A dominant negative mutation in the GIM1 gene of Leishmania donovani is responsible for defects in glycosomal protein localization

Molecular and Biochemical Parasitology 99 (1999) 117 – 128

A dominant negative mutation in the GIM1 gene of Leishmania dono6ani is responsible for defects in glycosomal protein localization John A. Flaspohler a,b, Kayde Lemley a, Marilyn Parsons a,b,* a b

Seattle Biomedical Research Institute, 4 Nickerson St., Seattle, WA 98109, USA Department of Pathobiology, Uni6ersity of Washington, Seattle, WA 98195, USA Received 4 November 1998; accepted 21 December 1998

Abstract Kinetoplastid protozoa contain a unique microbody organelle called the glycosome. Several important metabolic pathways are compartmentalized within the glycosome that are found in the cytoplasm of higher eukaryotes. We have previously reported the identification of a Leishmania dono6ani cell line called gim1 -1, in which several normally glycosomal proteins are partially mislocalized to the cytoplasm. The GIM1 gene complements the defect and restores import of proteins to the glycosome. Here we demonstrate that GIM1 encodes an integral membrane protein of the glycosome. We also report that the mutant gim1 -1 allele behaves as a dominant negative mutation. Introducing the gim1 -1 allele extrachromasomally led to mislocalization of a glycosomal reporter protein even in wild-type cells. Gene disruption experiments in heterozygous GIM1 /gim1 -1 cells showed that when the mutant gim1 -1 allele was lost, cells re-established normal glycosomal protein localization. Interestingly, no disruptions of the wild-type allele were obtained. These data indicate that a dominant negative mutation in the GIM1 gene is the sole genetic lesion responsible for the glycosomal defects in gim1 -1, and suggest that GIM1 is an essential gene in Leishmania. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Leishmania; Glycosome; Peroxin; Peroxisomes

1. Introduction

* Corresponding author. Tel.: +1-206-2848846; fax: +1206-2840313; e-mail: [email protected].

Members of the kinetoplastid protozoa, including the trypanosomatid pathogens responsible for leishmaniasis (Leishmania spp.) as well as sleeping sickness (African trypanosomes) and Chagas’ dis-

0166-6851/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 6 8 5 1 ( 9 9 ) 0 0 0 0 5 - 5

118

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

ease (American trypanosomes) contain a unique organelle termed the glycosome [1]. Glycosomes are microbody organelles. The microbody family of organelles also includes the peroxisomes of higher eukaryotes as well as the glyoxysomes of plants. The glycosome is the site of numerous important metabolic pathways [2 – 6]. Several of these glycosomal pathways, including the first six steps of glycolysis, purine salvage and pyrimidine biosynthesis, are not compartmentalized in other organisms and are instead present in the cytoplasm. Other pathways, such as ether-lipid biosynthesis and b-oxidation of fatty acids, are found in both glycosomes and peroxisomes [3,6 – 9]. The localization of key metabolic pathways to a unique kinetoplastid organelle has spurred investigation of the glycosome as a potential target for anti-parasite drug development. In the past, the characterization of glycosomes as members of the microbody family of organelles was based on similar morphological features and commonality in at least a subset of protein signal sequences which target matrix proteins to all microbody organelles [10 – 12]. More recently, two genes functioning in glycosomal protein localization and biogenesis have been identified and both show significant homologies to genes involved in peroxisome biogenesis [13,14]. One of these genes is GIM1, which was identified through rescue experiments using a Leishmania mutant (gim1 -1 ) that exhibits defects in protein localization to glycosomes [14]. GIM1 is homologous to the peroxin 2 (PEX2 ) family of genes, which encode peroxisomal integral membrane proteins required for normal peroxisome biogenesis [15 – 18]. PEX2p family proteins are characterized by a C3HC4 cysteine-ring motif near the carboxy terminus [19]. Although initially postulated to be involved in protein-DNA interactions, the cysteine-ring is now considered likely to function via protein-protein interactions. The function of PEX2p in peroxisome biogenesis is unknown, though mutations in the PEX2 gene in the yeast Yarrowia lipolytica not only cause peroxisome biogenesis defects but also affect protein secretion and retard the exit of some proteins from the endoplasmic reticulum [20]. Mutations in the PEX2 homologue of the filamentous fungus

Podospora anserina disrupt sexual development (karyogamy) as well as peroxisome biogenesis [17]. These pleiotropic effects of genes initially identified as peroxisome biogenesis genes hint at the interrelationships between microbody organelle biogenesis and other basic cellular processes. The phenotype of the L. dono6ani gim1 -1 mutant is characterized by the partial mislocalization of several glycosomally-targeted proteins to the cytoplasm [14]. However, the gim1 -1 cell line contains normal numbers of glycosomes. The genetic lesion in gim1 -1 appears to be a single point mutation at nt 715 that converts a glutamine residue to a premature stop codon in one of the two GIM1 alleles (i.e. the genotype is GIM1 / gim1 -1 ). Two possible mechanisms could explain the gim1 -1 protein mislocalization phenotype. The mutation could cause a haplo-insufficiency effect, whereby the one remaining wild-type GIM1 gene cannot compensate for the loss of a functional allele. Alternatively, the gim1 -1 mutation may represent a dominant negative, and expression from the mutant allele is responsible for the mutant phenotype. We have now further characterized Gim1p as well as the mutation in the gim1 -1 cell line and its role in causing defects in protein import into the glycosome. Evidence presented here demonstrates that Gim1p is localized to the glycosome membrane. We also demonstrate that the gim1 -1 allele behaves as a dominant negative and is responsible for the glycosomal defects observed in the gim1 -1 cell line. The identification of dominant negative mutants may provide additional opportunities to examine glycosome biogenesis and gene function in trypanosomatids.

2. Methods

2.1. Tissue culture and transfection Promastigotes of L. dono6ani 51.1 [21], and derivatives thereof, were used in all experiments and were maintained in medium M199 (Gibco) supplemented with 5% fetal calf serum (FCS, Atlanta Biochemicals). Aside from the cells used

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

in Fig. 1, and as controls in Figs. 2 and 6 (marked by an asterisk), all cell lines contained pXBLELUC. This plasmid encodes a fusion protein consisting of the bleomycin resistance protein fused to luciferase which contains an -SKL glycosomal/ peroxisomal targeting signal [14]. The gim1 -1 mutant was previously described [14]. Transfections used log phase parasites (4 ×107) and a Gene Pulser (Bio-Rad), using 2 – 4 mg of restriction enzyme digested DNA for gene disruptions and 10 – 40 mg of circular plasmid for stable episomal transfections [22]. Transfectants were grown as colonies on agarose/M199 plates under selection as previously described [14]. Puromycin (Calbiochem) was used at 45 mM in both liquid and agarose plate cultures. Hygromycin-bearing episomes were amplified by weekly doublings of the hygromycin concentration from the normal maintenance concentration of 20 mg ml − 1 to a final concentration of 320 mg ml − 1 after 4 weeks.

2.2. Subcellular localization Differential digitonin solubilization was performed as described [10]. Carbonate extractions of the digitonin pellets were performed using 100 mM sodium carbonate, pH 11.5 [23]. For myc immunoblot analysis, 1×108 cell equivalents were loaded per lane, and were subjected to SDSPAGE and immunoblot analysis using monoclonal anti-myc 9E10 [24] and 125I-goat anti-mouse IgG (New England Nuclear). As a control for glycosomal matrix protein localization, 1× 107 cell equivalents per lane were examined with rabbit anti-L. dono6ani hypoxanthine-guanine phosphoribosyl transferase [25] (anti-HGPRT, a gift of Dr Buddy Ullman, Oregon Health Sciences University), and 125I-goat anti-rabbit IgG. Luciferase activity in pellet and supernatant fractions following digitonin solubilization was measured on a Monolight 2010 luminometer (Analytical Luminescence Laboratory). For microscopic analysis, cells expressing a fusion protein of green fluorescence protein (GFP) with Gim1p, or luciferase (see below) were methanol-fixed and stained with antibodies to HGPRT. Alternatively, they were stained with

119

antisera raised against purified L. mexicana glycosomal glyceraldehyde phosphate dehydrogenase (a gift of Dr Paul Michels, International Institute of Cell and Molecular Pathology) [26]. The antibodies were revealed using Texas-red conjugated goat anti-rabbit IgG (Southern Biotechnology). The cells were viewed on a Nikon Microphot microscope equipped with a SenSys CCD camera (Photometrics) using a fluorescein filter (520–560 nm) for GFP, a Texas Red filter (600–660 nm) for immunostaining, and a DAPI filter (435–485 nm) for DNA staining. The digital images were collected and analyzed using Metamorph software.

2.3. Plasmid constructs This manuscript follows the yeast nomenclature in which gene replacements are indicated as follows: target gene::disrupting marker. The plasmid pDgim1::PAC was used in all GIM1 gene knockout experiments. It was constructed by subcloning the 5.6 kb ApaI-BglII fragment containing the GIM1 gene plus 2.7 kb of 5% flanking sequence and 1.7 kb of 3% flanking sequence into the pBluescript vector (Stratagene). The GIM1 coding sequence was excised by digestion with XhoI and NdeI and replaced with the 2.5 kb puromycin acetyl transferase gene (PAC) cassette. The PAC cassette was amplified from the plasmid pX63PAC [27] (gift of Dr Stephen Beverley) and consists of the 0.6 kb PAC gene surrounded by L. dono6ani DHFR 5% and 3% flanking sequences (0.5 kb 5% and 1.4 kb 3%). The resulting plasmid pDgim1::PAC was digested with NcoI, releasing the PAC cassette flanked by 1.7 kb of 5% and 1.8 kb of 3% GIM1 flanking sequence. The pBSGIM1 plasmid was previously described [14] and contains the GIM1 coding region as well as 135 bp of 5% flanking sequence and 251 bp of 3% flanking sequence in the SmaI site of pBluescript. The pBSgim1 -1 plasmid is identical except that it contains the gim1 -1 mutation at nt 714 relative to the start codon. The pX63gim1 -1 plasmid was constructed by re-amplifying the gim1 -1 coding sequence from pBSgim1 -1 using the original primers [GIM1-S, 5%-TTATCCGCGTCTGCTGTC and GIM1-AS, 5%-CACACGTATTCCGAGCC). The PCR product was

120

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

ligated into the pX63HYG expression vector [28] that had been digested with SmaI. The pXMyc2 plasmid was constructed by amplifying duplicate copies of the myc epitope coding sequence [24] from the plasmid pTbMyc2 [29]. The 5% primer, BgH3Myc2 (GAAGATCTAAGCTTATGCAGCTTGAACAGAAACTG), contains both a BglII and a HindIII site (restrictions sites in primers are italicized) as well as a start codon (underlined). The 3% primer BamMyc2 (CGGGATCCGCAGCAGGTCTTCTTCAGAG) contains a BamHI site. The Myc2 PCR product was cleaved with BglII and BamHI and inserted into the BamHI site of the Leishmania expression plasmid pX [30], thereby leaving a single BamHI site 3% to the tag sequence. This plasmid allows cloning of test sequences using the HindIII site for a tag at the C terminus or using the BamHI site and/or the XbaI site 12 nt downstream for a tag at the N-terminus. To generate pXMyc2-GIM1, the GIM1 coding region was amplified from the plasmid pBSGIM1 using primers 5%BamGIM1-104S (CGGGATCCTCATGGCGTGGCTCGGAGAC) and 3 %XbaGIM1 -1076AS (GCTCTAGATTACGCAGGGGCGCAGCTGTG). The numbers in the primer names corresponds to the nucleotide position in the GIM1 sequence with GenBank accession number U80074. The product and pXmyc2 were digested with BamHI and XbaI and then ligated together. The resulting plasmid encodes Gim1p with two myc tags at the N-terminus. To generate plasmids encoding GFP fusions, we utilized pXGGFP+2% [31] (gift of Dr Stephen Beverley, Washington University), in which the GFP coding region contains a S65T mutation and utilizes GC-rich synonymous codons [32]. The coding regions were amplified using primers containing BamHI (5%) and NotI (3%) recognition sites, digested with those enzymes and cloned into pXGGFP+2%. All fusions contain GFP at the N-terminus and the test sequence at the C-terminus. pGFP-GIM1 and pGFP-gim1 -1 contain the GIM1 and gim1 -1 coding regions respectively, [amplified from pBSGIM1 and pBSgim1 -1 using primers 5%BamGIM1-104S and 3%NotGIM11076AS (TAGCGGCCGCTTACGCAGGGGCGCAGCTGTG)]. pGFP-LUC contains the

luciferase coding region appended to GFP. All gene fusion constructs were sequenced to verify maintenance of the reading frame between the two protein coding sequences.

2.4. Sequence analysis of the GIM1 locus in GIM1::PAC lines Genomic DNA was purified by standard techniques [33] from wild-type cells, the gim1 -1 mutant cell line, and gim1 -1 cells stably transfected with pDGIM1::PAC. A segment of the GIM1 gene was amplified using Taq DNA polymerase and primers GIM1-461S (GCCCTGCAGAACACAAAG) and GIM1-1049AS (GCCGCACTTTATACAACG). The amplified sequence starts 357 bp downstream of the AUG initiation codon and contains the site of the gim1 -1 mutation. Amplified products from entire PCRs for wildtype cells, gim1 -1 cells and each of 20 clonal lines derived from the gim1 -1 pDGIM1::PAC transfections were directly sequenced across both strands. Sequencing was done using an ABI automated sequencer using ABI dye terminator cycle sequencing (Applied Biosystems, Foster City, CA). Sequence traces were used to determine the GIM1 allele(s) present in each DNA sample.

2.5. Southern analysis Genomic DNA was digested with BglII and NsiI. The DNA fragments were separated on a 0.85% agarose gel, blotted to Nytran (Schleicher and Schuell), and hybridized. The GIM1 riboprobe was generated from pBSGIM1. The 5% GIM1 flanking region probe was generated from the 2.8 kb XhoI fragment upstream of GIM1 (see Fig. 2). The PAC riboprobe was generated from pBSPAC, which is pBluescript with the PAC coding region subcloned from the pX63PAC plasmid.

3. Results

3.1. Subcellular localization of Gim1p The GIM1 gene is homologous to the PEX2 gene family, all of which encode peroxisomal inte-

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

gral membrane proteins[15 – 18]. For subcellular localization studies, we expressed Gim1p and the mutant gim1-1p as GFP fusion proteins in Leishmania. The top row of Fig. 1A shows the same cell examined for the pattern of green fluorescence of GFP-Gim1p, stained with antibody to the glycosomal marker protein HGPRT [25] to highlight the glycosomes, and stained with the DNA dye DAPI to reveal the nucleus

Fig. 1.

121

and kinetoplast. The colocalization of GFPGim1p and HGPRT demonstrates that Gim1p is indeed localized to glycosomes. This was further verified by costaining for a second glycosomal marker glyceraldehyde phosphate dehydrogenase (data not shown)[26]. The same pattern of punctate fluorescence was also observed in cells expressing a fusion of GFP to the mutant gim1-1p (Fig. 1A, bottom row) and in cells expressing GFP fused to glycosomally targeted luciferase. GFP expressed in Leishmania as a non-fusion protein showed a strong staining throughout the cell body, indicating a cytoplasmic localization (Fig. 1A, bottom row) and no green fluorescence was observed in untransfected cells (not shown). These studies were confirmed and extended by subcellular fractionation of promastigotes expressing myc-tagged Gim1p. Digitonin solubilization of the plasma membrane followed by centrifugation resulted in a glycosome-enriched organellar pellet which contained nearly all of the myc-Gim1p (solid arrow). When the organellar pellet was further fractionated by sodium carbonate extraction at pH 11.5, mycGim1p remained in the pellet, indicating that it is an integral membrane protein.

Fig. 1. Subcellular localization of Gim1p and gim1-1p. (A) Fluorescence microscopy. Top row: green fluorescence of cell expressing GFP-Gim1p fusion protein, co-staining of the same cell with antibody to the glycosomal protein HGPRT, and with DAPI to reveal the nuclear and kinetoplast DNA. Bottom row: green fluorescence of wild-type cells expressing GFPgim1-1p, GFP-luciferase fusion protein (GFP-Luc), and untargeted GFP. Scale bar = 1 mm. (B) Subcellular fractionation and immunoblot analysis. Untransfected wild-type cells (WT) and cells expressing myc-Gim1p (myc-GIM1 ) were subjected to digitonin solubilization and the organellar fraction was pelleted by centrifugation (left). Integral membrane proteins were isolated by carbonate extraction at pH 11.5 (right). Samples were analyzed by immunoblotting with monoclonal anti-myc 9E10. The largely cytosolic protein at 55 kDa represents a cross-reactive protein. The solid arrow marks the myc-tagged Gim1p. As a control, the samples were also analyzed with antibodies directed against the glycosomal matrix protein HGPRT [25], which was found in the digitonin pellet and carbonate supernatant, as expected (open arrows, lower panels). Molecular weight markers are shown to right.

122

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

3.2. Gene disruption in the GIM1 /gim1 -1 heterozygote The mechanism by which the GIM1 /gim1 -1 genotype results in defective glycosomal compartmentalization was explored through gene disruption experiments. We reasoned that the

Fig. 3. Determination of GIM1 allele status in gim1 -1 single knockout cell lines. Shown is a portion of the sequence trace profile of PCR fragments generated from genomic DNA. The traces are from sequencing entire PCR reactions from wild-type cells (A) or the gim1 -1 cell line (B). The T peaks are shown with dashed lines and all other peaks are solid lines. The coincident C and T peaks (arrow) in gim1 -1 sequence represent the sequence of the wild-type and mutant alleles, respectively.

Fig. 2. Single knockout at GIM1 locus in the gim1 -1 cell line. (A) Maps of the wild-type GIM1 locus, the disrupted GIM1 locus, and the knockout construct. The knockout construct is the 6.2 kb fragment resulting from NcoI digestion of pDgim1::PAC. The thick lines indicate the regions of identity in the GIM1 locus and in the knockout construct. Boxes represent the GIM1 and PAC coding regions. The stippled boxes represent 5% and 3% DHFR flanking sequence. Restriction sites are A, ApaI; B, BglII; N, NcoI; Nd, NdeI; X, XhoI. (B) Southern analysis of gim1 -1 cells with a single knockout at the GIM1 locus. Genomic DNA was isolated from the following clones: wild-type (WT*), gim1 -1, or gim1 -1 transfected with the knockout construct (KO1, KO2). All clones except WT* also contain pXBLE-LUC. The DNA was digested with BglII and separated on 0.85% agarose gels, transferred to a filter and hybridized with a riboprobe specific for the 5% GIM1 flanking region (left) or the PAC marker gene (right). The solid arrowhead marks the wild-type GIM1 fragment; the open arrowhead marks the novel 5.2 kb BglII fragment generated upon correct integration of the knockout construct. DNA size markers are shown between panels.

alternatives of haplo-insufficiency and dominant negative effects could be discriminated by this approach. Unless otherwise stated, the wild-type and gim1 -1 mutant cell lines used in all of the studies described below contain a plasmid expressing a fusion of the bleomycin resistance protein and luciferase. Because luciferase contains a glycosomal (peroxisomal) targeting signal [10], luciferase assays were used to reveal the extent of protein mislocalization. A map of the plasmid insert used to disrupt GIM1 alleles by homologous recombination is shown in Fig. 2A. The plasmid contains a puromycin acetyl transferase (PAC) gene inserted between 5% and 3% GIM1 flanking sequences, and this cassette was released by digestion with NcoI prior to transfection. Restriction maps of the wild-type GIM1 and the expected GIM1::PAC

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

loci, as well as the location of the probes used to analyze the transfectants, are also shown in Fig. 2A. Following transfection of the cassette into the gim1 -1 mutant cell line, puromycin resistant clones were isolated and characterized. A novel 5.2 kb BglII genomic DNA fragment (Fig. 2A) corresponding to the GIM 5% flanking region is diagnostic of replacement at the GIM1 locus. As expected, Southern analysis revealed that most puromycin resistant clones (19 of 20) contained the 5.2 kb fragment diagnostic of the correct integration (Fig. 2B). One of these 19 clones contained two copies of the coding sequence plus the integration, as determined by estimation of the relative copy number using phosphorimaging and by DNA sequencing (described below). One clone lacked the diagnostic fragment and contained the PAC cassette on an episome (data not shown). We next screened DNA from the puromycin resistant clones to determine which GIM1 allele had been retained. The presence or absence of both the wild-type and mutant alleles was assayed by sequencing PCR products spanning the mutation site. Fig. 3 shows the sequence profile ob-

123

Table 1 Genotypes of pDGIM1::PAC transfectants Allele(s) found

Fast growinga

Slow growing

GIM1 GIM1 and gim1 -1 gim1 -1

16 0 0

2 2 0

a Fast growing clones arose in 14–16 days, slow growing clones arose in 21–25 days.

tained from the wild-type (Fig. 3A) and the gim1 -1 (Fig. 3B) cell lines. The cytosine (C) and thymidine (T) at nt 715 (marked by arrow) correspond to the GIM1 and gim1 -1 alleles, respectively. The results of the sequence analysis are presented in Table 1. In the 18 puromycin resistant clones determined to be hemizygous by Southern analysis, the sequence profile was identical to that shown in Fig. 3(A), indicating that the mutant gim1 -1 allele had been lost, yielding a GIM1 /gim1 -1::PAC genotype. In the clone with two copies of the locus plus the PAC cassette integration, and in the clone containing the episomal PAC cassette, both the wild-type and mutant alleles were present. In no case was the remaining wild-type GIM1 gene in the gim1 -1 cell line lost. Interestingly, on agarose plates, the two clones that retained the gim1 -1 allele arose about one week later than most single knockout lines, a growth rate which was similar to the original gim1 -1 mutant.

3.3. Disruption of the gim1 -1 allele restores functional glycosomal targeting

Fig. 4. Disruption of the gim1 -1 allele restores glycosomal localization of luciferase. Cells from the indicated cell lines were fractionated into organellar pellet and cytosolic supernatant fractions following differential digitonin solubilization of the plasma membrane. The percentage of luciferase activity present in the cytosolic fraction is shown. The 18 GIM1 /gim1 1::PAC clones showed indistinguishable localization phenotypes; a representative clone is indicated as gim1 -1 KO. The alleles at the GIM1 locus are indicated as: +, GIM1 allele; mut, gim1 -1 allele; — , PAC replacement.

In order to distinguish between a gene dosage effect and a dominant negative mutation in the gim1 -1 cell line, we measured the efficiency of luciferase compartmentalization to the glycosome in gim1 -1 cells in which the mutant allele had been replaced. Luciferase compartmentalization in cells hemizygous at the GIM1 locus was measured (Fig. 4). All 18 gim1 -1 single knockout lines (GIM1 /gim1 -1::PAC) had re-established normal glycosomal targeting of the luciferase reporter (Fig. 4 shows a representative example, labeled gim1 -1 KO). Puromycin-resistant clones that had not lost the gim1 -1 allele still possessed the mislo-

124

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

Fig. 5. Exogenous expression of gim1 -1 allele in various cell lines causes mislocalization of luciferase. The pX63gim1 -1 expression plasmid was transfected into the single knockout lines GIM1 /gim1 -1::PAC (panel A, gim1 -1 KO) and GIM1 /GIM1::PAC (panel B, WT KO), and into wild-type cells (panel C, WT). Stable transfectants were isolated by hygromycin selection. Clonal transfectants were assayed for luciferase compartmentalization as cells were grown for the indicated number of days under stepwise increases in hygromycin concentration as described in Materials and Methods. Cell fractionation and luciferase quantitation were as described in Fig. 3. For each recipient line, representative clones are shown which demonstrated glycosomal mislocalization defects ( , “) as well as clones which did not demonstrate defects under any hygromycin concentration (, ×).

calization phenotype (data not shown). Finally, wild-type cells disrupted for a single GIM1 allele (GIM1 /GIM1::PAC, verified as in Fig. 2(B)) showed efficient glycosomal localization of the reporter (WT KO, Fig. 4). Thus, the mislocalization phenotype is not due to a gene dosage effect. Since loss of the gim1 -1 allele restores glycosomal targeting, the evidence is consistent with a dominant negative mutation being responsible for the gim1 -1 mutant phenotype.

3.4. Expression of gim1 -1 results in a glycosomal defect To further investigate the putative dominant negative nature of the gim1 -1 mutation, we tested the effect of establishing gim1 -1 expression in several cell lines. As recipients, we used the gim1 1 line in which the gim1 -1 allele had been disrupted, wild-type cells, and wild-type cells with a single GIM1 allele. All recipient cell lines expressed episomally-encoded luciferase targeted to the glycosome. The mutant allele was cloned into the pX63HYG Leishmania expression plasmid to yield pX63gim1 -1. Following electroporation of the circular plasmid, transfectants were selected by virtue of the hygromycin resistance gene car-

ried on the plasmid. Transfectants from each cell line were isolated and tested for luciferase compartmentalization. As shown in Fig. 5, approximately half of the transfectants from each cell line examined demonstrated increased mislocalization of luciferase. As compared to wild-type cells in which glycosomal targeting is quite efficient, approximately two- to three-fold more luciferase was found in the cytosol in these cells. This level of mislocalization is similar to that found in the original gim1 -1 mutant. We next sought an explanation as to why only a subset of pX63gim1 -1 transfectants displayed glycosomal protein localization defects. DNA rearrangements are known to occur relatively frequently in Leishmania [34–37] and therefore we assessed the structural integrity of the gim1 -1 mutant gene in the pX63gim1 -1 transfectants. Cleavage of the plasmid-borne copy of gim1 -1 with NsiI and BglII should yield a 1.6 kb fragment, while cleavage of the genomic GIM1 locus should yield a 2.8 kb fragment. As shown in Fig. 6, pX63gim1 -1 transfectants that demonstrated increased mislocalization possessed an intact plasmid-borne copy of gim1 -1. All transfectants that failed to demonstrate increased mislocalization lacked the plasmid-borne gim1 -1 gene. In total,

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

Fig. 6. Dominant negative phenotype correlates with intact plasmid-borne gim1 -1 gene: Southern analysis. Genomic DNA was isolated from the cell lines shown in Fig. 5, which had been transfected with pX63gim1 -1. Each cell line is marked as to its glycosomal localization phenotype: +, transfectants that demonstrated increased glycosomal mislocalization; —, transfectants that did not demonstrate increased glycosomal mislocalization. The lane marked pX63gim1 -1 contains the restricted plasmid alone. DNA was digested with NsiI and BglII, separated on a 0.85% agarose gel, transferred to a filter and hybridized with a riboprobe specific for the GIM1 coding region. Closed arrowhead, the 1.6 kb NsiI-BglII fragment expected on digestion of pX63gim1 -1 ; open arrowhead, the 2.8 kb NsiI fragment bearing the endogenous GIM1 gene. The bracket marks the pXBLE-LUC plasmid (higher) and pX63gim1 -1 vector backbone (lower) which both cross-hybridize with polylinker sequences present in the GIM1 riboprobe. pXBLE-LUC is present in all cell lines except wild-type control (WT*). DNA size markers are shown at the right.

only about half of the clones arising from transfection of the pX63gim1 -1 plasmid appeared to possess an intact copy of the plasmid-borne gim1 1 gene. These clones demonstrated defects in localization of the luciferase reporter similar to those seen in the gim1 -1 mutant cell line. The finding that many clones no longer possess an intact plasmid-borne copy of gim1 -1 is perhaps not surprising. All cell lines utilized for the transfections already harbored a multi-copy plasmid (pXBLE-LUC) with vector sequences largely homologous to the pX63gim1 -1 backbone. Recombination events between pX63gim1 -1 and the plasmid pXBLE-LUC (and/or the Leishmania genome) may be responsible for loss of the gim1 -1 gene from the episome.

125

We also noted that transfectants with an intact gim1 -1 episome tended to grow more slowly as colonies than transfectants which had lost the intact gim1 -1 gene (data not shown). The expression of a dominant negative mutation such as gim1 -1 may lower the recovery of viable transfectant colonies and favor recovery of faster-growing clones not expressing the mutant gene. It has been reported that increasing the selective pressure on Leishmania stable transfectants can result in an increase in plasmid copy number and a concomitant increase in plasmid-encoded gene expression [22]. Stepwise increases in hygromycin concentration brought about increased mislocalization of the luciferase reporter in cell lines possessing an intact plasmid-borne gim1 -1 gene (Fig. 5). Transfectants that lacked the plasmid-borne gim1 -1 gene readily became resistant to high levels of hygromycin selection but did not demonstrate increased mislocalization.

4. Discussion We report here the genetic characterization of a mutation that confers stable defects in glycosomal protein localization in Leishmania. We have previously described the L. dono6ani mutant gim1 -1, which mislocalizes a subset of glycosomallytargeted matrix enzymes, and demonstrated that this clone carries a nonsense mutation in one GIM1 allele[14]. We show here the mutant allele acts as a dominant negative. Targeted knockout of the mutant allele restored efficient protein targeting to glycosomes. Establishment of exogenous mutant gim1 -1 allele expression in L. dono6ani caused localization defects even in wild-type cells possessing two wild-type GIM1 alleles. The mutation in the gim1 -1 allele therefore appears to be solely responsible for the glycosome biogenesis defects in the gim1 -1 cell line. We hypothesize that our ability to complement the gim1 -1 cell line by cosmid rescue (which allowed us to isolate the GIM1 gene) resulted from an increase in the ratio of the wild-type to mutant proteins due to the multicopy GIM1 cosmid. We are aware of one other report of dominant negative alleles that disrupt microbody biogenesis.

126

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

Interestingly, that report demonstrated that the PER5 D and PER7 D alleles of the yeast Hansenula polymorpha yield peroxisome negative cells in haploid organisms, and cells with abnormal peroxisomes in diploids [38]. The exact nature of the defects in these genes has not been described. Defects in PEX2 are responsible for a subset of cases of the fatal genetic disease Zellweger’s syndrome [39,40]. While the disease shows an autosomal recessive etiology, our data, as well as the data cited above, suggests that a fraction of heterozygotes might show subtle defects in peroxisome protein localization. The dominant negative nature of the gim1 -1 mutation presents intriguing possibilities for further elucidation of the mechanics of glycosome import and assembly. Mutant gim1-1p presumably interacts with either Gim1p or with other protein(s) in an aberrant fashion. Identification of other proteins that interact with Gim1p would greatly aid in determining Gim1p function. Moreover, other proteins known to interact with Gim1p would likely be part of a pathway required for normal glycosome biogenesis. By applying genetic approaches such as the two-hybrid system, we hope to increase the known number of genes required for glycosome biogenesis. Although the exact function of Pex2p is not known, its location within the peroxisomal membrane and cysteine-ring motif have led to speculation that Pex2p is involved in protein translocation through the peroxisomal membrane [15] or in the assembly of the peroxisomal membrane [18]. Deletion of the C-terminal 102 amino acids of Pex2p [41] and truncation of Gim1p five residues farther upstream lead to microbody abnormalities in CHO cells and Leishmania, respectively. On the other hand, a mutant Pex2p lacking the last 92 residues (and thus the cysteine ring) was functional [18]. Interestingly, the first two mutations remove a conserved, predicted ahelical transmembrane domain, while the last does not. Although the mutation in the gim1 -1 allele removes this putative membrane-spanning domain, we found that the mutant protein was still glycosomal. Since the protein possesses additional predicted transmembrane domains, these

may allow for anchoring of the nonfunctional gim1-1p. Interestingly, a point mutation within the cysteine ring [42] was found to be the cause of a peroxisome defect in CHO cells, pointing to another mode of dysfunction. The possibility that GIM1 is in fact an essential gene in L. dono6ani is also suggested by our gene knockout studies. All stable transfectants in these experiments retained the wild-type GIM1 allele and nearly all replaced the mutant gim1 -1 allele. In both wild-type or gim1 -1 single knockouts, the one remaining wild-type GIM1 allele has proven difficult to disrupt (unpublished results). Clearly, the loss of the remaining wildtype GIM1 gene is not readily tolerated in L. dono6ani, raising the possibility that null mutants at this locus may not be viable. Given the importance of the metabolic pathways contained within the glycosome, it seems likely that this organelle is essential for trypanosomatids. This concept is supported by studies of the recently identified functional homologue of yeast PEX11 in Trypanosoma brucei [13]. TbPEX11 encodes a glycosomal membrane protein and appears to be an essential gene, as double gene disruptants were not recoverable. Regulation of the level of Pex11p expression in trypanosomes also resulted in changes in glycosome morphology and affected cell division. While peroxisomes are not essential in yeasts for vegetative growth on glucose [38,43], genes involved in peroxisome biogenesis appear to have more complex roles than initially envisaged. Recent data indicates that disruption of the GIM1 homologue in Yarrowia lipolytica, PEX2, not only blocks peroxisome biogenesis, but also the secretion of proteins specific for the mycelial form [20]. Although protein secretion has not been studied in the gim1 -1 line, we did note that the abundance of lipid bodies was dramatically reduced [14]. The ability of Leishmania to survive without glycosomal compartmentalization per se may be difficult to answer given the possible pleiotropic effects of genes involved in microbody biogenesis. The absence of a tightly regulated inducible expression system in Leishmania also makes the definitive identification of essential genes quite challenging.

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128

Acknowledgements The technical assistance of Jeffrey Stevens is gratefully acknowledged. The authors thank Tom Westlake and Ellen Sisk of the SBRI DNA core facility for DNA sequencing. This work was supported in part by an NIH NRSA award F32 AI09318 to J.F., grants NIH AI22635 and NIH S10 RR11865, and by the Murdock Charitable Trust.

References [1] Opperdoes FR, Michels PAM. The glycosomes of the Kinetoplastida. Biochimie 1993;75:231–4. [2] Clayton CE, Michels P. Metabolic compartmentation in African trypanosomes. Parasitol Today 1996;12:465–71. [3] Heise N, Opperdoes FR. The dihydroxyacetonephosphate pathway for biosynthesis of ether lipids in Leishmania mexicana promastigotes. Mol Biochem Parasitol 1997;89:61 – 72. [4] Allen TE, Ullman B. Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Trypanosoma brucei. Nucleic Acids Res 1993;21:5431 – 8. [5] Hammond DJ, Gutteridge WE, Opperdoes FR. A novel location for two enzymes of de novo pyrimidine biosynthesis in trypanosomes and Leishmania. FEBS Lett 1981;128:27 – 9. [6] Wiemer EAC, Ijlst L, Van Roy J, Wanders RJA, Opperdoes FR. Identification of 2-enoyl coenzyme A hydratase and NADP + -dependent 3-hydroxyacyl-CoA dehydrogenase activity in glycosomes of procyclic Trypanosoma brucei. Mol Biochem Parasitol 1996;82:107–11. [7] Van den Bosch H, Schutgens RBH, Wanders RJA, Tager JM. Biochemistry of peroxisomes. Annu Rev Biochem 1992;61:157 – 97. [8] Reddy JK, Mannaerts GP. Peroxisomal lipid metabolism. Annu Rev Nutr 1994;14:343–70. [9] Mannaerts GP, Van Veldhoven PP. Functions and organization of peroxisomal b-oxidation. Ann New York Acad Sci 1996;804:99–115. [10] Sommer JM, Cheng Q-L, Keller G-A, Wang CC. In vivo import of firefly luciferase into the glycosomes of Trypanosoma brucei and mutational analysis of the C- terminal targeting signal. Mol Biol Cell 1992;3:749–59. [11] Fung K, Clayton C. Recognition of a peroxisomal tripeptide entry signal by the glycosomes of Trypanosoma brucei. Mol Biochem Parasitol 1991;45:261–4. [12] Blattner J, Do¨rsam H, Clayton CE. Function of N-terminal import signals in trypanosome microbodies. FEBS Lett 1995;360:310 – 4.

127

[13] Lorenz P, Maier AG, Baumgart E, Erdmann R, Clayton C. Elongation and clustering of glycosomes in Trypanosoma brucei overexpressing the glycosomal Pex11p. EMBO J 1998;17:3542 – 55. [14] Flaspohler JA, Rickoll WL, Beverley SM, Parsons M. Functional identification of a Leishmania gene related to the peroxin 2 gene reveals common ancestry of glycosomes and peroxisomes. Mol Cell Biol 1997;17:1093 – 101. [15] Waterham HR, De Vries Y, Russell KA, Xie WQ, Veenhuis M, Cregg JM. The Pichia pastoris PER6 gene product is a peroxisomal integral membrane protein essential for peroxisome biogenesis and has sequence similarity to the Zellweger syndrome protein PAF-1. Mol Cell Biol 1996;16:2527 – 36. [16] Tsukamoto T, Miura S, Fujiki Y. Restoration by a 35K membrane protein of peroxisome assembly in a peroxisome-deficient mammalian cell mutant. Nature 1991;350:77 – 81. [17] Berteaux-Lecellier V, Picard M, Thompson-Coffe C, Zickler D, Panvier-Adoutte A, Simonet J-M. A nonmammalian homolog of the PAF1 gene (Zellweger syndrome) discovered as a gene involved in caryogamy in the fungus Podospora anserina. Cell 1995;81:1043 – 51. [18] Eitzen GA, Titorenko VI, Smith JJ, Veenhuis M, Szilard RK, Rachubinski RA. The Yarrowia lipolytica gene PAY5 encodes a peroxisomal integral membrane protein homologous to the mammalian peroxisome assembly factor PAF-1. J Biol Chem 1996;271:20300– 6. [19] Patarca R, Fletcher MA. Ring finger in the peroxisome assembly factor-1. FEBS Lett 1992;312:1 – 2. [20] Titorenko VI, Ogrydziak DM, Rachubinski RA. Four distinct secretory pathways serve protein secretion, cell surface growth, and peroxisome biogenesis in the yeast Yarrowia lipolytica. Mol Cell Biol 1997;17:5210 – 26. [21] Lodes MJ, Merlin G, deVos T, Ghosh A, Madhubala R, Myler PJ, Stuart K. Increased expression of LD1 genes transcribed by RNA polymerase I in Leishmania dono6ani as a result of duplication into the rRNA gene locus. Mol Cell Biol 1995;15:6845 – 53. [22] Kapler GM, Coburn CM, Beverly SM. Stable transfection of the human parasite Leishmania major delineates a 30-kilobase region sufficient for extrachromosomal replication and expression. Mol Cell Biol 1990;10:1084 – 94. [23] Fujiki Y, Hubbard AL, Fowler S, Lazarow PB. Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum. J Cell Biol 1982;61:97 – 102. [24] Evan GI, Lewis GK, Ramsay G, Bishop JM. Isolation of monoclonal antibodies specific for human c-myc protooncogene product. Mol Cell Biol 1985;5:3610 – 6. [25] Shih S, Hwang HY, Carter D, Stenberg P, Ullman B. Localization and targeting of the Leishmania dono6ani hypoxanthine-guanine phosphoribosyltransferase to the glycosome. J Biol Chem 1998;273:1534– 41. [26] Hannaert V, Callens M, Opperdoes FR, Michels PAM. Purification and characterization of the native and the recombinant Leishmania mexicana glycosomal glyceralde-

128

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

J.A. Flaspohler et al. / Molecular and Biochemical Parasitology 99 (1999) 117–128 hyde-3-phosphate dehydrogenase. Eur J Biochem 1994;225:143 – 9. Freedman DJ, Beverley SM. Two more independent selectable markers for stable transfection of Leishmania. Mol Biochem Parasitol 1993;62:37–44. Cruz A, Coburn CM, Beverley SM. Double targeted gene replacement for creating null mutants. Proc Natl Acad Sci USA 1991;88:7170 –4. Anderson SA, Carter V, Hagen CB, Parsons M. Molecular cloning of the glycosomal malate dehydrogenase of Trypanosoma brucei. Mol Biochem Parasitol 1998;96:185 – 9. LeBowitz JH, Coburn CM, McMahon-Pratt D, Beverley SM. Development of a stable Leishmania expression vector and application to the study of parasite surface antigen genes. Proc Natl Acad Sci USA 1990;87:9736–40. Ha DS, Schwarz JK, Turco SJ, Beverley SM. Use of the green fluorescent protein as a marker in transfected Leishmania. Mol Biochem Parasitol 1996;77:57–64. Haas J, Park EC, Seed B. Codon usage limitation in the expression of HIV-1 envelope glycoprotein. Curr Biol 1996;6:315 – 24. Hartree D, Bellofatto V. Essential components of the mini-exon gene promoter in the trypanosomatid Leptomonas seymouri. Mol Biochem Parasitol 1995;71:27–39. Wilson K, Beverley SM, Ullman B. Stable amplification of a linear extrachromosomal DNA in mycophenolic acid-resistant Leishmania dono6ani. Mol Biochem Parasitol 1992;55:197 – 206. Grondin K, Roy G, Ouellette M. Formation of extrachromosomal circular amplicons with direct or inverted duplications in drug-resistant Leishmania tarentolae. Mol Cell Biol 1996;16:3587–95. Henderson DM, Sifri CD, Rodgers M, Wirth DF, Hen-

.

[37]

[38]

[39]

[40]

[41]

[42]

[43]

drickson N, Ullman B. Multidrug resistance in Leishmania dono6ani is conferred by amplification of a gene homologous to the mammalian mdr1 gene. Mol Cell Biol 1992;12:2855 – 65. Tripp CA, Wisdom WA, Myler PJ, Stuart KD. A multicopy, extrachromosomal DNA in Leishmania infantum contains two inverted repeats of the 27.5-kilobase LD1 sequence and encodes numerous transcripts. Mol Biochem Parasitol 1992;55:39 – 50. Tan X, Titorenko V, Van der Klei IJ, Sulter GJ, Haima P, Waterham HR, Evers M, Harder W, Veenhuis M, Cregg J. Characterization of peroxisome-deficient mutants of Hansenula polymorpha. Curr Genet 1995;28:248 – 57. Shimozawa N, Tsukamoto T, Suzuki Y, Orii T, Shirayoshi Y, Mori T, Fujiki Y. A human gene responsible for Zellweger syndrome that affects peroxisome assembly. Science 1992;255:1132– 4. Shimozawa N, Suzuki Y, Orii T, Moser A, Moser HW, Wanders RJ. Standardization of complementation grouping of peroxisome-deficient disorders and the second Zellweger patient with peroxisomal assembly factor-1 (PAF-1) defect [letter]. Am J Hum Genet 1993;52:843 – 4. Tsukamoto T, Shimozawa N, Fujiki Y. Peroxisome assembly factor 1: Nonsense mutation in a peroxisomedeficient Chinese hamster ovary cell mutant and deletion analysis. Mol Cell Biol 1994;14:5458 – 65. Thieringer R, Raetz CR. Peroxisome-deficient Chinese hamster ovary cells with point mutations in peroxisome assembly factor-1. J Biol Chem 1993;268:12631– 6. Gould SJ, McCollum D, Spong AP, Heyman JA, Subramani S. Development of the yeast Pichia pastoris as a model organism for a genetic and molecular analysis of peroxisome assembly. Yeast 1992;8:613 – 28.