- Email: [email protected]
The Salvia miltiorrhiza NAC transcription factor SmNAC1 enhances zinc content in transgenic Arabidopsis
Gene 688 (2019) 54–61
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
The Salvia miltiorrhiza NAC transcription factor SmNAC1 enhances zinc content in transgenic Arabidopsis
T
Bin Zhua,1, Dong-Ao Huob,1, Xiao-Xiao Hongc, Juan Guoa, Tao Penga, Jie Liua, Xiao-Long Huanga, ⁎ ⁎ Hui-Qing Yana, Qing-Bei Wenga, Xiao-Cun Zhangd, , Xu-Ye Dua, a
School of Life Sciences, Guizhou Normal University, No. 116, Baoshanbei Street, Guiyang 550001, Guizhou Province, PR China Buckwheat Research Center, Guizhou Normal University, No. 116, Baoshanbei Street, Guiyang 550001, Guizhou Province, PR China c Basic Medical College, Guizhou Medical University, No. 27, Huayan Street, Guiyang 550025, Guizhou Province, PR China d College of Food Science and Engineering, Shandong Agricultural University, No. 61, Daizong Street, Taian 271000, Shandong Province, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Salvia miltiorrhiza NAC transcription factor Zinc content Transgenic Arabidopsis
NAC transcription factors play important roles in plant biological processes, including plant development, environmental stress responses and element enrichment. A novel NAC transcription factor gene, designated SmNAC1, was isolated from Salvia miltiorrhiza. SmNAC1 was localized in the nucleus in onion protoplasts and exhibited transcriptional activation activities in yeast. In addition, the SmNAC1 protein could specifically bind to the cis-elements of the NAC proteins. SmNAC1 was expressed at a higher level in the leaves of S. miltiorrhiza, indicating that SmNAC1 might be involved in the transportation of zinc. To examine the function of SmNAC1, transgenic Arabidopsis plants overexpressing SmNAC1 were generated. Zinc content assays in the transgenic plants demonstrated that overexpressed SmNAC1 plants had enhanced tolerance to high zinc concentrations, and zinc was enriched in the shoot tissues. Our results demonstrate that SmNAC1 plays important roles in the response to zinc stress. Zinc was mainly enriched in the leaves of S. miltiorrhiza and the shoot tissues of transgenic Arabidopsis plants. SmNAC1 might participate in zinc transportation from the roots to the shoots, that constitutes a useful gene for improving zinc content in plants.
1. Introduction Zinc (Zn) is an essential micro-nutrient required for a range of physiological and biochemical activities in animals and plants. Zn deficiency can cause internode shortening, leaf inward curling, and leaf size reducing (Broadley et al., 2007; Brune et al., 1994; Guerinot and Yi, 1994; Pinton et al., 1993). Transcription factors (TFs) play crucial roles in the regulation of target gene expression. The NAC (NAM, ATAF1/2, and CUC2) superfamily, which is one of the key gene expression regulators in plants, is one of the largest plant TF families (Olsen et al., 2005; Puranik et al., 2012; Nuruzzaman et al., 2013). Many NAC TFs have been reported to contribute to various developmental processes and stresses, such as senescence, flowering, fungal infection, drought, cold, and high salinity (Mitsuda et al., 2007; Uauy et al., 2006; Yoo et al., 2007; Nakashima et al., 2012).
Salvia miltiorrhiza Bge., also known as “Dan Shen”, grows widely in China and is a well-known traditional Chinese medicine. Owing to its remarkable biological activity and minimal side effects, it has been widely used for the treatment of disease of cardiovascular, cerebrovascular, dermatological and kidney (Zhao et al., 2010; Xu et al., 2015). Presently, there are more than 100 Chinese formulas and patent medicines containing Dan Shen as a critical material. Trace elements, such as iron (Fe) and Zn, are components of many medicinally relevant enzymes, such as antioxidant enzymes, and influence many metabolic processes. A large number of studies have indicated a relationship between the types and contents of the trace elements in S. miltiorrhiza and their pharmacological actions (Ravipati et al., 2012). For instance, the content and accumulation of three tanshinones increased with increased concentrations of copper (Cu) and Zn (Xu et al., 2012). The chemical components and pharmacological effects of S. miltiorrhiza have been increasingly reported on, but the availability of
Abbreviations: TFs, transcription factors; WT, wild-type; ORF, open reading frame; OE, overexpression; PCR, polymerase chain reaction; qRT-PCR, quantitative realtime polymerase chain reaction; EMSA, electrophoretic mobility shift assay ⁎ Corresponding authors. E-mail addresses: [email protected] (X.-C. Zhang), [email protected] (X.-Y. Du). 1 Bin Zhu and Dongao Huo contributed equally to this work. https://doi.org/10.1016/j.gene.2018.11.076 Received 22 August 2018; Received in revised form 29 October 2018; Accepted 22 November 2018 Available online 30 November 2018 0378-1119/ © 2018 Elsevier B.V. All rights reserved.
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 1. Nuclear localization of SmNAS1 in onion epidermal cells. Onion epidermal cell transformed with 35S: GFP was used as a control.
2. Materials and methods 2.1. Plant materials and growth conditions Seedlings of S. miltiorrhiza GY012 were grown at the Guizhou Medical University (Guiyang, China). Seeds of S. miltiorrhiza, wild-type (WT, Columbia), and SmNAC1 overexpression (T3 generation) Arabidopsis were germinated in half-strength Murashige & Skoog (MS) plates for 7 d, following which the seedlings were transferred into soil and grown in a light growth chamber at 21 °C with a photoperiod of 16 h/8 h (light/darkness). For phenotypic analyses, all the plants were grown on MS medium containing two Zn concentrations: 0.05 mM ZnSO4·7H2O (Zn+) or 1.0 mM ZnSO4·7H2O (Zn++). 2.2. Isolation and sequence analysis of SmNAC1 The young leaves of S. miltiorrhiza treated with Zn++ were used for genomic DNA and total RNA extraction using a Plant Genomic DNA Kit (Cwbio, Beijing, China) and Ultrapure RNA Kit (Cwbio, Beijing, China), respectively. Reverse-transcription PCR was carried out using the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Dalian, China). A pair of primers (forward: 5′-AAGCGAAGCAGTTTCAGCAA-3′, reverse: 5′-TCTCGTTGCATGAATGCTAC-3′) was designed according to the published NAC TF from S. miltiorrhiza (GenBank accession number JF760207). The total volume of the PCR reaction was 50 μL and contained 1 μL of cDNA or gDNA, 1 μL (10 μM) of each primer, 5 μL of PCR reaction buffer, 4 μL of dNTPs, and 1 μL of ExTaq DNA polymerase (Takara, Dalian, China). The reaction program was as follows: 95 °C for 5 min, 30 cycles of 95 °C for 40 s, 60 °C for 40 s, 72 °C for 2 min, and a final extension at 72 °C for 10 min. The products were separated on a 1% agarose gel. The target bands were then excised and purified using a Gel Extraction Kit (Cwbio, Beijing, China). The purified products were then inserted into the cloning vector pMD18-T (Takara, Dalian, China) and sequenced for confirmation.
2.3. Subcellular localization Fig. 2. (A) E. coli expression of SmNAC1. M: protein ladder; lane 1: the expression of GST label; lane 2 and 3: control; lane 4: the expression of SmNAC1. (B) In vitro DNA-binding electrophoretic mobility shift assay (EMSA).
The coding region of SmNAC1 without the stop codon was ligated to the pBI121-GFP vector. Then the recombinant construct and the vector as a negative control were infiltrated into onion epidermal cells via Agrobacterium tumefaciens-mediated transformation. After incubation for 24 h, the green fluorescent protein (GFP) fluorescence signal of SmNAC1 was observed using a confocal microscope (FluoView 1000, Olympus, Japan).
genomic resources is limited. In this study, we identified a novel NAC TF from S. miltiorrhiza and evaluated its role in improving Zn content in transgenic Arabidopsis. 55
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 3. Transactivation assay of SmNAC1 in yeast cells. The full-length (SmNAC1-FL), N-terminal (SmNAC1-N) and C-terminal (SmNAC1-C) was individually fused with GAL4 DNA-binding domain and expressed in yeast strain AH109. The pGBKT7 vector was used as a control. The transformed yeasts cells were streaked on the SD/-Trp and SD/-His medium, respectively. β-Galactosidase activity was determined using X-α-Gal as substrate.
2.4. Escherichia coli expression and DNA gel-shift assay (EMSA)
2.5. Transactivation activity assay
SmNAC1 recombinant protein was expressed from a pCold-GST vector (Huayueyang, Beijing, China) in BL21 (DE3) E. coli host cells. Induction was at 4 °C with 0.1 mM IPTG from an OD 0.6 culture for 12 h. The expressed proteins were purified using a GST-Tagged Protein Purification Kit (CwBio, Beijing, China). The total and purified proteins were analyzed using a 10% SDS-PAGE gel. For EMSA, a 38-bp DNA fragment containing NAC binding elements (TGAGCTCTTCTTCTGTAACACGCATGTGTTGCGTTTGG) was synthesized and used as a probe (NAC recognition core sequence CACG is underlined) according to Tran et al. (2004). The probe was labeled with digoxigenin (DIG) at the 3′-end. Binding reactions were in a total of 10μL volumes containing 5× EMSA buffer, 2 μg purified SmNAC1 protein or GST protein (as a negative control), and 1 μL DIG-labeled probe. For competitive analysis, an unlabeled probe (50-fold molar excess) was added and incubated for 30 min. The samples were separated on an 8% native polyacrylamide gel, electrotransferred onto a nylon membrane, and the signals revealed using a DIG Gel Shift Kit (Roche, Shanghai, China).
The complete sequence, N-terminal domain (1–336 bp), and Cterminal domain (337–660 bp) were amplified using the cDNA of SmNAC1 as a template. Then the sequences were inserted into the NdeI and EcoRI restriction sites of pGBKT7 (Clontech, Dalian, China). The constructs and negative control pGBKT7 vector were introduced into yeast strain AH109. The transformed yeast cultures were plated onto SD/-Trp and SD/-His plates. The plates were incubated at 30 °C for 4 d and subjected to a β-galactosidase assay. 2.6. Quantitative real-time (qRT)-PCR analysis Total RNA was extracted from the roots, shoots, and seeds of S. miltiorrhiza using an RNA Extraction Kit (CwBio, Beijing, China) in accordance with manufacturer's instructions. First-strand cDNA synthesis was performed according to the HiFiScript gDNA Removal cDNA Synthesis Kit protocol (CwBio, Beijing, China). Tissue-specific expression patterns and gene expression patterns of SmNAC1, following Zn treatments of different concentrations, were determined by qRT-PCR analysis. Gene-specific primer pairs (F: 5′-CTGGGCACCGACAAAGCCA 56
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 4. Expression patterns of SmNAC1 in different tissues after (A) Zn+ and (B) Zn++ treatments. Zn+: 0.05 mM ZnSO4·7H2O; Zn++: 1.0 mM ZnSO4·7H2O.
QuantStudio 3 Real-Time PCR System (ThermoFisher, Shanghai, China). Each sample was analyzed using three technical replicates. The relative expression of SmNAC1, AtMTP1, and AtMTP3 and the probability values were calculated using qRT-PCR analysis software (Rieu and Powers, 2009).
TCCAC-3′ R: 5′-CTGGGAGATGGAGGAGCCCATGT-3′) were designed at the coding sequence, thus excluding the specific sequence of SmNAC1. To test the specificity of the primers, PCR was carried out and the product was confirmed by sequencing. The housekeeping gene Smubiquitin of S. miltiorrhiza was used as the internal reference gene when examining the gene expression of SmNAC1. The sequence of Smubiquitin was as follows: 5′-ACCCTCACGGGAAGACCATC-3′; 5′-ACC ACGGAGACGGAGGACAAG-3′. For analysis of the expression patterns of AtMTP1 and AtMTP3 in transgenic Arabidopsis, the plants were treated with different concentration of Zn, and the roots and shoots were collected at 2, 4, and 6 d after treatment. Total RNA was then extracted using the above-mentioned kit and the primers used for the qRT-PCR were as detailed in Arrivault et al. (2006) and Gaitán-Solís et al. (2015). QRT-PCR analysis was performed using an Applied Biosystems
2.7. Measurements of Zn concentrations in transgenic Arabidopsis Zn contents were analyzed according to Li et al. (2016), with some minor modifications. In brief, entire plants were harvested and rinsed in distilled water three times, following which the roots, shoots, and seeds were separated and air-dried for one week at 25 °C. For Zn content analysis, 0.5 g plant tissue was digested in 2 mL HNO3 for 12 h, after which 2 mL H2O2 was added and the mixture boiled for 5 min. Subsequently, the digests were filtered and adjusted to 25 mL using ddH2O. 57
Gene 688 (2019) 54–61
B. Zhu et al.
cells and visualized under a confocal microscope. The GFP signal was consistently observed within both the cytoplasm and nucleus, whereas the SmNAC1-GFP fusion protein was exclusively localized in the nucleus, as confirmed by DAPI (4′,6-diamidino-2-phenylindole) staining (Fig. 1). This result indicated that SmNAC1 encodes a nuclear protein. 3.3. The specific DNA binds to the SmNAC1 protein in vitro Fig. 2A shows the expression of the SmNAC1 protein in E. coli. The expected size of the recombinant GST-SmNAC1 fusion protein was successfully expressed. To examine the SmNAC1 exhibition of DNA binding activity, the GST-SmNAC1 fusion protein was purified to homogeneity in native PAGE. The EMSA results revealed that the GSTSmNAC1 protein bound to the DIG-labeled fragment, which contained the CACG core motifs, forming a specific DNA–protein complex. The purified GST protein did not bind to the DIG-labeled fragment (Fig. 2B). These results indicate that the SmNAC1 protein could specifically bind to the cis-element of the NAC proteins. 3.4. SmNAC1 encodes a transcriptional activator To investigate the transcriptional activity of the SmNAC1 protein, the complete coding sequence, N-terminal domain, and C-terminal domain were fused to the GAL4 DNA binding domain (GAL4 BD) in pGBKT7 and transformed into yeast AH109 cells. As indicated in Fig. 3, all the transformed yeast cells grew well on SD medium lacking tryptophan (SD/-Trp). However, only the transformants containing the complete sequence of SmNAC1 (pBD-SmNAC1-FL) and the C-terminal domain of SmNAC1 (pBD-SmNAC1-C) could grow on SD medium lacking histidine (SD/-His). In contrast, the transformants containing an N-terminal domain (pBD-SmNAC1-N) or pBD could not grow on selection medium. Furthermore, the transformants with pBD-SmNAC1-FL and pBD-SmNAC1-C turned blue in the presence of X-α-Gal. The results suggested that SmNAC1 functions as a transcriptional activator and the required transactivation domain is located in the C-terminal domain. 3.5. The expression pattern of SmNAC1 in S. miltiorrhiza The expression patterns of SmNAC1 in S. miltiorrhiza seedlings under the Zn treatments were analyzed using qRT-PCR (Fig. 4A and B). The SmNAC1 expression level increased overall after three days of Zn (+) and Zn (++) treatment, peaking at day 10 and then decreasing on day 12. In addition, the expression level of SmNAC1 was highest in the stems and lowest in the leaves (Fig. 4A and B).
Fig. 5. Expression patterns of (A) AtMTP1 and (B) AtMTP3 in roots and shoots of transgenic Arabidopsis under zinc excess condition.
The Fe and Zn contents were then analyzed using an iCAP 6000 Series spectrometer (Thermo-Fisher, Shanghai, China).
3.6. The expression patterns of AtMPT1 and AtMPT3 in transgenic Arabidopsis under excess Zn conditions
3. Results
The expression patterns of AtMPT1 and AtMPT3 in transgenic Arabidopsis under excess Zn were analyzed by qRT-PCR (Fig. 5A and B). The expression levels of AtMPT1 and AtMPT3 were higher in the root tissue and lower in the shoot tissue. Moreover, the expression of AtMPT1 was up-regulated by excessive Zn concentration, while the expression of AtMPT3 was inhibited by this treatment (Fig. 5A and B).
3.1. Characterization of the molecular structure of SmNAC1 PCR amplification demonstrated that target bands of 1500 bp and 1200 bp were obtained from the gDNA and cDNA, respectively (Supplementary Fig. S1A). After cloning, sequencing, and open reading frame (ORF) identification, the complete length of SmNAC1 was 894 bp. Sequence analysis showed that three exons and two introns were present in SmNAC1 (Supplementary Fig. S1B). The complete sequence of SmNAC1 has been deposited to Genbank and the accession number is MK095582.
3.7. Zn distribution in transgenic Arabidopsis To further explore the functions of SmNAC1 in the uptake and transport of Zn, we constructed overexpression vectors and generated transgenic Arabidopsis plants overexpressing SmNAC1. Transgenic lines OE1, OE2, and OE3 were selected for further evaluation. To confirm the expression of SmNAC1, transcription levels were detected by RT-PCR (data not shown). The transgenic Arabidopsis can normally grow up under excess Zn treatment, however, the wild type showed yellow green chlorotic under 0.05 mM Zn treatment and the leaves withered under 1.0 mM Zn
3.2. SmNAC1 is localized in the nucleus To determine the subcellular localization of SmNAC1, the SmNAC1GFP fusion construct and the GFP control in pEarleyGate101 driven by the CaMV 35S promoter were transiently expressed in onion epidermal 58
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 6. Phenotype of wild and transgenic Arabidopsis under different Zn treatment.
The N-terminal domain of the NAC protein is crucial for binding to and recognizing specific cis-elements in their target genes, while the Cterminal region is considered to be essential for transcriptional activation (Yang et al., 2015). We found that SmNAC1 was exclusively located in the nucleus in transient expression analysis using onion epidermal cells, which is characteristic of a TF with DNA-binding activity. Furthermore, a transactivation assay was conducted in yeast, and the results showed that SmNAC1 functions as a transcriptional activator, with the transcriptional activation domain located in the C-terminal region. These results were in accordance with other previously reported NAC members (Fujita et al., 2004; Hao et al., 2011; He et al., 2005; Jeong et al., 2010; Mao et al., 2012; Nuruzzaman et al., 2013; Olsen et al., 2005; Wu et al., 2009). The influence of NAC TFs on Zn absorption and transportation has been reported in wheat and related species. In this paper, we first reported the effect of an NAC TF from S. miltiorrhiza on Zn concentration in transgenic Arabidopsis. In Triticeae species, NAM genes belong to the NAC TF family and have been shown to affect Fe, Zn, and nitrogen content in grains (Uauy et al., 2006). As a key essential micronutrient for all organisms, Zn is required as a cofactor and plays critical structural roles in many proteins and countless transcription factors. However, Zn can also be toxic when present in excessive quantities. The
treatment (Fig. 6). For further determine the overexpression of SmNAC1 affected Zn distribution in transgenic Arabidopsis, the roots, shoots, and seeds of transgenic and wild-type Arabidopsis were used for Zn content measurement (Fig. 7). Compared with wild-type plants, transgenic Arabidopsis accumulated more Zn in the roots and shoots. Furthermore, the Zn content in the seeds was not significantly different from that of the wild-type. These results suggest that SmNAC1 facilitates Zn uptake by the roots and may be involved in shoot transport; however, extremely low levels of Zn were transported into the seeds.
4. Discussion The NAC TF superfamily in plants participates in various regulatory and developmental processes (Mitsuda et al., 2007; Li et al., 2016). Its role in the regulation of abiotic stress responses, such as drought, salinity and cold resistance, has been well documented in transgenic Arabidopsis (Nuruzzaman et al., 2013). However, studies on NAC TFs from S. miltiorrhiza and their influence on Zn accumulation are lacking. In this work, we overexpressed the S. miltiorrhiza NAC TF SmNAC1 in Arabidopsis, which led to greater Zn accumulation in the roots and shoots when compared with control plants. 59
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 7. Zinc contents in different tissues of transgenic Arabidopsis after (A) Zn+ and (B) Zn++ treatments. Zn+: 0.05 mM ZnSO4·7H2O; Zn++: 1.0 mM ZnSO4·7H2O.
roots to the shoots under excess Zn (Arrivault et al., 2006; Zhang et al., 2016). This study also demonstrated that high concentrations of Zn inhibit the expression of AtMPT3 in both wild-type and transgenic plants (Fig. 5B). In conclusion, a novel S. miltiorrhiza NAC TF, SmNAC1, was isolated and characterized in this study. In transgenic Arabidopsis, SmNAC1 overexpression enhanced plant tolerance to Zn stress and improved Zn content. These results enhance our understanding of the roles of S. miltiorrhiza NAC TFs in the plant response to Zn stress and may provide candidate genes for enhancing plant Zn content. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2018.11.076.
unregulated high-affinity binding of Zn to sulfur-, nitrogen- and oxygen-containing functional groups in biological molecules, can cause inactivation and damage, as well as the uncontrolled displacement of essential cofactor metal cations, for example Mn2+ and Fe2+. Metal tolerance proteins (MTPs) are associated with the process of metallic element tolerance (Gaitán-Solís et al., 2015). In Arabidopsis, the Zn transporters AtMTP1 and AtMTP3 played distinct roles in Zn absorption and transportation (Zhang et al., 2016). In this study, the expression levels of AtMPT1 and AtMPT3 were higher in the root tissue and lower in the shoot tissue. Additionally, the expression of AtMPT1 was up-regulated by excess Zn, while the expression of AtMTP3 showed a different expression pattern compared with AtMTP1 (Fig. 5A and B). Previous work has indicated that AtMTP1 is inhibited under high Zn concentrations (Wang et al., 2017). The present study suggested that SmNAC1 and AtMPT1 coordinate expression in transgenic Arabidopsis and are highly expressed under excess Zn conditions (Fig. 5A). AtMTP3 plays important roles in restricting the transportation of Zn from the
Conflict of interest The authors declare that they have no conflict of interest. 60
Gene 688 (2019) 54–61
B. Zhu et al.
Acknowledgements
NAC transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta (BBA) Gene Regul. Mech. 1819, 97–103. Nuruzzaman, M., Sharoni, A.M., Kikuchi, S., 2013. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front. Microbiol. 4, 1–16. Olsen, A.N., Ernst, H.A., Leggio, L.L., Skriver, K., 2005. NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci. 10, 79–87. Pinton, R., Cakmak, I., Marschner, H., 1993. Effect of zinc deficiency on proton fluxes in plasma membrane-enriched vesicles isolated from bean roots. J. Exp. Bot. 44, 623–630. Puranik, S., Sahu, P.P., Srivastava, P.S., Prasad, M., 2012. NAC proteins: regulation and role in stress tolerance. Trends Plant Sci. 17, 369–381. Ravipati, A.S., Zhang, L., Koyyalamudi, S.R., Jeong, S.C., Reddy, N., Bartlett, J., Smith, P.T., Shanmugam, K., Münch, G., Wu, M.J., Satyanarayanan, M., Vysetti, B., 2012. Antioxidant and anti-inflammatory activities of selected Chinese medicinal plants and their relation with antioxidant content. BMC Complement. Alternat. Med. 12, 173. Rieu, I., Powers, S.J., 2009. Real-time quantitative RT-PCR: design, calculations, and statistics. Plant Cell 21, 1031–1033. Tran, L.S., Nakashima, K., Sakuma, Y., Simpson, S.D., Fujita, Y., Maruyama, K., Fujita, M., Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K., 2004. Isolation and functional analysis of Arabidopsis stress inducible NAC transcription factors that bind to a drought responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16, 2481–2498. Uauy, C., Distelfeld, A., Fahima, T., Blechl, A., Dubcovsky, J., 2006. A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 314, 1298–1301. Wang, D.L.Y., Lv, S.L., Jiang, P., Li, Y.X., 2017. Roles, regulation, and agricultural application of plant phosphate transporters. Front. Plant Sci. 8, 817. Wu, Y., Deng, Z., Lai, J., Zhang, Y., Yang, C., Yin, B., Zhao, Q., Zhang, L., Li, Y., Xie, Q., 2009. Dual function of Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res. 19, 1279–1290. Xu, X.B., Jiang, Q.H., Ma, X.Y., Ying, Q.C., Shen, B., Qian, Y.S., Song, H.M., Wang, H.Z., 2012. Deep sequencing identifies tissue-specific microRNAs and their target genes involving in the biosynthesis of tanshinones in Salvia miltiorrhiza. PLoS One 9, e111679. Xu, Z.C., Peters, R.J., Weirather, J., Liao, B.S., Zhang, X., Zhu, Y.J., Ji, A.J., Zhang, B., Hu, S.N., Au, K.F., Song, J.Y., Chen, S.L., 2015. Full-length transcriptome sequences and splice variants obtained by a combination of sequencing platforms applied to different root tissues of Salvia miltiorrhiza and tanshinone biosynthesis. Plant J. 82, 951–961. Yang, X.W., Wang, X.Y., Ji, L., Yi, Z.L., Fu, C.X., Ran, J.C., Hu, R.B., Zhong, G.K., 2015. Overexpression of a Miscanthus lutarioriparius NAC gene MlNAC5 confers enhanced drought and cold tolerance in Arabidopsis. Plant Cell Rep. 34, 943–958. Yoo, S.Y., Kim, Y.H., Kim, S.Y., Lee, J.S., Ahn, J.H., 2007. Control of flowering time and cold response by a NAC-domain protein in Arabidopsis. PLoS One 2, e642. Zhang, Y.X., Sun, T.Z., Liu, S.Q., Dong, L., Liu, C.Y., Song, W.W., Liu, J.J., Gai, S.P., 2016. MYC cis-elements in PsMPT promoter is involved in chilling response of Paeonia suffruticosa. PLoS One 11, e0155780. Zhao, J.L., Zhou, L.G., Wu, J.Y., 2010. Effects of biotic and abiotic elicitors on cell growth and tanshinone accumulation in Salvia miltiorrhiza cell cultures. Appl. Micro. Biotech. 87, 137–144.
We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. This work was financed by National Natural Science Foundation of China (31860375), grants from the State Key Laboratory of Crop Biology (2018KF02), Natural Science Foundation of Shandong Province (ZR2018MC016), Guizhou Science and Technology Foundation (Qiankehe LH 2016-7206, Qiankehe LH 2016-7210, Qiankehe LH 2017-7356 and QKHJZLKS[2012]21). References Arrivault, S., Senger, T., Krämer, U., 2006. The Arabidopsis metal tolerance protein AtMTP3 maintainsmetal homeostasis by mediating Zn exclusion from the shoot under Fe deficiency and Zn oversupply. Plant J. 46, 861–879. Broadley, M.R., White, P.J., Hammond, J.P., Zelko, I., Lux, A., 2007. Zinc in plants. New Phytol. 173, 677–702. Brune, A., Urbach, W., Dietz, K.J., 1994. Zinc stress induces changes in apoplasmic protein content and polypeptide composition of barley primary leaves. J. Exp. Bot. 45, 1189–1196. Fujita, M., Fujita, Y., Maruyama, K., Seki, M., Hiratsu, K., Ohme-Takag, M., Tran, L.S.P., Yamaguchi-Shinozaki, K., Shinozaki, K., 2004. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 39, 863–876. Gaitán-Solís, E., Taylor, N.J., Siritunga, D., Stevens, W., Schachtman, D.P., 2015. Overexpression of the transporters AtZIP1 and AtMTP1 in cassava changes zinc accumulation and partitioning. Front. Plant Sci. 6, 492. Guerinot, M.L., Yi, Y., 1994. Iron: nutritious, noxious, and not readily available. Plant Physiol. 104, 815–820. Hao, Y.J., Wei, W., Song, Q.X., Chen, H.W., Zhang, Q.Y., Wang, F., Zou, H.F., Lei, G., Tian, A.G., Zhang, W.K., Ma, B., Zhang, J.S., Chen, S.Y., 2011. Soybean NAC transcription factors promote abiotic stress tolerance and lateral root formation in transgenic plants. Plant J. 68, 302–313. He, X.J., Mu, R.L., Cao, W.H., Zhang, Z.G., Zhang, J.S., Chen, S.Y., 2005. AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. Plant J. 44, 903–916. Jeong, J.S., Kim, Y.S., Baek, K.H., Jung, H., Ha, S.H., Do Choi, Y., Kim, M., Reuzeau, C., Kim, J.K., 2010. Root-specific expression of OsNAC10 improves drought tolerance and grain yield in rice under field drought conditions. Plant Physiol. 153, 185–197. Li, S.Z., Zhou, X.J., Zhao, Y.F., Li, H.B., Liu, Y.F., Zhu, L.Y., Guo, J.J., Huang, Y.Q., Yang, W.Z., Fan, Y.L., Chen, J.T., Chen, R.M., 2016. Constitutive expression of the ZmZIP7 in Arabidopsis alters metal homeostasis and increases Fe and Zn content. Plant Physiol. Biochem. 106, 1–10. Mao, X., Zhang, H., Qian, X., Li, A., Zhao, G., Jing, R., 2012. TaNAC2, a NAC-type wheat transcription factor conferring enhanced multiple abiotic stress tolerances in Arabidopsis. J. Exp. Bot. 63, 2933–2946. Mitsuda, N., Iwase, A., Yamamoto, H., Yoshida, M., Seki, M., Shinozaki, K., Ohme-Takagi, M., 2007. NAC transcription factors, NST1 and NST3, are key regulators of the formation of secondary walls in woody tissues of Arabidopsis. Plant Cell 19, 270–280. Nakashima, K., Takasaki, H., Mizoi, J., Shinozaki, K., Yamaguchi-Shinozaki, K., 2012.
61
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
The Salvia miltiorrhiza NAC transcription factor SmNAC1 enhances zinc content in transgenic Arabidopsis
T
Bin Zhua,1, Dong-Ao Huob,1, Xiao-Xiao Hongc, Juan Guoa, Tao Penga, Jie Liua, Xiao-Long Huanga, ⁎ ⁎ Hui-Qing Yana, Qing-Bei Wenga, Xiao-Cun Zhangd, , Xu-Ye Dua, a
School of Life Sciences, Guizhou Normal University, No. 116, Baoshanbei Street, Guiyang 550001, Guizhou Province, PR China Buckwheat Research Center, Guizhou Normal University, No. 116, Baoshanbei Street, Guiyang 550001, Guizhou Province, PR China c Basic Medical College, Guizhou Medical University, No. 27, Huayan Street, Guiyang 550025, Guizhou Province, PR China d College of Food Science and Engineering, Shandong Agricultural University, No. 61, Daizong Street, Taian 271000, Shandong Province, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Salvia miltiorrhiza NAC transcription factor Zinc content Transgenic Arabidopsis
NAC transcription factors play important roles in plant biological processes, including plant development, environmental stress responses and element enrichment. A novel NAC transcription factor gene, designated SmNAC1, was isolated from Salvia miltiorrhiza. SmNAC1 was localized in the nucleus in onion protoplasts and exhibited transcriptional activation activities in yeast. In addition, the SmNAC1 protein could specifically bind to the cis-elements of the NAC proteins. SmNAC1 was expressed at a higher level in the leaves of S. miltiorrhiza, indicating that SmNAC1 might be involved in the transportation of zinc. To examine the function of SmNAC1, transgenic Arabidopsis plants overexpressing SmNAC1 were generated. Zinc content assays in the transgenic plants demonstrated that overexpressed SmNAC1 plants had enhanced tolerance to high zinc concentrations, and zinc was enriched in the shoot tissues. Our results demonstrate that SmNAC1 plays important roles in the response to zinc stress. Zinc was mainly enriched in the leaves of S. miltiorrhiza and the shoot tissues of transgenic Arabidopsis plants. SmNAC1 might participate in zinc transportation from the roots to the shoots, that constitutes a useful gene for improving zinc content in plants.
1. Introduction Zinc (Zn) is an essential micro-nutrient required for a range of physiological and biochemical activities in animals and plants. Zn deficiency can cause internode shortening, leaf inward curling, and leaf size reducing (Broadley et al., 2007; Brune et al., 1994; Guerinot and Yi, 1994; Pinton et al., 1993). Transcription factors (TFs) play crucial roles in the regulation of target gene expression. The NAC (NAM, ATAF1/2, and CUC2) superfamily, which is one of the key gene expression regulators in plants, is one of the largest plant TF families (Olsen et al., 2005; Puranik et al., 2012; Nuruzzaman et al., 2013). Many NAC TFs have been reported to contribute to various developmental processes and stresses, such as senescence, flowering, fungal infection, drought, cold, and high salinity (Mitsuda et al., 2007; Uauy et al., 2006; Yoo et al., 2007; Nakashima et al., 2012).
Salvia miltiorrhiza Bge., also known as “Dan Shen”, grows widely in China and is a well-known traditional Chinese medicine. Owing to its remarkable biological activity and minimal side effects, it has been widely used for the treatment of disease of cardiovascular, cerebrovascular, dermatological and kidney (Zhao et al., 2010; Xu et al., 2015). Presently, there are more than 100 Chinese formulas and patent medicines containing Dan Shen as a critical material. Trace elements, such as iron (Fe) and Zn, are components of many medicinally relevant enzymes, such as antioxidant enzymes, and influence many metabolic processes. A large number of studies have indicated a relationship between the types and contents of the trace elements in S. miltiorrhiza and their pharmacological actions (Ravipati et al., 2012). For instance, the content and accumulation of three tanshinones increased with increased concentrations of copper (Cu) and Zn (Xu et al., 2012). The chemical components and pharmacological effects of S. miltiorrhiza have been increasingly reported on, but the availability of
Abbreviations: TFs, transcription factors; WT, wild-type; ORF, open reading frame; OE, overexpression; PCR, polymerase chain reaction; qRT-PCR, quantitative realtime polymerase chain reaction; EMSA, electrophoretic mobility shift assay ⁎ Corresponding authors. E-mail addresses: [email protected] (X.-C. Zhang), [email protected] (X.-Y. Du). 1 Bin Zhu and Dongao Huo contributed equally to this work. https://doi.org/10.1016/j.gene.2018.11.076 Received 22 August 2018; Received in revised form 29 October 2018; Accepted 22 November 2018 Available online 30 November 2018 0378-1119/ © 2018 Elsevier B.V. All rights reserved.
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 1. Nuclear localization of SmNAS1 in onion epidermal cells. Onion epidermal cell transformed with 35S: GFP was used as a control.
2. Materials and methods 2.1. Plant materials and growth conditions Seedlings of S. miltiorrhiza GY012 were grown at the Guizhou Medical University (Guiyang, China). Seeds of S. miltiorrhiza, wild-type (WT, Columbia), and SmNAC1 overexpression (T3 generation) Arabidopsis were germinated in half-strength Murashige & Skoog (MS) plates for 7 d, following which the seedlings were transferred into soil and grown in a light growth chamber at 21 °C with a photoperiod of 16 h/8 h (light/darkness). For phenotypic analyses, all the plants were grown on MS medium containing two Zn concentrations: 0.05 mM ZnSO4·7H2O (Zn+) or 1.0 mM ZnSO4·7H2O (Zn++). 2.2. Isolation and sequence analysis of SmNAC1 The young leaves of S. miltiorrhiza treated with Zn++ were used for genomic DNA and total RNA extraction using a Plant Genomic DNA Kit (Cwbio, Beijing, China) and Ultrapure RNA Kit (Cwbio, Beijing, China), respectively. Reverse-transcription PCR was carried out using the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Dalian, China). A pair of primers (forward: 5′-AAGCGAAGCAGTTTCAGCAA-3′, reverse: 5′-TCTCGTTGCATGAATGCTAC-3′) was designed according to the published NAC TF from S. miltiorrhiza (GenBank accession number JF760207). The total volume of the PCR reaction was 50 μL and contained 1 μL of cDNA or gDNA, 1 μL (10 μM) of each primer, 5 μL of PCR reaction buffer, 4 μL of dNTPs, and 1 μL of ExTaq DNA polymerase (Takara, Dalian, China). The reaction program was as follows: 95 °C for 5 min, 30 cycles of 95 °C for 40 s, 60 °C for 40 s, 72 °C for 2 min, and a final extension at 72 °C for 10 min. The products were separated on a 1% agarose gel. The target bands were then excised and purified using a Gel Extraction Kit (Cwbio, Beijing, China). The purified products were then inserted into the cloning vector pMD18-T (Takara, Dalian, China) and sequenced for confirmation.
2.3. Subcellular localization Fig. 2. (A) E. coli expression of SmNAC1. M: protein ladder; lane 1: the expression of GST label; lane 2 and 3: control; lane 4: the expression of SmNAC1. (B) In vitro DNA-binding electrophoretic mobility shift assay (EMSA).
The coding region of SmNAC1 without the stop codon was ligated to the pBI121-GFP vector. Then the recombinant construct and the vector as a negative control were infiltrated into onion epidermal cells via Agrobacterium tumefaciens-mediated transformation. After incubation for 24 h, the green fluorescent protein (GFP) fluorescence signal of SmNAC1 was observed using a confocal microscope (FluoView 1000, Olympus, Japan).
genomic resources is limited. In this study, we identified a novel NAC TF from S. miltiorrhiza and evaluated its role in improving Zn content in transgenic Arabidopsis. 55
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 3. Transactivation assay of SmNAC1 in yeast cells. The full-length (SmNAC1-FL), N-terminal (SmNAC1-N) and C-terminal (SmNAC1-C) was individually fused with GAL4 DNA-binding domain and expressed in yeast strain AH109. The pGBKT7 vector was used as a control. The transformed yeasts cells were streaked on the SD/-Trp and SD/-His medium, respectively. β-Galactosidase activity was determined using X-α-Gal as substrate.
2.4. Escherichia coli expression and DNA gel-shift assay (EMSA)
2.5. Transactivation activity assay
SmNAC1 recombinant protein was expressed from a pCold-GST vector (Huayueyang, Beijing, China) in BL21 (DE3) E. coli host cells. Induction was at 4 °C with 0.1 mM IPTG from an OD 0.6 culture for 12 h. The expressed proteins were purified using a GST-Tagged Protein Purification Kit (CwBio, Beijing, China). The total and purified proteins were analyzed using a 10% SDS-PAGE gel. For EMSA, a 38-bp DNA fragment containing NAC binding elements (TGAGCTCTTCTTCTGTAACACGCATGTGTTGCGTTTGG) was synthesized and used as a probe (NAC recognition core sequence CACG is underlined) according to Tran et al. (2004). The probe was labeled with digoxigenin (DIG) at the 3′-end. Binding reactions were in a total of 10μL volumes containing 5× EMSA buffer, 2 μg purified SmNAC1 protein or GST protein (as a negative control), and 1 μL DIG-labeled probe. For competitive analysis, an unlabeled probe (50-fold molar excess) was added and incubated for 30 min. The samples were separated on an 8% native polyacrylamide gel, electrotransferred onto a nylon membrane, and the signals revealed using a DIG Gel Shift Kit (Roche, Shanghai, China).
The complete sequence, N-terminal domain (1–336 bp), and Cterminal domain (337–660 bp) were amplified using the cDNA of SmNAC1 as a template. Then the sequences were inserted into the NdeI and EcoRI restriction sites of pGBKT7 (Clontech, Dalian, China). The constructs and negative control pGBKT7 vector were introduced into yeast strain AH109. The transformed yeast cultures were plated onto SD/-Trp and SD/-His plates. The plates were incubated at 30 °C for 4 d and subjected to a β-galactosidase assay. 2.6. Quantitative real-time (qRT)-PCR analysis Total RNA was extracted from the roots, shoots, and seeds of S. miltiorrhiza using an RNA Extraction Kit (CwBio, Beijing, China) in accordance with manufacturer's instructions. First-strand cDNA synthesis was performed according to the HiFiScript gDNA Removal cDNA Synthesis Kit protocol (CwBio, Beijing, China). Tissue-specific expression patterns and gene expression patterns of SmNAC1, following Zn treatments of different concentrations, were determined by qRT-PCR analysis. Gene-specific primer pairs (F: 5′-CTGGGCACCGACAAAGCCA 56
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 4. Expression patterns of SmNAC1 in different tissues after (A) Zn+ and (B) Zn++ treatments. Zn+: 0.05 mM ZnSO4·7H2O; Zn++: 1.0 mM ZnSO4·7H2O.
QuantStudio 3 Real-Time PCR System (ThermoFisher, Shanghai, China). Each sample was analyzed using three technical replicates. The relative expression of SmNAC1, AtMTP1, and AtMTP3 and the probability values were calculated using qRT-PCR analysis software (Rieu and Powers, 2009).
TCCAC-3′ R: 5′-CTGGGAGATGGAGGAGCCCATGT-3′) were designed at the coding sequence, thus excluding the specific sequence of SmNAC1. To test the specificity of the primers, PCR was carried out and the product was confirmed by sequencing. The housekeeping gene Smubiquitin of S. miltiorrhiza was used as the internal reference gene when examining the gene expression of SmNAC1. The sequence of Smubiquitin was as follows: 5′-ACCCTCACGGGAAGACCATC-3′; 5′-ACC ACGGAGACGGAGGACAAG-3′. For analysis of the expression patterns of AtMTP1 and AtMTP3 in transgenic Arabidopsis, the plants were treated with different concentration of Zn, and the roots and shoots were collected at 2, 4, and 6 d after treatment. Total RNA was then extracted using the above-mentioned kit and the primers used for the qRT-PCR were as detailed in Arrivault et al. (2006) and Gaitán-Solís et al. (2015). QRT-PCR analysis was performed using an Applied Biosystems
2.7. Measurements of Zn concentrations in transgenic Arabidopsis Zn contents were analyzed according to Li et al. (2016), with some minor modifications. In brief, entire plants were harvested and rinsed in distilled water three times, following which the roots, shoots, and seeds were separated and air-dried for one week at 25 °C. For Zn content analysis, 0.5 g plant tissue was digested in 2 mL HNO3 for 12 h, after which 2 mL H2O2 was added and the mixture boiled for 5 min. Subsequently, the digests were filtered and adjusted to 25 mL using ddH2O. 57
Gene 688 (2019) 54–61
B. Zhu et al.
cells and visualized under a confocal microscope. The GFP signal was consistently observed within both the cytoplasm and nucleus, whereas the SmNAC1-GFP fusion protein was exclusively localized in the nucleus, as confirmed by DAPI (4′,6-diamidino-2-phenylindole) staining (Fig. 1). This result indicated that SmNAC1 encodes a nuclear protein. 3.3. The specific DNA binds to the SmNAC1 protein in vitro Fig. 2A shows the expression of the SmNAC1 protein in E. coli. The expected size of the recombinant GST-SmNAC1 fusion protein was successfully expressed. To examine the SmNAC1 exhibition of DNA binding activity, the GST-SmNAC1 fusion protein was purified to homogeneity in native PAGE. The EMSA results revealed that the GSTSmNAC1 protein bound to the DIG-labeled fragment, which contained the CACG core motifs, forming a specific DNA–protein complex. The purified GST protein did not bind to the DIG-labeled fragment (Fig. 2B). These results indicate that the SmNAC1 protein could specifically bind to the cis-element of the NAC proteins. 3.4. SmNAC1 encodes a transcriptional activator To investigate the transcriptional activity of the SmNAC1 protein, the complete coding sequence, N-terminal domain, and C-terminal domain were fused to the GAL4 DNA binding domain (GAL4 BD) in pGBKT7 and transformed into yeast AH109 cells. As indicated in Fig. 3, all the transformed yeast cells grew well on SD medium lacking tryptophan (SD/-Trp). However, only the transformants containing the complete sequence of SmNAC1 (pBD-SmNAC1-FL) and the C-terminal domain of SmNAC1 (pBD-SmNAC1-C) could grow on SD medium lacking histidine (SD/-His). In contrast, the transformants containing an N-terminal domain (pBD-SmNAC1-N) or pBD could not grow on selection medium. Furthermore, the transformants with pBD-SmNAC1-FL and pBD-SmNAC1-C turned blue in the presence of X-α-Gal. The results suggested that SmNAC1 functions as a transcriptional activator and the required transactivation domain is located in the C-terminal domain. 3.5. The expression pattern of SmNAC1 in S. miltiorrhiza The expression patterns of SmNAC1 in S. miltiorrhiza seedlings under the Zn treatments were analyzed using qRT-PCR (Fig. 4A and B). The SmNAC1 expression level increased overall after three days of Zn (+) and Zn (++) treatment, peaking at day 10 and then decreasing on day 12. In addition, the expression level of SmNAC1 was highest in the stems and lowest in the leaves (Fig. 4A and B).
Fig. 5. Expression patterns of (A) AtMTP1 and (B) AtMTP3 in roots and shoots of transgenic Arabidopsis under zinc excess condition.
The Fe and Zn contents were then analyzed using an iCAP 6000 Series spectrometer (Thermo-Fisher, Shanghai, China).
3.6. The expression patterns of AtMPT1 and AtMPT3 in transgenic Arabidopsis under excess Zn conditions
3. Results
The expression patterns of AtMPT1 and AtMPT3 in transgenic Arabidopsis under excess Zn were analyzed by qRT-PCR (Fig. 5A and B). The expression levels of AtMPT1 and AtMPT3 were higher in the root tissue and lower in the shoot tissue. Moreover, the expression of AtMPT1 was up-regulated by excessive Zn concentration, while the expression of AtMPT3 was inhibited by this treatment (Fig. 5A and B).
3.1. Characterization of the molecular structure of SmNAC1 PCR amplification demonstrated that target bands of 1500 bp and 1200 bp were obtained from the gDNA and cDNA, respectively (Supplementary Fig. S1A). After cloning, sequencing, and open reading frame (ORF) identification, the complete length of SmNAC1 was 894 bp. Sequence analysis showed that three exons and two introns were present in SmNAC1 (Supplementary Fig. S1B). The complete sequence of SmNAC1 has been deposited to Genbank and the accession number is MK095582.
3.7. Zn distribution in transgenic Arabidopsis To further explore the functions of SmNAC1 in the uptake and transport of Zn, we constructed overexpression vectors and generated transgenic Arabidopsis plants overexpressing SmNAC1. Transgenic lines OE1, OE2, and OE3 were selected for further evaluation. To confirm the expression of SmNAC1, transcription levels were detected by RT-PCR (data not shown). The transgenic Arabidopsis can normally grow up under excess Zn treatment, however, the wild type showed yellow green chlorotic under 0.05 mM Zn treatment and the leaves withered under 1.0 mM Zn
3.2. SmNAC1 is localized in the nucleus To determine the subcellular localization of SmNAC1, the SmNAC1GFP fusion construct and the GFP control in pEarleyGate101 driven by the CaMV 35S promoter were transiently expressed in onion epidermal 58
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 6. Phenotype of wild and transgenic Arabidopsis under different Zn treatment.
The N-terminal domain of the NAC protein is crucial for binding to and recognizing specific cis-elements in their target genes, while the Cterminal region is considered to be essential for transcriptional activation (Yang et al., 2015). We found that SmNAC1 was exclusively located in the nucleus in transient expression analysis using onion epidermal cells, which is characteristic of a TF with DNA-binding activity. Furthermore, a transactivation assay was conducted in yeast, and the results showed that SmNAC1 functions as a transcriptional activator, with the transcriptional activation domain located in the C-terminal region. These results were in accordance with other previously reported NAC members (Fujita et al., 2004; Hao et al., 2011; He et al., 2005; Jeong et al., 2010; Mao et al., 2012; Nuruzzaman et al., 2013; Olsen et al., 2005; Wu et al., 2009). The influence of NAC TFs on Zn absorption and transportation has been reported in wheat and related species. In this paper, we first reported the effect of an NAC TF from S. miltiorrhiza on Zn concentration in transgenic Arabidopsis. In Triticeae species, NAM genes belong to the NAC TF family and have been shown to affect Fe, Zn, and nitrogen content in grains (Uauy et al., 2006). As a key essential micronutrient for all organisms, Zn is required as a cofactor and plays critical structural roles in many proteins and countless transcription factors. However, Zn can also be toxic when present in excessive quantities. The
treatment (Fig. 6). For further determine the overexpression of SmNAC1 affected Zn distribution in transgenic Arabidopsis, the roots, shoots, and seeds of transgenic and wild-type Arabidopsis were used for Zn content measurement (Fig. 7). Compared with wild-type plants, transgenic Arabidopsis accumulated more Zn in the roots and shoots. Furthermore, the Zn content in the seeds was not significantly different from that of the wild-type. These results suggest that SmNAC1 facilitates Zn uptake by the roots and may be involved in shoot transport; however, extremely low levels of Zn were transported into the seeds.
4. Discussion The NAC TF superfamily in plants participates in various regulatory and developmental processes (Mitsuda et al., 2007; Li et al., 2016). Its role in the regulation of abiotic stress responses, such as drought, salinity and cold resistance, has been well documented in transgenic Arabidopsis (Nuruzzaman et al., 2013). However, studies on NAC TFs from S. miltiorrhiza and their influence on Zn accumulation are lacking. In this work, we overexpressed the S. miltiorrhiza NAC TF SmNAC1 in Arabidopsis, which led to greater Zn accumulation in the roots and shoots when compared with control plants. 59
Gene 688 (2019) 54–61
B. Zhu et al.
Fig. 7. Zinc contents in different tissues of transgenic Arabidopsis after (A) Zn+ and (B) Zn++ treatments. Zn+: 0.05 mM ZnSO4·7H2O; Zn++: 1.0 mM ZnSO4·7H2O.
roots to the shoots under excess Zn (Arrivault et al., 2006; Zhang et al., 2016). This study also demonstrated that high concentrations of Zn inhibit the expression of AtMPT3 in both wild-type and transgenic plants (Fig. 5B). In conclusion, a novel S. miltiorrhiza NAC TF, SmNAC1, was isolated and characterized in this study. In transgenic Arabidopsis, SmNAC1 overexpression enhanced plant tolerance to Zn stress and improved Zn content. These results enhance our understanding of the roles of S. miltiorrhiza NAC TFs in the plant response to Zn stress and may provide candidate genes for enhancing plant Zn content. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2018.11.076.
unregulated high-affinity binding of Zn to sulfur-, nitrogen- and oxygen-containing functional groups in biological molecules, can cause inactivation and damage, as well as the uncontrolled displacement of essential cofactor metal cations, for example Mn2+ and Fe2+. Metal tolerance proteins (MTPs) are associated with the process of metallic element tolerance (Gaitán-Solís et al., 2015). In Arabidopsis, the Zn transporters AtMTP1 and AtMTP3 played distinct roles in Zn absorption and transportation (Zhang et al., 2016). In this study, the expression levels of AtMPT1 and AtMPT3 were higher in the root tissue and lower in the shoot tissue. Additionally, the expression of AtMPT1 was up-regulated by excess Zn, while the expression of AtMTP3 showed a different expression pattern compared with AtMTP1 (Fig. 5A and B). Previous work has indicated that AtMTP1 is inhibited under high Zn concentrations (Wang et al., 2017). The present study suggested that SmNAC1 and AtMPT1 coordinate expression in transgenic Arabidopsis and are highly expressed under excess Zn conditions (Fig. 5A). AtMTP3 plays important roles in restricting the transportation of Zn from the
Conflict of interest The authors declare that they have no conflict of interest. 60
Gene 688 (2019) 54–61
B. Zhu et al.
Acknowledgements
NAC transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta (BBA) Gene Regul. Mech. 1819, 97–103. Nuruzzaman, M., Sharoni, A.M., Kikuchi, S., 2013. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front. Microbiol. 4, 1–16. Olsen, A.N., Ernst, H.A., Leggio, L.L., Skriver, K., 2005. NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci. 10, 79–87. Pinton, R., Cakmak, I., Marschner, H., 1993. Effect of zinc deficiency on proton fluxes in plasma membrane-enriched vesicles isolated from bean roots. J. Exp. Bot. 44, 623–630. Puranik, S., Sahu, P.P., Srivastava, P.S., Prasad, M., 2012. NAC proteins: regulation and role in stress tolerance. Trends Plant Sci. 17, 369–381. Ravipati, A.S., Zhang, L., Koyyalamudi, S.R., Jeong, S.C., Reddy, N., Bartlett, J., Smith, P.T., Shanmugam, K., Münch, G., Wu, M.J., Satyanarayanan, M., Vysetti, B., 2012. Antioxidant and anti-inflammatory activities of selected Chinese medicinal plants and their relation with antioxidant content. BMC Complement. Alternat. Med. 12, 173. Rieu, I., Powers, S.J., 2009. Real-time quantitative RT-PCR: design, calculations, and statistics. Plant Cell 21, 1031–1033. Tran, L.S., Nakashima, K., Sakuma, Y., Simpson, S.D., Fujita, Y., Maruyama, K., Fujita, M., Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K., 2004. Isolation and functional analysis of Arabidopsis stress inducible NAC transcription factors that bind to a drought responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16, 2481–2498. Uauy, C., Distelfeld, A., Fahima, T., Blechl, A., Dubcovsky, J., 2006. A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 314, 1298–1301. Wang, D.L.Y., Lv, S.L., Jiang, P., Li, Y.X., 2017. Roles, regulation, and agricultural application of plant phosphate transporters. Front. Plant Sci. 8, 817. Wu, Y., Deng, Z., Lai, J., Zhang, Y., Yang, C., Yin, B., Zhao, Q., Zhang, L., Li, Y., Xie, Q., 2009. Dual function of Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res. 19, 1279–1290. Xu, X.B., Jiang, Q.H., Ma, X.Y., Ying, Q.C., Shen, B., Qian, Y.S., Song, H.M., Wang, H.Z., 2012. Deep sequencing identifies tissue-specific microRNAs and their target genes involving in the biosynthesis of tanshinones in Salvia miltiorrhiza. PLoS One 9, e111679. Xu, Z.C., Peters, R.J., Weirather, J., Liao, B.S., Zhang, X., Zhu, Y.J., Ji, A.J., Zhang, B., Hu, S.N., Au, K.F., Song, J.Y., Chen, S.L., 2015. Full-length transcriptome sequences and splice variants obtained by a combination of sequencing platforms applied to different root tissues of Salvia miltiorrhiza and tanshinone biosynthesis. Plant J. 82, 951–961. Yang, X.W., Wang, X.Y., Ji, L., Yi, Z.L., Fu, C.X., Ran, J.C., Hu, R.B., Zhong, G.K., 2015. Overexpression of a Miscanthus lutarioriparius NAC gene MlNAC5 confers enhanced drought and cold tolerance in Arabidopsis. Plant Cell Rep. 34, 943–958. Yoo, S.Y., Kim, Y.H., Kim, S.Y., Lee, J.S., Ahn, J.H., 2007. Control of flowering time and cold response by a NAC-domain protein in Arabidopsis. PLoS One 2, e642. Zhang, Y.X., Sun, T.Z., Liu, S.Q., Dong, L., Liu, C.Y., Song, W.W., Liu, J.J., Gai, S.P., 2016. MYC cis-elements in PsMPT promoter is involved in chilling response of Paeonia suffruticosa. PLoS One 11, e0155780. Zhao, J.L., Zhou, L.G., Wu, J.Y., 2010. Effects of biotic and abiotic elicitors on cell growth and tanshinone accumulation in Salvia miltiorrhiza cell cultures. Appl. Micro. Biotech. 87, 137–144.
We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. This work was financed by National Natural Science Foundation of China (31860375), grants from the State Key Laboratory of Crop Biology (2018KF02), Natural Science Foundation of Shandong Province (ZR2018MC016), Guizhou Science and Technology Foundation (Qiankehe LH 2016-7206, Qiankehe LH 2016-7210, Qiankehe LH 2017-7356 and QKHJZLKS[2012]21). References Arrivault, S., Senger, T., Krämer, U., 2006. The Arabidopsis metal tolerance protein AtMTP3 maintainsmetal homeostasis by mediating Zn exclusion from the shoot under Fe deficiency and Zn oversupply. Plant J. 46, 861–879. Broadley, M.R., White, P.J., Hammond, J.P., Zelko, I., Lux, A., 2007. Zinc in plants. New Phytol. 173, 677–702. Brune, A., Urbach, W., Dietz, K.J., 1994. Zinc stress induces changes in apoplasmic protein content and polypeptide composition of barley primary leaves. J. Exp. Bot. 45, 1189–1196. Fujita, M., Fujita, Y., Maruyama, K., Seki, M., Hiratsu, K., Ohme-Takag, M., Tran, L.S.P., Yamaguchi-Shinozaki, K., Shinozaki, K., 2004. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 39, 863–876. Gaitán-Solís, E., Taylor, N.J., Siritunga, D., Stevens, W., Schachtman, D.P., 2015. Overexpression of the transporters AtZIP1 and AtMTP1 in cassava changes zinc accumulation and partitioning. Front. Plant Sci. 6, 492. Guerinot, M.L., Yi, Y., 1994. Iron: nutritious, noxious, and not readily available. Plant Physiol. 104, 815–820. Hao, Y.J., Wei, W., Song, Q.X., Chen, H.W., Zhang, Q.Y., Wang, F., Zou, H.F., Lei, G., Tian, A.G., Zhang, W.K., Ma, B., Zhang, J.S., Chen, S.Y., 2011. Soybean NAC transcription factors promote abiotic stress tolerance and lateral root formation in transgenic plants. Plant J. 68, 302–313. He, X.J., Mu, R.L., Cao, W.H., Zhang, Z.G., Zhang, J.S., Chen, S.Y., 2005. AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. Plant J. 44, 903–916. Jeong, J.S., Kim, Y.S., Baek, K.H., Jung, H., Ha, S.H., Do Choi, Y., Kim, M., Reuzeau, C., Kim, J.K., 2010. Root-specific expression of OsNAC10 improves drought tolerance and grain yield in rice under field drought conditions. Plant Physiol. 153, 185–197. Li, S.Z., Zhou, X.J., Zhao, Y.F., Li, H.B., Liu, Y.F., Zhu, L.Y., Guo, J.J., Huang, Y.Q., Yang, W.Z., Fan, Y.L., Chen, J.T., Chen, R.M., 2016. Constitutive expression of the ZmZIP7 in Arabidopsis alters metal homeostasis and increases Fe and Zn content. Plant Physiol. Biochem. 106, 1–10. Mao, X., Zhang, H., Qian, X., Li, A., Zhao, G., Jing, R., 2012. TaNAC2, a NAC-type wheat transcription factor conferring enhanced multiple abiotic stress tolerances in Arabidopsis. J. Exp. Bot. 63, 2933–2946. Mitsuda, N., Iwase, A., Yamamoto, H., Yoshida, M., Seki, M., Shinozaki, K., Ohme-Takagi, M., 2007. NAC transcription factors, NST1 and NST3, are key regulators of the formation of secondary walls in woody tissues of Arabidopsis. Plant Cell 19, 270–280. Nakashima, K., Takasaki, H., Mizoi, J., Shinozaki, K., Yamaguchi-Shinozaki, K., 2012.
61