A Cross-Talk Between Hypoxia and TGF-β Orchestrates Erythropoietin Gene Regulation Through SP1 and Smads

doi:10.1016/j.jmb.2003.12.023

J. Mol. Biol. (2004) 336, 9–24

A Cross-Talk Between Hypoxia and TGF-b Orchestrates Erythropoietin Gene Regulation Through SP1 and Smads Tilman Sa´nchez-Elsner1, Jose R. Ramı´rez2, Francisco Rodriguez-Sanz1 Elisa Varela1, Carmelo Bernabe´u1 and Luisa M. Botella1* 1 Centro de Investigaciones Biolo´gicas, CSIC. Ramiro de Maeztu, 9, Madrid 28040 Spain 2

Hospital Militar Go´mez Ulla Madrid, Spain

Erythropoietin (Epo) is the humoral regulator of red blood-cell production. Low oxygen tension increases the Epo levels by enhancing transcription, through the hypoxia-inducible factor (HIF)-1, a transcriptional modulator in oxygen-regulated gene expression. In the present work, a cooperative interaction between hypoxia, mediated by the HIF-1 complex, and transforming growth factor-b (TGF-b), mediated by Smad3/4, was revealed in the Epo gene. This cooperation is due to physical interaction between Smad3/4 and HIF-1a. The Smad3/4 binding site is located within the 30 Epo enhancer, downstream from the HRE consensus, and immediately adjacent to the orphan hepatic nuclear factor receptor (HNF-4). HNF-4 is interacting also with Smad3 and the HIF-1 complex, to potentiate further the cooperative effect between both factors. Moreover, Sp1 has been identified as the factor binding the promoter necessary for the full hypoxia inducibility of the EPO gene. However, this full induction is achieved only if the TGF-b pathway is mediating a cross-talk between promoter (Sp1) and enhancer (HIF-1a) regions through Smad3. We show that Sp1 binding to the proximal promoter is relevant for Epo transcription, and contributes to the Epo induction by hypoxia. A functional cooperation among the transcription factors mediating hypoxia (HIF-1, Sp1), the TGF-b pathway (Smad3/4), and tissue-specific HNF-4 is proposed for the regulation of the Epo gene. In this model, the physical contact between the upstream promoter and the 30 downstream enhancer is mediated by Sp1 and Smad3 factors, and would occur upon bending of the DNA intervening sequences. Thus, Sp1 would reinforce the promoter/enhancer contact, while Smad3 would stabilize the multifactorial complex by interacting with HIF-1/Sp1/HNF-4 and the coactivator CBP/ p300. This model may be extended to other genes where collaboration between TGF-b and hypoxia takes place. q 2003 Elsevier Ltd. All rights reserved.

*Corresponding author

Keywords: erythropoietin; hypoxia; TGF-b; Sp1; transcription factors

Present address: T. Sa´nchez-Elsner, Department of Biochemistry and Molecular Biology, University of California at Riverside, USA. Abbreviations used: ChIP, chromatin immunoprecipitation; EPO, erythropoietin; HIF, hypoxia-inducible factor; TGF-b, transforming growth factor-b; HRE, hypoxia response element; HNF-4, hepatocyte nuclear factor 4; VEGF, vascular endothelial growth factor; EMSA, electrophoretic mobility-shift assay; SBE, Smad binding element; GST, glutathione-Stransferase. E-mail address of the corresponding author: [email protected]

Introduction Erythropoietin (EPO)1 is a 34.4 kDa glycoprotein hormone, identified as the humoral factor regulating red blood-cell production. Decreased levels of oxygen positively regulate the expression of the EPO gene. Erythropoiesis normally is kept at a low basal level to compensate for the loss of old red cells. However, in a situation of increased erythrocyte demand, like low oxygen tension, anemia, or bleeding, the production of EPO is induced up to 1000-fold above the normal levels.1 The

0022-2836/$ - see front matter q 2003 Elsevier Ltd. All rights reserved.

10

research on EPO regulation by hypoxia has led to general models for the regulation of other hypoxiamodulated genes, basically those of the glycolytic pathway, and those involved in angiogenesis.2 EPO is produced primarily by fetal liver3 and adult kidney4 and, to some extent, by hematopoietic progenitor cells.5 EPO transcriptional regulation is achieved by several transacting factors on the 50 proximal promoter and the 30 untranslated region of the gene.6 – 11 In the 30 untranslated region there is a 50 bp hypoxia-responsive enhancer element (HRE), placed 120 bp downstream from the polyadenylation site. There are three types of factors binding this HRE. One is the hypoxia-inducible factor (HIF-1), which binds the consensus CCAC GTGG.9 The second is required for HIF-1 transactivation of the main hypoxia element, the so-called hypoxia ancillary element (CACAG).12 Moreover, the orphan receptor hepatocyte nuclear factor 4 (HNF-4) is bound to two tandemly arranged boxes to the right of the HIF-1 site.13 HNF-4 functions as a transcriptional activator for tissue and hypoxia-specific EPO expression, and is antagonized by EAR3/COUP-TF1.10 The role of the p300/CBP as coadaptor for HNF-4 and HIF-1 has been described for the EPO enhancer.11 On the other hand, the EPO proximal promoter does not have TATA or CAAT boxes, but it has a GC-rich region that contributes to hypoxic induction through an unknown factor acting coordinately with the 30 enhancer.8 Interestingly, deletion of a 17 bp fragment from 2 61 to 2 45 decreases the EPO hypoxic induction.14 Vascular endothelial growth factor (VEGF) and EPO genes are the best studied examples of hypoxia-regulated genes. Multiple similarities between these genes have been shown at the level of oxygen sensing, and signal transduction pathways.1 At the transcriptional level, they share common HRE and ancillary consensus sequences.1 Recently, a transcriptional cooperation between hypoxia and transforming growth factor-b (TGF-b) pathways, mediated by HIF-1, and Smad3/4 factors, has been described in VEGF and endoglin genes.15,16 When comparing the upstream enhancer of VEGF containing the hypoxia and TGF-b elements (HRE and SBE, respectively) with the EPO 30 enhancer, similarities between consensus sites are found. Thus, HRE and SBE sequences on VEGF promoter are preserved in EPO, except that the putative EPO SBE is found in an inverted and complementary orientation.1,9,15,17 TGF-b had been shown to regulate erythroid differentiation.18 – 22 However, the role of TGF-b on the regulated expression of EPO has been poorly evaluated. Several reports have shown that deficiency in TGF-b receptors or transducers (Smads) are associated with hematopoietic defects and anemia. Thus, TGF-b1 null mutation causes defects in haematopoiesis;23 mice lacking one copy each of Smad2 and Smad3 suffered midgestation lethality due to liver hypoplasia and anemia;24 and a defective erythropoiesis has been reported in

Erythropoietin Gene Regulation by Hypoxia and TGF-b

TGF-b type I receptor-deficient mice.25 In this last example, murine embryos knocked out for TGF-b type I receptor are anemic, but their hematopoietic ability remains intact, as shown when hematopoietic precursor cells are cultured in vitro in the presence of EPO. These observations, the previous synergism between hypoxia and TGF-b pathways,15,16 and the presence of SBE consensus motifs in the 30 EPO enhancer, prompted us to investigate the possible relationship between hypoxia and TGF-b in EPO gene regulation. Moreover, given the presence of cis-acting factors on this 30 enhancer, mainly HNF4, and the contribution of the proximal promoter to the hypoxic response, we tried to assess a functional relationship among all known elements in the transcription of EPO. We found that a synergism between hypoxia and TGF-b stimuli takes place in EPO, similar to the VEGF and endoglin genes. In these genes, VEGF, endoglin and EPO, the transcriptional cooperation is the result of multiple interactions between transcription factors, the coadaptor CBP/p300 and transcriptional machinery. In endoglin and EPO, these interactions require also a looping of the intervening DNA sequences.

Results and Discussion TGF-b synergizes with hypoxia to increase EPO expression To investigate the possible involvement of TGF-b on EPO-regulated expression, non-confluent cultures of Hep3B cells were treated with or without TGF-b and simultaneously subjected to normoxic (21%) or hypoxic (1%) conditions for 24 hours. The amount of EPO released to the culture was measured by radioimmunoassay (Figure 1A). Whereas TGF-b alone, induced EPO production only slightly (1.5-fold), hypoxia induced the secretion by 4.2-fold, and the combined effect of both treatments was synergistic, yielding an 8.4fold increase in the EPO synthesis. To assess whether the synergism between hypoxia and TGF-b takes place at the RNA level, semi-quantitative reverse transcribed (RT)-PCR of a 300 bp EPO-specific cDNA versus actin was carried out. Figure 1B shows that after 20 PCR cycles, TGF-b is enhancing the effect of hypoxia on the RNA EPO production by fourfold. After 25 cycles, a synergic cooperation between hypoxia and TGF-b is evident; while TGF-b or hypoxia alone increase RNA levels around 1.4-fold or 3.4-fold, respectively, the combination of both stimuli results in an 8.2-fold increase in EPO RNA levels, coincident with the results obtained at the protein level. TGF-b and hypoxia collaborate at the transcriptional level on the EPO 30 enhancer The reporter construct, Pwt Epo, containing the EPO enhancer and proximal promoter fused

Erythropoietin Gene Regulation by Hypoxia and TGF-b

11

Figure 1. Effect of TGF-b and hypoxia on EPO synthesis. Hep3B cells were subjected to different treatments: N (normoxic conditions, 21% oxygen, 5% CO2), T (10 ng/ml of TGF-b1), and H (hypoxic conditions, 1% oxygen, 5% CO2), as indicated. A, Detection of EPO secretion. EPO was measured by RIA and the results are expressed in milliunits of the hormone secreted in 1 ml of culture medium by 100,000 cells. Experiments were repeated three times in duplicate, and the figure shown is a representative result. B, RT-PCR analysis. RNA levels of EPO were measured by semiquantitative RT-PCR of a 300 bp EPO-specific fragment in comparison to a 400 bp actin-specific cDNA. The RT-PCR was repeated three times, and a representative experiment is shown. The upper and lower histograms show the densitometries of the gels obtained after 20 and 25 cycles of PCR, respectively.

upstream from the luciferase26 was transiently transfected in Hep3B cells and the independent effects of TGF-b, hypoxia, or both at the same time, were examined (Figure 2A). While TGF-b alone did not significantly affect the reporter activity, hypoxia increased the luciferase activity more than three times, and the combined effects of the stimuli were synergistic, with an eightfold increase over the basal luciferase activity. A parallel experiment was performed substituting the effects of hypoxia and TGF-b by the corresponding transcription factors HIF-1a, and Smad3/4, respectively. Basically, the same effect as that shown in Figure 2A was observed (Figure 2B). We performed the same experiment as that shown in Figure 2B, but under hypoxic conditions, and found that although the induction values were slightly higher, the overall response was qualitatively the same (data not shown). Thus, cooperation between hypoxia and TGF-b was operating at the transcriptional level, and was mediated by HIF-1 and Smads, respectively. Furthermore, the reporter

pGL2/Epo enhancer was used in transient transfections of Hep3B cells to assess whether the cooperation between the transcription factors was taking place on the 30 EPO enhancer. As shown in Figure 2C, HIF-1a/b and Smad3/4 are indeed cooperating at the transcriptional level on the 30 EPO enhancer. The region of interest on the EPO 30 enhancer is depicted in Figure 3. The sequence 50 CACGTGCT 30 is the HRE for HIF-1 localized at the 30 untranscribed EPO enhancer.1,6,26 In the close vicinity of HRE, a second site, 7 bp 30 of HIF-1 site has the CACAG motif, the hypoxia ancillary sequence (HAS) for binding of hypoxia ancillary factors,12 and essential for hypoxia inducibility.1 Two sites arranged in tandem for the HNF-4 hepatic orphan receptor are found to the right of HRE10 and marked in Figure 3A. However, no TGFb/Smad responsive element (SBE) has been defined so far. Smads have DNA binding affinity for G/C-rich tracts, and mainly to the CAGAC sequence.27 Analysis of the HRE flanking sequences within the

12

Erythropoietin Gene Regulation by Hypoxia and TGF-b

EPO enhancer revealed the presence of a consensus SBE that contains the complementary inverted sequence of the CAGAC motif (Figure 3A). The ability of this putative Smad-binding element to bind Smad3/4 proteins was assessed in band-shift assays (Figure 3B). Smads do not bind alone to DNA, but in cooperation with different transcription factors, which interact with a consensus motif in close vicinity to SBE within the DNA.27,28 Interestingly, we found a putative consensus for SBE on the EPO enhancer, in the close proximity of both the HIF-1 binding site on one side, and the HNF-4 on the other side. Fusion recombinant proteins GST/Smad3 and GST/Smad4 were able to bind an oligonucleotide encompassing this sequence. The complexes DNA/Smads are specific because they are competed by an excess of cold oligonucleotide. Moreover, antibodies against Smads could supershift the specific complexes. On the other hand, the same oligonucleotide could support the binding of HIF-1a/b, as it contained the HRE-specific sequence (Figure 3B). No alteration of the hypoxia complex was detected upon treatment with TGF-b, or by transfection with Smad3/Smad4, or preincubation with anti-Smad antibodies (data not shown), pointing out the difficulty in observing the labile Smad-DNA interaction using nuclear extracts. This difficulty of detecting native nuclear binding due to Smad or TGF-b-treated nuclear extracts, is well known.28 To assess the functionality of this putative consensus SBE on the EPO enhancer, experiments using a Pwt Epo construct mutated at the SBE were performed. No TGF-b stimulation nor synergism between hypoxia and TGF-b pathways was found using the SBE mutated construct (Figure 3C), suggesting that the SBE site at the EPO enhancer is functioning as a TGF-b/Smad-binding element involved in both TGF-b responsiveness and the cooperative transcription induced by the combined stimulation of TGF-b and hypoxia. In summary, the synergistic cooperation Smad3/HIF-1 takes place at the transcriptional level and through their specific binding to DNA sites placed in the 30 EPO enhancer.

Figure 2. Hypoxia and TGF-b regulate the expression of EPO at the level of transcription, acting on the 30 EPO enhancer. A, Hep3B cells were transiently transfected with the reporter plasmid Pwt 30 EPO and subjected for 24 hours to hypoxia (1% oxygen) and/or TGF-b (10 ng/ ml) treatments, as indicated. Luciferase units were normalized to b-galactosidase levels in each sample. Three different experiments were performed in triplicate, and a representative experiment is shown. B, Hep3B cells were transiently cotransfected with the reporter plasmid

Pwt 30 Epo and expression vectors for HIF-1a and/or Smad3/4, as indicated. Luciferase units were normalized to b-galactosidase levels in each sample. Three different experiments were performed in triplicate, and a representative experiment is shown. C, Hep3B cells were transiently transfected with plasmid pGL2P/Epo, harboring the 30 EPO enhancer fused to the minimal SV40 promoter and to the luciferase reporter gene, and cotransfected with expression vectors for HIF-1a and/or Smad3/4. Filled bars, experiments with additional TGF-b (10 ng/ ml) treatments. Luciferase units were normalized to b-galactosidase levels in each sample. Experiments were repeated at least three different times, and a representative experiment is shown.

13

Erythropoietin Gene Regulation by Hypoxia and TGF-b

Interactions among different transcription factors at the 30 EPO enhancer EPO 30 enhancer contains two hexanucleotide consensus motifs for the orphan receptor HNF-4, mediating tissue-specific, and hypoxia-inducible expression of the EPO gene.10,29 To analyze the contribution of HNF-4 to the functional cooperation between HIF-1 and Smads, HeLa cells, which do not express HNF-4,10 were transiently transfected with the Pwt Epo reporter construct, and expression vectors for Smads, HIF-1a, and HNF-4. Figure 4A shows that while the proteins Smad3/4 and HIF-1a could transactivate the EPO reporter, HNF-4 alone was unable to stimulate the reporter activity. Combinations in pairs of these factors increased the luciferase activity, but the concomitant expression of all the factors enhanced much more strongly the EPO transcription activity. Thus, all these factors, when present at the same time on the 30 EPO enhancer, may cooperate to give a more efficient transcription of the EPO gene. The cooperation among different transcription factors on the 30 EPO enhancer is taking place through protein interactions as shown in Figure 4B and C. In Figure 4B we are using the one-hybrid system (Gal4-Luc/GALBD-HIF-1a) to detect protein– protein interactions in the absence of their natural DNA-binding sites. In this type of experiment, HIF-1 is hooked to GAL4-BD and cooperates only with factors that can interact with it directly. Hence, Figure 4B shows the cooperative interaction between HIF-1a and Smad3, in agreement with previous reports.15,16 In the same experiment, no direct interaction between HNF-4 and HIF-1a seemed to occur, although they may cooperate through the common adaptor CBP/p300.11 Nonetheless, a ternary interaction among HIF-1, Smad3/4, and HNF-4 was revealed. Presumably, Smad3 is the key element of this interaction because it contacts HIF-1a on one hand, and HNF-4 on the other hand (Figure 4B). Supporting this view are immunoprecipitation experiments from Hep3B cells subjected to hypoxia alone, or to hypoxia and TGF-b (Figure 4C). Hep3B cells constitutively express HNF-4,10 and HNF-4 was coimmunoprecipitated with HIF-1a only when cells were subjected to TGF-b treatment. These results are in agreement with published data15 and support the pivotal role of Smads in the interaction among transcription factors on the 30 EPO enhancer. The proximal promoter of EPO gene is involved in the hypoxic response The minimal EPO promoter capable of induction by hypoxia encompasses 117 bp 50 to the transcription initiation site.1,8 A segment of 17 bp is responsible for this upregulation by hypoxia between positions 2 61 to 2 45.14 This sequence is a G/Crich tract (Figure 5A), with putative binding sites for Sp1 elements. When an oligonucleotide encom-

passing from 2 65 to 2 45 was used in electrophoretic mobility-shift assay (EMSA), a specific complex was formed. This complex contained Sp1 because it could be supershifted by specific antibodies and the mutation at a putative Sp1 binding site, could not compete for binding (Figure 5B). The role of Sp1 in the transactivation of Pwt EPO promoter was analyzed in Schneider cells, where Sp1 is not expressed. The cotransfection of an expression vector for Sp1 increased by almost 22fold the EPO promoter activity, while it was not increased at all when the putative Sp1 site was mutated in Pwt Epo promoter (Figure 5C). Next, we measured the contribution of Sp1 to the hypoxia responsiveness of EPO gene, by performing experiments similar to that shown in Figure 2A, but using an Sp1-mutated Pwt Epo construct. No significant hypoxia stimulation (1.4-fold), nor synergism between hypoxia and TGF-b pathways was found in the Sp1 mutated construct (Figure 5D), suggesting that Sp1 is a critical element involved in the cooperative transcription of EPO induced by the combined stimulation of TGF-b and hypoxia. Physical and functional interplay between promoter and 30 enhancer of EPO gene Since the Sp1 site on the proximal promoter (at 2 57/2 45) is involved in the hypoxia induction whose target HRE is on the 30 enhancer (at 125/ 140, downstream the poly(A) site), the possible interplay between the EPO proximal promoter and the distant 30 enhancer was addressed. The joint effect of 50 promoter and 30 enhancer was analyzed on the Pwt construct by transient transfections in Schneider cells where Sp1, HIF-1, and HNF-4 are not expressed (Figure 6A). A functional interaction between Sp1, on the 50 promoter, and HIF-1, on the 30 enhancer, was demonstrated, whereas the strongest transactivation was observed when Sp1 and HIF-1a were co-transfected with Smad3. This supports a cooperative functional interaction between the 50 promoter, and the 30 enhancer transcription elements of EPO. Next, the physical interaction among the different transcription factors involved in the 30 Epo enhancer and Sp1 from EPO promoter was assessed using the Gal4-Luc/Gal4-Sp1 one-hybrid system (Figure 6B). No significant interaction between HNF-4 and Sp1 could be detected, but when Smad3 was added, the activity of the reporter was enhanced cooperatively. This result suggests that Smad3 is acting as a bridge between HNF-4 and Sp1. This study provides several lines of evidence supporting the existence of physical and functional interactions among multiple transcription factors involved in the regulation of the erythropoietin gene. The induction of EPO by hypoxia is potentiated in a synergistic way by the TGF-b/Smad3 pathway, as described for VEGF and endoglin genes.15,16 The TGF-b effect is mediated by an SBE

14

Erythropoietin Gene Regulation by Hypoxia and TGF-b

Figure 3. The EPO enhancer contains both SBE and HRE functional sites. A, Schematic of the EPO gene structure with the promoter and 30 enhancer region. Important motifs like the hypoxia responsive element (HRE), the hypoxia ancilliary sequence (HAS) and the putative Smad binding element (SBE), are indicated. B, Electrophoretic mobility-

Erythropoietin Gene Regulation by Hypoxia and TGF-b

15

Figure 4. Protein interactions between different transcription factors on the 30 EPO enhancer. A, HeLa cells were transiently transfected with Pwt Epo luciferase reporter and different expression vectors for HIF-1a, Smad3/4, and HNF-4 transcription factors. Luciferase units were normalized to b-galactosidase levels in each sample. Three different experiments were performed in triplicate, and a representative experiment is shown. B, HeLa cells were transiently transfected with the fusion reporter Gal4-luc, and the expression vector encoding HIF-1a-Gal4 binding domain. Interactions between HIF-1a and Smad3 and/or HNF-4 were elucidated by transient cotransfection with the corresponding expression vectors, as indicated. Luciferase units were normalized to b-galactosidase levels in the sample. Three different experiments were performed in triplicate, and a representative experiment is shown. C, Co-immunoprecipitation experiments. Hep3B cells were either untreated, or treated under hypoxia (1% oxygen) and/or TGF-b. Protein extracts were immunoprecipitated with an antibody against HIF-1a, and the precipitates were subjected to SDS-PAGE, followed by Western blot analysis (WB) with antibodies against HNF-4 or HIF-1a. The positions of HNF-4, HIF-1a, and the immunoglobulin (IgG) heavy chain used for immunoprecipitation are indicated. Similar results were obtained in three different experiments.

found on the 30 downstream EPO enhancer, immediately upstream from the HNF-4 binding sites. This SBE is a bona fide Smad consensus CAGACA30 but placed in inverted/complementary disposition. In addition, the orphan receptor factor HNF-4 strengthens the functional cooperation in

EPO, among TGF-b and hypoxia pathways. A complex interplay, among the transcription factors mediating hypoxia (HIF-1), TGF-b (Smads) and tissue-specific factors (HNF-4) occur in the 30 EPO enhancer through direct protein interaction. In this interaction, Smad3 plays a central role, as it

shift assays (EMSAs) using as probe the wild-type (WT) radiolabeled oligonucleotide corresponding to the 30 enhancer (see A). For Smad binding assays (left panel), GST fusion proteins for Smad3 or Smad4 were used. Competition experiments were carried out using the unlabeled probe (WT). For HIF-1 binding assays (right panel), TnT extracts of HIF-1a and/or HIF-1b, were used as a source for HIF-1 transcription factor. Supershifts (SS) were detected with both Smad3/4 and HIF-1a antibodies, as indicated. C, Hep3B cells were transiently transfected with either the WT Pwt Epo reporter, or its SBE mutant (Smad Mut) version in the EPO enhancer. The corresponding WT and mutant SBE sequences are indicated in parentheses. Cells were treated under either normoxic (21% oxygen) or hypoxic (1% oxygen) atmosphere, with or without TGF-b1 (10 ng/ml). The results are given in fold-induction values normalized with respect to the normoxic situation for both constructs. The experiment was repeated at least three times, and the data shown correspond to one representative experiment in triplicate.

16

Erythropoietin Gene Regulation by Hypoxia and TGF-b

Figure 5. Analysis of the Sp1 site on the EPO upstream promoter. A, Wild-type sequence of the proximal EPO promoter between positions 266 and 242 (WT). The consensus Sp1 site is underlined. The sequence containing mutations that disrupt the Sp1 consensus site (see asterisks) is shown (Mut). B, EMSA using as probe the radiolabeled oligonucleotide corresponding to the wild-type EPO upstream promoter (see A). Nuclear extracts from Hep3B cells were used as source of proteins. A 100-fold excess of cold competitors (WT and Mut; see A) were used. As shown in lane 4, a specific Sp1 antibody was used, giving rise to a supershift (SS). C, Effect of Sp1 mutation on the promoter activity. Schneider cells were transiently transfected with either the WT Pwt Epo reporter, or with its Sp1 mutant version in the upstream EPO promoter (Mut), as shown in A. In both cases, cells were subjected to cotransfection with an expression vector for Sp1 (pAC Sp1), or with the empty vector (pAC). The numbers in the upper part of the bars show the fold increase in luciferase activity after Sp1 cotransfection. The experiment was repeated three times, and the data shown correspond to one representative experiment in triplicate. D, Hep3B cells were transiently transfected with either the WT Pwt Epo reporter, or with its Sp1 mutant version in the upstream EPO promoter (Mut), as shown in A. Cells were treated under either normoxic (21% oxygen) or hypoxic (1% oxygen) atmosphere, with or without TGF-b1 (10 ng/ml). The results are given in fold-induction values (numbers shown in the upper part of the histogram bars), normalized with respect to the normoxic situation for both the wild-type construct (WT) or the mutant (Mut Sp1). The experiment was repeated at least three times, and the data shown correspond to one representative experiment in triplicate.

interacts with HIF-1a, as documented previously15,16 but it is potentiating HIF-1/HNF-4 interaction. Thus, only when Hep3B cells (constitutively expressing HNF-4) are stimulated with TGF-b (Smads), HIF-1a can be coimmunoprecipitated with HNF-4. One way to explain this result is through a direct interaction Smad3/HNF-4, as may be inferred from Figure 6B. Another possibility, compatible with the first one, is the inter-

action of these factors through the common adaptor CBP/p300. In fact, this coadaptor interacts with Smads,30 HNF-4,31 and HIF-1a.32 Moreover, HNF-4 plays a critical role in the regulated expression of EPO as it is expressed constitutively in kidney and liver cells, where EPO is synthesized, and it is necessary for a complete hypoxic induction of the EPO gene.10 On the other hand, this work demonstrates that

Erythropoietin Gene Regulation by Hypoxia and TGF-b

17

Figure 6. Interactions between transcription factors on the 30 downstream EPO enhancer and Sp1 on the EPO promoter. A, Schneider cells were transiently cotransfected with Pwt Epo reporter and different expression vectors for Sp1, HIF-1a, and Smads. Luciferase units were measured relative to b-galactosidase levels in each sample. Three different experiments were carried out in triplicate, and a representative experiment is shown. B, HeLa cells were transiently cotransfected with the reporter Gal4-luc and different expression vectors for Gal4-Sp1, Smad3, and HNF-4, as indicated. The results shown are the average of three replicates, and the experiment is representative of three different experiments.

Sp1 is at least one of the upstream additional factors postulated as necessary for the complete induction of EPO by hypoxia.11,14 Here, we have described physical and functional interactions between HIF-1a, which binds to the 30 downstream enhancer,11 and Sp1, which binds to the proximal promoter. Accordingly, for an interaction HIF-1/ Sp1, a fold-back in the DNA intervening sequences appears to be necessary. In this setting, Smad3/4 would stabilize interactions between physically distant DNA sites like Sp1 and HIF-1 in the EPO gene, and, as we have previously hypothesized, in endoglin.16 In both cases, the Sp1/HIF-1 association could bring together the two elements bound by these transcription factors and this association would be reinforced by Smads, in agreement with data from the endoglin promoter16 and this work. In fact, bending of DNA has been reported as a mechanism by which some transcription factors can increase the efficiency of basal promoters.33 While the stability of DNA looping is achieved by

Sp1 self-association in some promoters,34 in the EPO promoter we postulate an interplay between Sp1 and Smad3 to achieve a productive bending in terms of transcription efficiency. DNA bending of the 30 downstream EPO enhancer has been admitted implicitly in the literature, since the HRE was mapped downstream from the EPO gene.6 – 11 During the formation of DNA loops, distal segments of DNA come into close proximity. The process can be measured by a time-course in vitro cyclization dynamics when DNA ligase is added. This test is accepted as a model for the study of DNA conformational changes due to looping or bending.35,36 Interactions between the elements binding to the 30 enhancer and 50 promoter of EPO, as well as those with the general transcription machinery, should require a loop in the DNA intervening sequences. Presumably, upon binding of the transcription factors to their consensus sites, the bending of the intervening DNA is facilitated.

18

However, a DNA fragment of more than 6 kb is spanning the promoter and the 30 enhancer of EPO, which hampers any attempt to measure in vitro cyclization kinetics with the whole EPO gene. However, we have a similar situation in the case of endoglin; in this gene, the HRE is placed around 300 bp downstream from the transcription start, whereas HIF-1 is interacting with Sp1 and Smad3, whose consensus sites are at 50 bp upstream.16 The mechanism of a DNA loop mediating upstream/downstream interactions in the endoglin gene could explain the hypoxia/TGF-b cooperation in this gene, and was already implicit in a previous work.16 Hence, we performed the

Erythropoietin Gene Regulation by Hypoxia and TGF-b

cyclization experiment with an endoglin fragment of around 350 bp, obtained by PCR, encompassing the upstream promoter, the transcription initiation and downstream untranslated 50 region. We analyzed whether the presence of Sp1, HIF-1 and Smad3 in nuclear extracts may facilitate the ligation of the fragment containing both connecting sites, 50 promoter and 30 enhancer. A ligation kinetics was performed for naked DNA, for DNA and normoxic extracts, and for DNA and hypoxia/TGF-btreated extracts. As shown in Figure 7A, nuclear extracts from TGF-b/hypoxia-stimulated Hep3B cells promote faster cyclization than normoxic extracts. To show that the difference is due to the

Figure 7. Cyclation dynamics of endoglin promoter and Epo upstream promoter/30 downstream enhancer. DNA fragments corresponding to the PCR-amplified 350 bp fragment from endoglin promoter (A) and Xba I 500 bp from the Pwt Epo construct (B), were subjected to ligation in the absence of proteins (naked DNA), or in the presence of nuclear extracts from Hep3B cells after normoxia (21% oxygen), or hypoxia (1% oxygen) plus TGF-b (10 ng/ml) treatments, as indicated. The ligation (cyclation) dynamics at different time-points was visualized in 2.5% (w/v) Nu-Sieve agarose gels stained with ethidium bromide. Upper panels show the bands corresponding to linear and circular DNA obtained with naked DNA. Depletion experiments were made by immunoprecipitation of Sp1, Smad3, and HIF-1 from nuclear extracts of cells subjected to TGF-b/hypoxia using specific antibodies, as indicated. An irrelevant antibody (antiRelC) was used as a negative control. Bands corresponding to linear and circular DNA were scanned and quantified by densitometry. The cyclation dynamics resulting from the densitometric analysis of the different samples is shown.

Erythropoietin Gene Regulation by Hypoxia and TGF-b

presence of HIF-1/Smad3 and Sp1, we depleted the TGF-b/hypoxia extracts of those factors by immuno-absorption with specific antibodies. As depicted in Figure 7A, preabsorption with specific antibodies lengthens the cyclization process, as compared to preabsorption with a control antibody. In addition to endoglin, the possibility of a DNA loop mediating the hypoxia inducibility was also tested in a more artificial construct for the EPO gene. A Xba I DNA fragment from the Pwt plasmid, which contains the 30 EPO enhancer fused to 175 nt of the upstream promoter was used for the cyclization dynamics. This DNA fragment contains the extremities of the putative loop, i.e. the 50 promoter (encompassing the sites for Sp1 binding) and 30 enhancer (containing the HIF-1,

19

Smad3 and HNF-4 sites). As in the case of endoglin, extracts from TGF-b/hypoxia-treated cells promoted faster cyclation than normoxic ones. Also, specific depletion of the different transcriptional components from the EPO complex, leads to a significant delay in the cyclization process (Figure 7B). In summary, the experiments of cyclization for the EPO gene are compatible with DNA bending of the 30 downstream enhancer region over the promoter. To analyze this bending mechanism in a more physiological context, chromatin immunoprecipitation (ChIP) experiments of both EPO endogenous enhancer and promoter regions, following different treatments of Hep3B cells, were carried out (Figure 8). Figure 8A demonstrates that under normoxia

Figure 8. ChIP of EPO promoter and enhancer DNA in Hep3B cells subjected to different treatments. A, Hep3B cells were treated with or without TGF-b under normoxic or hypoxic conditions, as indicated. Cellular extracts were subjected to immunoprecipitation with antibodies against Sp1 (aSp1), HIF-1a (aHIF) or Smad3/4 (aS3/4). PCR for ChIP assay were performed using primers positioned upstream of the transcriptional start site of the human EPO promoter (2 348 to þ 31), and at the EPO enhancer (3085 – 3506). Positions of bands corresponding to EPO promoter, EPO enhancer, and unreacted primers (P) are indicated with arrows. Samples of different treatments are separated by vertical broken lines. B, The results of the PCR were analyzed in relation to the respective inputs (1/100 of total lysate) for each treatment. Relative intensity of the bands were estimated as follows: (2), no DNA recovery; (þ ), presence of DNA bands with lower recovery than input; (þþ) similar DNA recovery as input; (þ þþ), higher DNA recovery than input.

20

none of the transcription factors studied is able to bind significantly either to the promoter or to the enhancer regions of the EPO gene. This is in agreement with the expression data from Figure 1, which show negligible EPO transcriptional activity under normoxia. On the contrary, following hypoxia, individual antibodies against Sp1, HIF-1 and Smad3/4 are capable of recruiting the DNA fragments of EPO promoter and enhancer, suggesting that hypoxia treatment induces EPO transcription engaging Sp1, HIF-1 and Smad3/4, and involving both EPO promoter and enhancer. Moreover, this recruitment into the EPO promoter and enhancer appears to be further increased after the combined treatment of hypoxia and TGF-b (Figure 8B), as expected from the transcriptional cooperation shown between hypoxia and TGF-b (Figure 2). Of course the table in Figure 8B shows just a relative estimate of the immunoprecipitation outputs related to the inputs, although we are aware that chromatin immunoprecipitation is not a quantitative technique. But all in all, what the table in Figure 8B shows is a higher recruitment of both EPO promoter and enhancer DNA, after hypoxia and TGF-b treatment compared to single treatments; and this is exactly what was expected according to the experiments shown in Figures 1–7. Interestingly, Smad3/4 is recruited into the EPO promoter and enhancer DNA sequences by TGF-b stimulation and by hypoxia treatment. This last observation further supports the reported collaboration between the TGF-b and hypoxia pathways,15,16 and agrees fully with recent reports describing that cellular response to hypoxia involves signaling via Smad proteins.37,38 In addition, control Western blot analysis demonstrated that Sp1, Smad3/4, and HIF-1a coimmunoprecipitated after hypoxia or hypoxia/TGF-b

Erythropoietin Gene Regulation by Hypoxia and TGF-b

treatments regardless of the antibody used, aSp1, aSmad3/4, or aHIF-1a (data not shown). These results support the idea of a physical interaction among the different factors, forming a multitranscriptional complex involved in the Epo transcription. Also, the ChIP experiments demonstrate that a DNA bending of EPO enhancer over the promoter takes place in the physiological chromatin context. At the same time, these data contribute to reinforce the other results shown here, concerning interactions among different transcription factors involved in EPO transcription. A general model accounting for a multicomplex interaction among all the transcription factors involved in TGF-b/hypoxia stimulation of EPO transcription is presented in Figure 9. The initiation machinery is contacted on one side by Sp1, which is playing a pivotal role by interacting with HIF-1 and Smad3 in the downstream regulatory counterpart of the EPO gene. In turn, HIF-1, Smad3/4, and HNF-4 recruit CBP/p300 to facilitate the cooperative interactions with the transcriptional machinery. Thus, regulatory models including interactions among multiple factors bound to DNA, and DNA bending promoted by them, is likely a general mechanism to control the expression of eukaryotic genomes. There must be an orchestrated symphony of transcription factors39 engaged from subtle signals to complex regulatory networks, consisting of co-activators/co-repressors, the intervening DNA, and the initiation machinery. But ultimately, genes may be regulated in their native chromatin context, and hence experimental reconstitution of transcription processes should consider chromatin template systems with chromatin remodeling co-regulators making it accessible to transcription initiation events.

Figure 9. Hypothetical model for EPO transcriptional regulation upon hypoxia and TGF-b treatments. A, The EPO proximal promoter, and the 30 downstream enhancer, showing relevant sites for transcription factors. HRE, SBE and HNF-4 BS stand for hypoxia responsive element, Smad binding element, and HNF-4 binding site, respectively. B, Promoter/enhancer interactions with the transcriptional machinery in the EPO gene after hypoxic induction. GTF, general transcription factors. C, Promoter/ enhancer interactions with the transcriptional machinery in the EPO gene after hypoxic induction and TGF-b treatment.

21

Erythropoietin Gene Regulation by Hypoxia and TGF-b

Material and Methods Cell culture

efficiency was made by cotransfection with the pCMVb-galactosidase expression vector and the enzymatic activity was determined using the Galacto-Light kit (Tropix).

The cell lines were cultured in 5% CO2 at 34 8C in medium containing 10% (v/v) fetal calf serum (FCS), 2 mM L -glutamine and penicillin –streptomycin (100 IU/ml). Human hepatoma cells Hep3B and epithelioid carcinoma HeLa cells were cultured in DMEM (Gibco). Drosophila SL-2 cells were cultured in Schneider medium (Sigma). Hypoxic treatment was carried out under 1% oxygen, 5% CO2 and 94% nitrogen for the times indicated (3– 72 hours). Treatment of cells with human recombinant TGF-b1 (R and D Systems) was performed at 4 ng/ml in medium supplemented with 0.2% FCS, except for radioimmunoassay experiments, where the concentration was 10 ng/ml in serum-free medium.

GAL4-Sp1 construct as well as GAL4-LUC reporter were used in transient transfections of HeLa cells essentially as described,40 in combination with Smad3 and/or HNF-4 expression vectors, to assess protein – protein interactions among HNF-4, Smad3 and Sp1. Transfections were repeated three times with different DNA preparations. Correction for transfection efficiency was made by cotransfection with the pCMV-b-galactosidase expression vector and the enzymatic activity was determined using the Galacto-Light kit (Tropix).

Plasmids

Radioimmunoassay

The luciferase reporter for EPO promoter enhancer (1), Pwt was kindly provided by Dr S. Imagawa (University of Tsukuba, Japan).26 The Pwt vector contains a 126-bp 30 EPO enhancer (120– 245 bp 30 of the poly(A) addition site) and the 144 bp minimal EPO promoter (from 2118 to þ26 relative to transcription initiation site) upstream of the firefly luciferase (Luc) gene in pXP2. For sitedirected mutagenesis of Sp1 and Smad sites, 50 ng of Pwt DNA plasmid was used as template for PCR using as primers 50 -AGCCTCTCCCCAATTCCAATTCGCG-30 and its complementary chain for Sp1 (in the promoter), and 50 -CTCACACATCCTTTTTGACCTCTCGACCTA CCGG-30 and its complementary chain for Smad binding element (SBE in the enhancer), where changes in the original sequence are in bold. PCR were performed by Turbo Taq DNA polymerase (Stratagene), with one minute denaturing at 95 8C, one minute annealing at 52 8C and 15 minutes elongation at 68 8C for 20 cycles. The pGL2-Epo enhancer construct was made inserting the EPO HRE 30 enhancer double-stranded oligonucleotide 50 CTACGTGCTGTCTCACACAGCCTGTCTGACCTG 30 in the Sma I site of pGL2-P reporter vector (Promega). pcDNA 3-HNF-4 expression vector encoding HNF-4 was kindly provided by Dr Scott Friedman (Mount Sinai Hospital, New York, USA). pcDNA3-HIF-1a, and pcDNA3-HIF-1b encoding the human HIF-1a, and HIF1b transcription factors, respectively, were kindly provided by Dr L.E. Huang (Brigham and Women’s Hospital, Harvard Medical School, Boston, USA). The expression vectors pCMV5-Flag-Smad3, and pCMV5Smad4-HA, encoding human Smad members have been described.15,27

Care was taken to begin the experiment when cells reached a 50% confluence. HepG2 cells were incubated in the absence or in the presence of 10 ng/ml of TGF-b1 under normoxic or hypoxic conditions for 24 hours. Culture medium was collected and a commercial radioimmunoassay kit (Amersham Biosciences) was used to determine EPO according to standard procedures,41 using 125I-labeled recombinant human EPO. The EPO values thus obtained were referred to the number of viable cells (IU/cell).

Transfections Transfection of HeLa, Hep3B and Schneider-2 cells was carried out using Superfect (Qiagen) according to the manufacturer’s protocol. Cells in 24-well plates were transfected with the appropriate reporter and/or expression vectors at densities of 5 £ 104 cells/well. When the reporter vector was cotransfected with expression vectors, the amount of DNA in each transfection was normalized by using the corresponding empty expression vector. Relative luciferase units from duplicate samples were determined in a TD20/20 Luminometer (Promega, Madison, WI). Each transfection experiment was performed at least three times with different DNA preparations. Correction for transfection

GAL-4 one-hybrid system constructs

RT-PCR analysis Total RNA was isolated from Hep 3B cells, using the RNAeasy kit (Qiagen) and reverse transcribed by AMV (Roche Applied Science) reverse transcriptase. The resulting cDNA was used as template for PCR with EPO-specific oligonucleotide primers for exon 2 (50 AAT GTCCTGCCTGGCTGTGG 30 ) and exon 4 (50 CCAGACT TCTACGGCCTGCTG 30 ). Actin primers were used as controls.40 Electrophoretic mobility-shift assay (EMSA) These experiments were performed as described.42 The probes were radioactively labeled with [g-32]P ATP; HRE EPO was a double-stranded oligonucleotide encompassing the EPO HRE segment of the 30 enhancer: 50 CTACGTGCTGTCTCACACAGCCTGTCTGACCTG 30 , and EPO Sp1 probe was a double-stranded oligonucleotide spanning from 2 66 up to 2 42 of EPO upstream promoter: 50 AGCCTCTCCCCCACCCCCAGCCCGGCG 30 . GST-Smad3 and Smad4 fusion recombinant proteins or in vitro transcribed/translated (TNT kit, Promega) HIF-1a and b16 were used to bind the probes. Gel preparation, electrophoresis, competitions and antibody incubations with Sp1, Smad3, Smad4, and HIF-1a (Santa Cruz) were essentially made as described.40 Immunoprecipitation and Western blot analysis For immunoprecipitation experiments, Hep3B cells were treated with hypoxia and/or TGF-b; cells were collected, lysed and subjected to immunoprecipitation with anti-human HIF-1a (mAb OZ 12 þ 15, Lab Vision Corp.) or anti-Flag (Sigma) antibodies using protein G-Sepharose (Amersham Biosciences). Immunoprecipitates were

22

subjected to SDS-PAGE under reducing conditions, and proteins were electrophoretically transferred to nitrocellulose membranes (Millipore Corp., Bedford, USA). Filters were blocked with PBS containing 5% (w/v) nonfat dry milk for one hour. Specific immunodetection was carried out by incubation with anti-HNF-4 (Santa Cruz) followed by peroxidase-conjugated rabbit anti-mouse Ig at room temperature (Dako). Antigens were revealed using a chemiluminescence assay (Supersignal detection kit, Pierce). Experiments were repeated at least three times with similar results and representative experiments are shown in the Figures. Cyclation kinetics of EPO-enhancer and endoglin promoters Time-course experiments were performed with 500 ng of DNA and 50 – 100 ng of protein extracts. DNA fragments were the Xba I 500 bp from the Pwt Epo construct, and the PCR amplified 350 bp fragment from endoglin promoter construct pCD105 (250/þ350).28 Cyclation kinetics proceeded from 2 – 60 minutes, depending on the DNA, and 8 ml aliquots were withdrawn from the ligation mixture at different time-points, as described.41 The cyclation reaction was visualized on 2.5% Nu-Sieve agarose gels upon staining with ethidium bromide, and the ratio of circular versus linear DNA was quantified by densitometry. Depletion controls were made by immunoprecipitation of protein extracts with specific antibodies against Sp1, Smad3 and HIF-1 (Santa Cruz) or against C-rel as negative control (CalBiochem). Chromatin-immunoprecipitation assay Briefly, 2 £ 106 Hep3B cells were treated with or without 10 ng/ml of TGF-b1 under hypoxic or normoxic conditions for 24 hours. After collection, cells were crosslinked with 1% (v/v) formaldehyde for ten minutes at 34 8C, followed by cell lysis in lysis buffer (50 mM Hepes– KOH (pH 7.5), 140 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 0.1% (w/v) SDS, 1 mM PMSF and protein inhibitors) and sonication of the DNA into 200– 1000 bp fragments. Proteins cross-linked to DNA were immunoprecipitated with 10 mg of anti-Sp1, anti-HIF1a, or anti-Smad3/4 antibodies (Santa Cruz Biotechnology), respectively, and 40 ml of salmon sperm DNA/ BSA/protein A agarose beads. The protein A agarose/ antibody/protein complexes were washed extensively and eluted, as follows: four washes with lysis buffer plus 500 mM NaCl, four washes with IP wash solution (10 mM Tris – HCl (pH 8.0), 250 mM LiCl, 0.5% (v/v) NP-40, 0.5% (w/v) sodium deoxycholate, 1 mM EDTA), and two washes with TE (pH 8.0). Proteins were digested by proteinase K overnight at 34 8C, and the cross-link was reversed by heating at 65 8C for six hours. DNA was recovered by extraction with phenol/ chloroform, and precipitation in ethanol in the presence of 20 mg of glycogen carrier, and used as a template for PCR reactions. Genomic sequence primers encompassing the EPO promoter region 2 348 to þ 31 were: forward 50 CAGGCGTCCTGCCCCTGCT-30 and reverse 50 -CAGCC CGCGAGTACTCACCGTG-30 . Primers encompassing the EPO enhancer were: forward 50 -AATAGCATCACA AATTTCAC-30 and reverse 50 -CAGGCCCGGTAGGGTC GAGA-30 corresponding to the EPO gene positions 3075– 3506 (accession number AF202312). These primers were used to amplify by PCR the immunoprecipitated

Erythropoietin Gene Regulation by Hypoxia and TGF-b

DNA, after 40 cycles with annealing temperature of 50 8C, and one minute elongation at 72 8C.

Acknowledgements We thank Dr Carlos Zaragoza for advice with the cyclation experiments and helpful discussions, Dr Isabel Fabregat for reagents, and Carmen Langa for technical assistance. This work was supported by grants from Ministerio de Ciencia y Tecnologı´a (SAF2000-0132), Fondo de Investigacion Sanitaria (PI020200), and Comunidad Auto´noma de Madrid (CAM) to C.B.

References 1. Ebert, B. L. & Bunn, F. (1999). Regulation of the erythropoietin gene. Blood, 94, 1864– 1877. 2. Bunn, F. & Poyton, R. O. (1996). Oxygen sensing and molecular adaptation to hypoxia. Physiol. Rev. 76, 839– 885. 3. Zanjani, E. D., Poster, J., Burlington, H., Mann, L. & Wasserman, L. R. (1977). Liver as the primary site of erythropoietin formation in the fetus. J. Lab. Clin. Med. 89, 640– 644. 4. Jacobsen, L. O., Goldwasser, E., Fried, W. & Plzak, L. (1957). The role of the kidney in erythropoiesis. Nature, 179, 633 –634. 5. Stopka, T., Zivny, J. H., Stopkova, P., Prehal, J. F. & Prehal, J. T. (1998). Human hematopoietic progenitors express erythropoietin. Blood, 91, 3466– 3474. 6. Semenza, G. L., Nejfelt, M. K., Chi, S. M. & Antonarakis, S. E. (1991). Cell-type-specific and hypoxia inducible expression of the human erythropoietin gene in transgenic mice. Proc. Natl Acad. Sci. USA, 88, 5680– 5684. 7. Pugh, C. W., Tan, C. C., Jones, R. W. & Ratcliffe, P. J. (1991). Functional analysis of an oxygen-regulated transcriptional enhancer lying 30 to the mouse erythropoietin gene. Proc. Natl Acad. Sci. USA, 88, 10553– 10557. 8. Blanchard, K. L., Acquaviva, A. M., Galson, D. L. & Bunn, H. F. (1992). Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements. Mol. Cell. Biol. 12, 5343– 5385. 9. Semenza, G. L. & Wang, G. L. (1992). A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol. Cell. Biol. 12, 5447– 5454. 10. Galson, D. L., Tsuchiya, T., Tendler, D. S., Huang, L. E., Ren, Y., Ogura, T. & Bunn, H. F. (1995). The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1. Mol. Cell. Biol. 15, 2135– 2144. 11. Ebert, B. L. & Bunn, H. F. (1998). Regulation of transcription by hypoxia requires a multiprotein complex that includes hypoxia-inducible factor 1, an adjacent transcription factor, and p300/CREB binding protein. Mol. Cell. Biol. 18, 4089– 4096.

23

Erythropoietin Gene Regulation by Hypoxia and TGF-b

12. Kimura, H., Weisz, A., Ogura, T., Hitomi, Y., Kurashina, Y., Hashimoto, K. et al. (2001). Identification of hypoxia-inducible factor 1 ancillary sequence and its function in vascular endothelial growth factor gene induction by hypoxia and nitric oxide. J. Biol. Chem. 273, 2292–2298. 13. Bogan, A. A., Dallas-Yang, Q., Ruse, M. D., Jr, Maeda, Y., Jiang, G., Nepomuceno, L. et al. (2000). Analysis of protein dimerization and ligand binding of orphan receptor HNF4a. J. Mol. Biol. 302, 831– 851. 14. Gupta, M. & Goldwasser, E. (1996). The role of the near upstream sequence in hypoxia-induced expression of the erythropoietin gene. Nucl. Acids Res. 24, 4768– 4774. 15. Sanchez-Elsner, T., Botella, L. M., Velasco, B., Corbı´, A., Attisano, L. & Bernabeu, C. (2001). Synergistic cooperation between hypoxia and transforming growth factor-beta pathways on human vascular endothelial growth factor gene expresio´n. J. Biol. Chem. 276, 38527– 38535. 16. Sanchez-Elsner, T., Botella, L. M., Velasco, B., Langa, C. & Bernabe´u, C. (2002). Endoglin expression is regulated by transcriptional cooperation between the hypoxia and transforming growth factor-beta pathways. J. Biol. Chem. 277, 43499– 43808. 17. Pugh, C. W., Ebert, B. J., Ebrahim, O. & Ratcliffe, P. (1994). Characterisation of functional domains within the mouse erythropoietin 30 enhancer conveying oxygen-regulated responses in different cell lines. Biochim. Biophys. Acta, 1217, 297– 306. 18. Krystal, G., Lam, V., Dragowska, W., Takahashi, C., Appel, J., Gontier, A. et al. (1994). Transforming growth factor beta 1 is an inducer of erythroid differentiation. J. Expt. Med. 180, 851–860. 19. Faquin, W. C., Schneider, T. J. & Goldberg, M. A. (1992). Effect of inflammatory cytokines on hypoxiainduced erythropoietin production. Blood, 79, 1987–1994. 20. Ohta, M., Greenberger, J. S., Anklesaria, P., Bassols, A. & Massague, J. (1987). Two forms of transforming growth factor-beta distinguished by multipotential haematopoietic progenitor cells. Nature, 329, 539–541. 21. Zermati, Y., Fichelson, S., Valensi, F., Freyssinier, J. M., Rouyer-Fessard, P., Cramer, E. et al. (2000). Transforming growth factor inhibits erythropoiesis by blocking proliferation and accelerating differentiation of erythroid progenitors. Expt. Hematol. 28, 885–894. 22. Liu, B., Sun, Y., Jiang, F., Zhang, S., Wu, Y., Lan, Y. et al. (2003). Disruption of Smad5 gene leads to enhanced proliferation of high-proliferative potential precursors during embryonic hematopoiesis. Blood, 101, 124– 133. 23. Dickson, M. C., Martin, J. S., Cousins, F. M., Kulkarni, A. B., Karlsson, S. & Akhurst, R. J. (1995). Defective haematopoiesis and vasculogenesis in transforming growth factor-beta1 knock out mice. Development, 121, 1845–1854. 24. Weinstein, M., Monga, S. P. S., Liu, Y., Brodie, S. G., Tang, Y., Li, C., Mishra, L. & Deng, C. (2001). Smad proteins and hepatocyte growth factor control parallel regulatory pathways that converge on beta1-integrin to promote normal liver development. Mol. Cell. Biol. 21, 5122–5131. 25. Larsson, J., Goumans, M. J., Sjostrand, L. J., van Rooijen, M. A., Ward, D., Leveen, P. et al. (2001). Abnormal angiogenesis but intact hematopoietic

26.

27.

28.

29.

30. 31.

32.

33. 34.

35. 36.

37.

38.

39. 40.

potential in TGF-beta type I receptor-deficient mice. EMBO J. 20, 1663–1673. Tarumoto, T., Imagawa, S., Ohmine, K., Nagai, T., Higuchi, M., Suzuki, M. et al. (2000). N(G)-monomethyl-L -arginine inhibits erythropoietin gene expression by stimulating GATA-2. Blood, 96, 1716 –1722. Labbe´, E., Silvestri, P. A., Hoodless, J. L. & Attisano, L. (1998). Smad2 and Smad3 positively and negatively regulate TGF beta-dependent transcription through the forkhead DNA -binding protein FAST2. Mol. Cell. 2, 109– 12026. Botella, L. M., Sa´nchez-Elsner, T., Rı´us, C., Corbı´, A. & Bernabe´u, C. (2001). Identification of a critical Sp1 site within the endoglin promoter and its involvement in the transforming growth factor-beta stimulation. J. Biol. Chem. 276, 34486 –34494. Bunn, H. F., Gu, J., Huang, E., Park, J. W. & Zhu, H. (1998). Erythropoietin: a model system for studying oxygen-dependent gene regulation. J. Expt. Biol. 201, 1197– 1201. Attisano, L. & Wrana, J. L. (2000). Smads as transcriptional co-modulators. Curr. Opin. Cell Biol. 12, 235 –243. Shi, Y., Wang, Y. F., Jayaraman, L., Yang, H., Massague, J. & Pavlotich, N. P. (1998). Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-beta signaling. Cell, 94, 585 –594. Ema, M., Hirota, K., Mimura, J., Abe, H., Yodoi, B. J., Sogawa, K. et al. (1999). Molecular mechanisms of transcription activation by HLF and HIF1 alpha in response to hypoxia: their stabilization and redox signal-induced interaction with CBP/p300. EMBO J. 18, 1905– 1914. Kahn, J. D. & Crothers, D. M. (1992). Protein-induced bending and DNA cyclization. Proc. Natl Acad. Sci. USA, 89, 6343– 6347. Su, W., Jackson, S., Tjian, R. & Echols, H. (1991). DNA looping between sites for transcriptional activation: self-association of DNA -bound Sp1. Genes Dev. 5, 820– 826. Crothers, D. M., Drak, J., Kahn, J. D. & Levene, S. D. (1992). DNA bending, flexibility, and helical repeat by cyclization kinetics. Methods Enzymol. 212, 3– 29. Saura, M., Zaragoza, C., Bao, C., McMillan, A. & Lowenstein, C. J. (1999). Interaction of interferon regulatory factor-1 and nuclear factor kappa B during activation of inducible nitric oxide synthase transcription. J. Mol. Biol. 289, 459– 471. Zhang, H., Akman, H. O., Smith, E. L., Zhao, J., Murphy-Ullrich, J. E. & Batuman, O. A. (2003). Cellular response to hypoxia involves signaling via Smad proteins. Blood, 101, 2253– 2260. Akman, H. O., Zhang, H., Siddiqui, M. A., Solomon, W., Smith, E. L. & Batuman, O. A. (2001). Response to hypoxia involves transforming growth factorbeta2 and Smad proteins in human endothelial cells. Blood, 98, 3324– 3331. Lemon, B. & Tjian, R. (2000). Orchestrated response: a symphony of transcription factors for gene control. Genes Dev. 14, 2551– 2569. Botella, L. M., Sa´nchez-Elsner, T., Sanz-Rodrı´guez, F., Kojima, S., Shimada, J., Guerrero-Esteo, M. et al. (2002). Transcriptional activation of endoglin and transforming growth factor-beta signaling components by cooperative interaction between Sp1 and KLF6: their potential role in the response to vascular injury. Blood, 100, 4001–4010.

24

41. Schapira, L., Antin, J. H., Ransil, B. J., Antman, K. H., Eder, J. P., McGargle, C. J. & Goldberg, M. A. (1990). Serum erythropoietin levels in patients receiving intensive chemotherapy and radiotherapy. Blood, 76, 2354– 2359.

Erythropoietin Gene Regulation by Hypoxia and TGF-b

42. Rı´us, C., Smith, J. D., Almendro, N., Botella, L. M., Langa, C., Vary, C. P. H. & Bernabe´u, C. (1998). Cloning of the promoter region of human endoglin, the target gene for hereditary hemorrhagic telangiectasia type 1. Blood, 92, 4677– 4690.

Edited by M. Yaniv (Received 17 November 2003; accepted 9 December 2003)