H, 4CL1, CCoAOMT, CCR and COMT) and transcription factors involved in regulation of SCW biosynthesis (NST1, NST2, NST3, MYB46 and MYB83) in stems of 6-week-old plants. WT represents wild type control, L10 and L21 represent two independent GhFSN5-overexpressing transgenic lines. The values are expressed as means ± SE of three independent assays. * indicates significant difference between wild type and transgenic lines (t-test, p < 0.05).

GhFSN5, it is very likely that an activator GhFSN1 induces a repressor GhFSN5 to balance SCW deposition. To prevent overly deposition of SCW or maintain an appropriate thickness of fiber SCW, the degree of secondary wall thickening must be tightly regulated by a sophisticated regulatory network. Both activator-type NAC and repressor-type NAC present in the network provide flexibility and accuracy in regulating fiber SCW synthesis. Secondary wall composition varies among different plant species and may change in response to developmental and environmental stimuli. This work can not absolutely rule out the possibility that GhFSN5 might function differently in cotton fiber. However, we show here GhFSN5 has the potential to regulate fiber SCW biosynthesis in cotton, one of the most important commercial fiber crops. Further functional characterization of GhFSN5 in cotton may provide new insights into the molecular mechanisms controlling secondary wall heterogeneity. With the increased understanding of genes involved in the transcriptional regulation of secondary wall components, the species-specific particular regulatory scheme will be revealed, and can be used to engineer SCWs to improve fiber quality and quantity.

regulation program of SCW formation is expected to be somewhat different in cotton fibers and Arabidopsis xylem as their secondary wall composition is quite different. The function of NST may differ in Arabidopsis and cotton accordingly, especially in cotton fibers which contain much greater proportions of cellulose than stems of Arabidopsis. This may be due to gene duplication and specialization in cotton. As many as 14 putative NST homologs are present in cotton, seven of which are preferentially expressed in fibers undergoing SCW thickening and some may have undergone subfunctionalization in cotton. Overexpression of GhFSN5 led to a decrease in stem SCW thickening and defect in anther development. This is very different from the NST overexpression phenotypes in Arabidopsis, which illustrates that the regulatory function of NST homologs may differ between Arabidopsis xylem and cotton fibers. To precisely regulate the complex and unique fiber SCW formation, some NAC genes appear to undergo functional divergence through interaction with different partners, with some being SCW positive regulators and others being negative regulators. As our previous work demonstrated that GhFSN1 was a positive regulator of fiber SCW formation and co-expressed with

311

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 10. Pollen viability assay. More viable pollen grains were present in the wild type anther (A) than in the two overexpression (OE) lines (B and C), bar = 100 μm, (D) statistical analysis of viable pollens between the wild type and the two OE lines. Data are means ± SE, n = 200, * indicates significant difference between wild type and overexpression lines, P < 0.05.

Fig. 8. Examination of floral structures. (A–C) micrographs of flowers from wild type and two overexpression transgenic lines, (D–F) Stamens from wild type and two overexpression transgenic lines, red arrow denotes pollen grains. Bars = 1 mm (A-C), 6 mm (D–F). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Fig. 9. Anthers observed by fluorescence microscope and scanning electron microscope. (A–C), the anthers of open flowers were observed under UV illumination. A net-like structure of lignified materials was found in the anther dehiscence zones of the wild type plants (A), but not so obvious in OE lines (B and C). Few pollen grains were released from OE anthers (B and C), and a lot of pollen grains were observed in wild type anther (A). (D–F); Scanning electron microscopy images of the anthers of the wild type (D), two overexpression (OE) lines (E and F). Red dotted lines were used to mark the stomium. The stomium in the wild type endothecium is wider than those of the OE lines. (G–I) Scanning electron microscopy images of pollens from wild type (G), two OE lines (H and I), white arrows in (A) show the released pollens while in (H) and (I) show the collapsed pollens. Bars = 100 μm (A–F), 20.0 μm (G–I). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

312

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al.

Fig. 11. Phloroglucinol-HCl staining of wild type and GhFSN5 overexpressing inflorescences. Wild type flowers displayed stronger phloroglucinol staining, whereas overexpression lines showed lower staining which suggests that more lignin deposited in wild type than in transgenic lines. Flower in the big box is a magnified version of flower in small box in each image. WT represents wild type, L10 and L21 represent two independent GhFSN5-overexpressing transgenic lines.

Author contributions

model for cell wall and cellulose research. Front. Plant Sci. 3, 104. Han, L., Li, Y., Wang, H., et al., 2013. The dual functions of wlim1a in cell elongation and secondary wall formation in developing cotton fibers. Plant Cell 25, 4421–4438. He, X., Zhu, L., Xu, L., Guo, W., Zhang, X., 2016. GhATAF1, a NAC transcription factor, confers abiotic and biotic stress responses by regulating phytohormonal signaling networks. Plant Cell Rep. 35, 2167–2179. Huang, J., Chen, F., Wu, S., Li, J., Xu, W., 2016. Cotton GhMYB7 is predominantly expressed in developing fibers and regulates secondary cell wall biosynthesis in transgenic Arabidopsis. Sci. China Life Sci. 59, 194–205. Kubo, M., Udagawa, M., Nishikubo, N., et al., 2005. Transcription switches for protoxylem and metaxylem vessel formation. Genes Dev. 19, 1855–1860. Kumar, M., Campbell, L., Turner, S., 2016. Secondary cell walls: biosynthesis and manipulation. J. Exp. Bot. 67, 515–531. Li, F., Fan, G., Lu, C., et al., 2015. Genome sequence of cultivated Upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution. Nat. Biotechnol. 33, 524–530. Li, L., Huang, J., Qin, L., et al., 2014. Two cotton fiber-associated glycosyltransferases, GhGT43A1 and GhGT43C1, function in hemicellulose glucuronoxylan biosynthesis during plant development. Physiol. Plant. 152, 367–379. Li, Y., Jiang, J., Du, M., Li, L., Wang, X., Li, X., 2013. A cotton gene encoding MYB-Like transcription factor is specifically expressed in pollen and is involved in regulation of late anther/pollen development. Plant Cell Physiol. 54, 893–906. MacMillan, C.P., Birke, H., Chuah, A., et al., 2017. Tissue and cell-specific transcriptomes in cotton reveal the subtleties of gene regulation underlying the diversity of plant secondary cell walls. BMC Genomics 18, 539. Mitsuda, N., Iwase, A., Yamamoto, H., et al., 2007. NAC transcription factors, NST1 and NST3, are key regulators of the formation of secondary walls in woody tissues of Arabidopsis. Plant Cell 19, 270–280. Mitsuda, N., Seki, M., Shinozaki, K., Ohme-Takagi, M., 2005. The NAC transcription factors NST1 and NST2 of Arabidopsis regulate secondary wall thickenings and are required for anther dehiscence. Plant Cell 17, 2993–3006. Mizuno, S., Osakabe, Y., Maruyama, K., Ito, T., Osakabe, K., Sato, T., Shinozaki, K., Yamaguchi-Shinozaki, K., 2007. Receptor-like protein kinase 2 (RPK2) is a novel factor controlling anther development in Arabidopsis thaliana. Plant J. 50, 751–766. Qin, L., Chen, Y., Zeng, W., et al., 2017. The cotton β-galactosyltransferase 1 (GalT1) that galactosylates arabinogalactan-proteins participates in controlling fiber development. Plant J. 89, 957–971. Sakamoto, S., Mitsuda, N., 2015. Reconstitution of a secondary cell wall in a secondary cell wall-deficient Arabidopsis mutant. Plant Cell Physiol. 56, 299–310. Shah, S., Pang, C., Fan, S., Song, M., Arain, S., Yu, S., 2013. Isolation and expression profiling of GhNAC transcription factor genes in cotton (Gossypium hirsutum L.) during leaf senescence and in response to stresses. Gene 531, 220–234. Tuttle, J.R., Nah, G., Duke, M.V., et al., 2015. Metabolomic and transcriptomic insights into how cotton fiber transitions to secondary wall synthesis, represses lignification, and prolongs elongation. BMC Genomics 16, 477. Valdivia, E., Herrera, M., Gianzo, C., et al., 2013. Regulation of secondary wall synthesis and cell death by NAC transcription factors in the monocot Brachypodium distachyon. J. Exp. Bot. 64, 1333–1343. Xiao, W., Yang, Y., Yu, J., 2018. ZmNST3 and ZmNST4 are master switches for secondary wall deposition in maize (Zea mays L.). Plant Sci. 266, 83–94. Xu, W., Zhang, D., Wu, Y., et al., 2013. Cotton PRP5 gene encoding a proline-rich protein is involved in fiber development. Plant Mol. Biol. 82, 353–365. Yoshida, K., Sakamoto, S., Kawai, T., et al., 2013. Engineering the Oryza sativa cell wall with rice NAC transcription factors regulating secondary wall formation. Front. Plant Sci. 4, 383. Zhang, J., Huang, G., Zou, D., et al., 2018. The cotton (Gossypium hirsutum) NAC transcription factor (FSN1) as a positive regulator participates in controlling secondary cell wall biosynthesis and modification of fibers. New Phytol. 217, 625–640. Zhang, T., Hu, Y., Jiang, W., et al., 2015. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement. Nat. Biotechnol.

WL Xu conceived the research and designed the experiments. QW Sun, JF Huang, YF Guo, MM Yang, and YJ Guo performed experiments and analyzed the data. J Li and J Zhang were involved in data analysis. WL Xu wrote the manuscript. Funding information This work was supported by National Natural Science Foundation of China, China [grant numbers: 31671735; 31371234], Hubei provincial Natural Science Foundation, China [grant number: 2016CFA071], and self-determined research funds of Central China Normal University from the colleges’ basic research and operation of Ministry of Education, China (CCNU18TS021).. Declaration of competing interest The authors declare that they have no conflict of interest. Acknowledgements We thank Dr. W. Zeng (Zhejiang A&F University, China) and Dr. B. Keppler for critical reading and modification of the manuscript. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.plaphy.2019.11.030. References Betancur, L., Singh, B., Rapp, R., et al., 2010. Phylogenetically distinct cellulose synthase genes support secondary wall thickening in arabidopsis shoot trichomes and cotton fiber. J. Integr. Plant Biol. 52, 205–220. Chai, G., Kong, Y., Zhu, M., et al., 2015. Arabidopsis C3H14 and C3H15 have overlapping roles in the regulation of secondary wall thickening and anther development. J. Exp. Bot. 66, 2595–2609. Chai, G., Wang, Z., Tang, X., et al., 2014. R2R3-MYB gene pairs in Populus: evolution and contribution to secondary wall formation and flowering time. J. Exp. Bot. 65, 4255–4269. Endo, H., Yamaguchi, M., Tamura, T., et al., 2015. Multiple classes of transcription factors regulate the expression of VASCULAR-RELATEDNAC-DOMAIN7, a master switch of xylem vessel differentiation. Plant Cell Physiol. 56, 242–254. Gunapati, S., Naresh, R., Ranjan, S., et al., 2016. Expression of GhNAC2 from G. herbaceum, improves root growth and imparts tolerance to drought in transgenic cotton and Arabidopsis. Sci. Rep. 6, 24978. Guo, Y., Pang, C., Jia, X., et al., 2017. An NAM domain gene, GhNAC79, improves resistance to drought stress in upland cotton. Front. Plant Sci. 8, 1657. Haigler, C., Lissete, B., Stiff, M.R., Tuttle, J., 2012. Cotton fiber: a powerful single-cell

313

Plant Physiology and Biochemistry 146 (2020) 303–314

Q. Sun, et al. 33, 531–537. Zhao, F., M, J., Li, L., et al., 2016. GhNAC12, a neutral candidate gene, leads to early aging in cotton (Gossypium hirsutum L). Gene 576, 268–274. Zhong, R., Demura, T., Ye, Z., 2006. SND1, a NAC domain transcription factor, is a key regulator of secondary wall synthesis in fibers of Arabidopsis. Plant Cell 18, 3158–3170.

Zhong, R., Lee, C., Ye, Z., 2010. Evolutionary conservation of the transcriptional network regulating secondary cell wall biosynthesis. Trends Plant Sci. 15, 625–632. Zhong, R., Lee, C., McCarthy, R., Reeves, C., Jones, E., Ye, Z., 2011. Transcriptional activation of secondary wall biosynthesis by rice and Maize NAC and MYB transcription factors. Plant Cell Physiol. 52, 1856–1871.

314