- Email: [email protected]
A fine balance between CCNL1 and TIMP1 contributes to the development of breast cancer cells
Biochemical and Biophysical Research Communications 409 (2011) 344–349
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
A fine balance between CCNL1 and TIMP1 contributes to the development of breast cancer cells Li Peng a,b,1, Ma Yanjiao a,b,1, Wang Ai-guo c, Gong Pengtao a, Li Jianhua a, Yang Ju a, Ouyang Hongsheng a,⇑, Zhang Xichen a,⇑ a b c
College of Animal Science and Veterinary Medicine, Jilin University, 5333 Xi’an Road, Changchun 130062, PR China College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agriculture University, Daqing, Heilongjiang 163319, PR China Laboratory Animal Center, Dalian Medical University, Dalian, Liaoning 116000, PR China
a r t i c l e
i n f o
Article history: Received 25 April 2011 Available online 8 May 2011 Keywords: CCNL1 TIMP1 Breast cancer Gene expression
a b s t r a c t Cyclin L1 (CCNL1) and tissue inhibitor of matrix metalloproteinase-1 (TIMP1) are candidate genes involved in several types of cancer. However, the expression of CCNL1 and the relationship between CCNL1 and TIMP1 in breast cancer cells is unknown. Using patients’ breast cancer tissues, the expression of CCNL1 and TIMP1 was measured by cDNA microarray and further confirmed by real-time RT-PCR and western blotting. Overexpression or repression of CCNL1 and TIMP1, individually or together, was performed in breast cancer MDA-MB-231 cells by transient transformation methods to investigate their role in breast cancer cell growth. Simultaneously, mRNA and protein expression levels of CCNL1 and TIMP1 were also measured. CCNL1 and TIMP1 expression was significantly elevated in breast cancer tissues compared with that in peri-breast cancer tissues of patients by cDNA microarray and these results were further confirmed by real-time RT-PCR and western blotting. Interestingly, in vitro experiments showed a stimulatory effect of TIMP1 and an inhibitory effect of CCNL1 on growth of MDA-MB-231 cells. Coexpression or co-repression of these two genes did not affect cell growth. Overexpression of CCNL1 and TIMP1 individually induced overexpression of each other. These data demonstrate that there is a fine balance between CCNL1 and TIMP1, which may contribute to breast cancer development. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Cyclin L1 (CCNL1) has recently been identified as a new nuclear protein that is located in the 3q25-28 region of the genome [1] and belongs to the cyclin family. It contains a C-terminal arginine and serine-rich (RS) domain and a characteristic cyclin box [2]. The RS domain and nuclear speckles localization are considered to be the main factors that contribute to pre-mRNA splicing activity of CCNL1 [3,4]. In head and neck squamous cell carcinoma (HNSCC), CCNL1 plays a critical role in loco-regional progression and may serve as an indicator for occult advanced tumor stages [5]. Therefore, CCNL1 is considered as a candidate oncogene and biomarker of HNSCC [1,6]. Tissue inhibitor of matrix metalloproteinase-1 (TIMP1) is a naturally occurring inhibitor of matrix metalloproteinases (MMPs), a large family of proteases involved in many physiological and pathological processes such as embryonic development, tissue morpho⇑ Corresponding authors. Fax: +86 431 87981351. E-mail addresses: [email protected] (O. Hongsheng), [email protected] (Z. Xichen). 1 These authors contributed equally to this work. 0006-291X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.05.021
genesis, wound healing, inflammation and cancer invasion [7]. Four TIMPs (TIMP1 to 4) have been identified and they differ in tissue distribution and ability to inhibit different MMPs [8]. TIMP1 was first identified for its growth stimulating activity in erythroid progenitors [9], and its mitogenic ability has since been demonstrated in many cell types [10,11]. Further reports have suggested that TIMP1 plays a role in multiple processes including cell proliferation, apoptosis, angiogenesis and cellular signaling [10,11]. As a result of these clinical findings and experimental data, it has been suggested that the TIMP proteins may inhibit as well as promote tumor growth and development, dependent on the tumor environment and the TIMP1 expression level. For breast cancer, a high TIMP1 expression is associated with increased histological grade, lymph-node and distant metastasis and decreased survival and a poor prognosis [5,6,12,13]. TIMP1 is also considered a tumor marker in breast carcinoma patients [14]. However, it is unknown if CCNL1 is related to the development and progress of breast cancer. The relationship between CCNL1 and TIMP1 in breast cancer cells is also unknown. In this study, the expression of CCNL1 and TIMP1 in breast cancer patients and their relationship was investigated in vitro in MDA-MB-231 cells, which is a breast cancer cell line.
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
2. Materials and methods 2.1. Patients Ten breast carcinomas developed in the stage of Phase IIb T2N1M0 according to the TNM Classification of Malignant Tumors (TNM) and their adjacent peri-tumor tissues were collected from patients who had surgery without previous radiation or chemotherapy at The Affiliated Clinical Hospital of Jilin University. The patients were aged from 35 to 58 years (mean, 44 years). The tissue samples were snap-frozen and stored in liquid nitrogen until the RNA or protein was extracted. 2.2. cDNA microarray A cDNA microarray chip (22K Human Genome Array Chip; CapitalBio, Co., Ltd., Beijing, CHN) was used in this experiment. Total RNA was extracted using Trizol reagent (Invitrogen, Gaithersburg, MD, USA) from tumors or peri-tumor tissues of patients and further purified by a NucleoSpinÒ RNA clean-up kit (TaKaRa, Otsu, Shiga, Japan). RNA samples were reverse-transcribed to cDNAs, which were amplified and marked by fluorescence (Amplification labeling kit, GE Healthcare, Buckinghamshire HP8 4SP, UK). After hybridization, washing and chip scanning (JINGXIN LuxScan 10KA dual-channel laser scanner, CapitalBio, Co., Ltd., Beijing, CHN), the results were analyzed by SAM (Significance Analysis of Microarrays, version 3.0; Stanford University, Stanford city, US) software to determine differentially expressed genes. 2.3. Plasmid construction Human CCNL1 and TIMP1 full-length cDNA were generated by RT-PCR from total RNA of MDA-MB-231 cells. The primers are listed in Table 1. The purified PCR products were then directly subcloned into the multicloning site of the pMD-18T vector (TaKaRa, Otsu, Shiga, Japan). The genes were then digested by EcoR I and Hind III restriction enzymes and subcloned into the multicloning site of a pcDNA3.1 (+) vector (Invitrogen, Carlsbad, US). These plasmids were called pcCCNL1 and pcTIMP1. In addition, to enhance the expression of CCNL1 and TIMP1, the key sequence of KOZAK (GCCACC) [16] was inserted ahead of the initiation codon (ATG) of the genes. All constructed genes were sequenced in their entirety to verify the correct sequence, orientation and reading frame. For repression of gene expression, two interference DNAs were designed (iCCNL1 and iTIMP1) according to the sequence of CCNL1 (Genebank No. NM-003254) and TIMP1 (Genebank No. NM020307). 2.4. Cell culture and transfection MDA-MB-231 cells were provided by Boster Co. and grown in special medium (Boster Co., Hunan, CHN) in a humidified atmosphere of 5% CO2 at 37 °C. For transfection, 80–90% confluency MDA-MB-231 cells were covered by 2 ml of complete medium.
345
At the same time, 2 lg plasmid and 6 ll FuGENE HD Transfection Reagent (Roche, Mannheim, Germany) were diluted in 100 ll Dulbecco’s modified Eagle’s medium (DMEM) without serum. After a 5-min incubation, diluted DNA and FuGENE HD Transfection Reagent were mixed gently and cultured for an additional 15 min at room temperature. This combination was then added to the cultured cells and the cells were cultured in a CO2 incubator for 36 h. The transfected cells were then used for further experiments. 2.5. MTT assay To explore the possible role of CCNL1 and TIMP1 on cell growth, an MTT assay was performed in transfected MDA-MB-231 cells. Thirty-six hours after transfection, the cells were collected and diluted to 2 103 cells/ml in medium and seeded into 96-cell culture wells (0.2 ml per well) and the wells with medium only were set up as controls. After defined times of cell culture, 20 ll MTT reagent was added to each well and continually cultured for another 4 h, and then 150 ll DMSO was added to each well and mixed by shaken for 10 min. Absorbance values at a 490 nm wavelength were measured by enzyme-linked immunosorbent assay. 2.6. Quantitative real-time RT-PCR Total RNA was extracted using the Simply P Total RNA Extraction kit (BioFlux, Hangzhou, China) from tissues and cells and quantitated by an ultraviolet spectrophotometer. Two micrograms of total RNA was reverse-transcribed to cDNA using the BioRT one step RT-PCR kit (BioFlux, Hangzhou, China). Two microliters of cDNA was used for quantitative PCR amplification using the standard SYBR Green I PCR protocol provided by the manufacturer on an ABI Prism 7000 quantitative real-time PCR instrument. Primers are listed in Table 2. Gene expression levels were measured in at least three independent experiments and normalized to the expression level of b-actin. 2.7. Western blot Tissues and cells were lysed in lysis buffer (50 mmol/l Tris–HCl pH 8.0; 0.150 mmol/l NaCl; 1% Triton X-100; 100 lg/ml PMSF) and the protein concentration was measured using a BCA protein assay kit (Pierce, Rockford, US). For western blot analysis, 20 lg protein samples were boiled in 5 sample buffer for 10 min and were then resolved by 12% SDS–PAGE. After transferring and blocking, membranes were probed with first and then second antibodies (anti-human CCNL1 (Abcam, Cambridge, USA), anti-human TIMP1 (Abcam, Cambridge, USA), coat anti-mouse antibodies (Santa Cruz, Biotechnology, Santa Cruz, CA). Destination straps were detected by a DAB kit (Bioer Tech, Hangzhou, China). 2.8. Statistical analysis The results are expressed as mean ± standard error (SEM). Statistical analysis was carried out using two-way ANOVA. Where sig-
Table 1 The primers for full-length CCNL1 and TIMP1 cloning.
Notes: The sequences underlined were EcoR I or Hind III restriction sites and the sequence boxed was KOZAK sequence.
346
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
Table 2 The primers and probes for quantitative real-time RT-PCR assay. Gene
Primer and probe
Sequences
The length of production
CCNL1
CF (forward) CR (reverse) CP (probe)
AAGAAGCAGGTCCCGCAGT TGGCTGCATCTGAGTGATCC FTGAAAGCCCTCGAAGACATCATAATCATGGP
179 bp
TIMP1
TF (forward) TR (reverse) TP (probe)
50 -TGGCATCCTGTTGTTGCTGT-30 50 -GGTGGTCTGGTTGACTTCTGGT-30 FCCAGCAGGGCCTGCACCTGTGTP
142 bp
nificant overall differences were detected by ANOVA, the Student’s two-tailed unpaired t-test was used to compare differences between treatments. A p value of less than 0.05 was considered to be significant. We used the statistical analysis program SPSS 10.0. 3. Results 3.1. CCNL1 and TIMP1 are significantly elevated in breast cancer cells From breast cancer tissues of 10 patients, microarray data showed 303 differentially expressed genes (S1A), and among them we found that CCNL1 and TIMP1 expression was simultaneously significantly elevated in breast cancer tissues compared with that in peri-tumor tissues (S1B). These results were further confirmed by quantitative real-time RT-PCR (Fig. 1A and, S1C and D) and western blot (Fig. 1B).
growth of breast cancer cells and may play an important role in breast cancer development. 3.3. CCNL1 inhibits the growth of MDA-MB-231 cells CCNL1 has been shown to be a molecular marker and an oncogene for HNSCC [5]. Interestingly, we also found overexpression of the CCNL1 gene in breast cancer tissues (Fig. 1). To investigate if CCNL1 contributes to breast cancer development, overexpression and repression of CCNL1 were performed in MDA-MB-231 cells. Overexpression of CCNL1 significantly inhibited cell growth, while repression of CCNL1 promoted cell growth (Fig. 2A). The in vivo and in vitro data showed that CCNL1 has a negative effect on breast cancer cell growth and may play an important role in controlling the growth of breast cancer. 3.4. Cell growth is controlled by the expression levels of TIMP1 and CCNL1
3.2. TIMP1 promotes the growth of MDA-MB-231 cells TIMP1 has been shown to have an important role in promoting cell growth of breast cancer [5,6,12,13]. We also found that there was overexpression of the TIMP1 gene in breast cancer tissues (Fig. 1). To confirm TIMP1’s effect on cell growth, overexpression and repression of TIMP1 were performed in MDA-MB-231 cells. Overexpression of TIMP1 significantly promoted cell growth, while repression of TIMP1 had no effect on cell growth (S2A). Our in vivo and in vitro data showed that TIMP1 has a positive effect on the
A
Although CCNL1 had a negative influence on breast cancer cell growth, CCNL1 was also overexpressed in breast cancer tissues (Fig. 1). To determine the relationship between CCNL1 and TIMP1, regulation of the expression of these two genes was performed in MDA-MB-231 cells. When MDA-MB-231 cells were transfected with pcTIMP1 and iCCNL1 together, cell growth was significantly promoted (Fig. 2B). However, when pcCCNL1 and iTIMP1 were transfected into MDA-MB-231 cells together, cell growth was significantly inhibited (Fig. 2B). These data further confirmed the
Cancer tissues M
1T
2T
3T
Peri-tumor tissues
4T
5T
1N
2N
3N
4N
5N CCNL1
TIMP1
B
Cancer tissues
1T
2T
Peri-tumor tissues
1N
2N CCNL1 TIMP1 Actin
Fig. 1. Overexpression of CCNL1 and TIMP1 genes in breast cancer tissues. RT-PCR (A) and western blot (B) assay for the expression of CCNL1 and TIMP1 in breast tumor and peri-tumor tissues of breast cancer patients. The numbers indicate separate breast cancer patients. T, tumor tissue; N, peri-tumor tissue.
347
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
A
stimulatory effect of TIMP1 and inhibitory effect of CCNL1 in breast cancer cells. Not surprisingly, the co-expression of TIMP1 and CCNL1 in MDA-MB-231 cells did not affect cell growth (S2B). Additionally, repression of TIMP1 and CCNL1 in MDA-MB-231 cells did not affect cell growth (S2B).
0.5 MDA-MB- 231 cell with pcCCNL1 MDA-MB- 231 cell with iCCNL1
*
0.4 OD490nm value
MDA-MB- 231 cell without plasmid
*
MDA-MB- 231 cell with pcDNA3.1
0.3
3.5. CCNL1 and TIMP1 regulate the expression of each other
* *
2 0.2 0
*
*
*
6
7
8
01 0.1
0.0 0
1
2
3
4
5
9
Days
B
0.6 MDA-MB- 231 cell with pcCCNL1 and iTIMP1 MDA-MB- 231 cell with iCCNL1 and pcTIMP1
0.5
*
MDA-MB- 231 cell without plasmid
OD490nm value
*
MDA-MB- 231 cell with pcDNA3.1
0.4
*
0.3
* *
*
0.2
4. Discussion
*
0.1
0.0 0
1
2
3
CCNL1 has been reported to regulate gene expression [15]. To determine if these two genes can affect the expression of each other, expression levels of these two genes was measured after transfection of pcCCNL1, pcTIMP1, iCCNL1 and iTIMP1 individually or by combination into MDA-MB-231 cells. Interestingly, overexpression as well as repression of CCNL1 induced the overexpression of TIMP1 in mRNA and protein expression levels (Fig. 3A). Even the expression of TIMP1 was more increased when transfected with iCCNL1 than with pcCCNL1 (Fig. 3A). CCNL1 expression was significantly increased when transfected with iTIMP1. However, the expression of CCNL1 did not change when transfected with pcTIMP1 (Fig. 3B). Interestingly, the expression of TIMP1 and CCNL1 was significantly elevated when co-transfected with pcTIMP1 and pcCCNL1 compared with transfection with pcTIMP1 or pcCCNL1 alone (Fig. 4A and B). These data indicate that the expression levels of CCNL1 and TIMP1 are regulated by each other.
4
Days
5
6
7
8
9
Fig. 2. The growth of MDA-MB-231 cells influenced by regulation of the expression of TIMP1 and/or CCNL1. MTT was used for the growth curve assay and the cells transfected with or without pcDNA3.1 were used as controls. (A) The cell growth was significantly induced by transient transfection of iCCNL1 from day 5 and was significantly inhibited by transient transfection of the pcCCNL1 vector from day 6. (B) The cell growth was significantly induced by simultaneous transient transfection of the iCCNL1 and pcTIMP1 vectors from day 4 and was significantly inhibited by simultaneous transient transfection of the pcCCNL1 vector and iTIMP1 from day 7. The experiment was performed in triplicate and repeated twice. Error bars represent the standard deviation, indicates P < 0.05 by Student’s t-test.
A 100
CCNL1 has been found to be overexpressed in a variety of human cancers, particularly in human head and neck carcinoma. However, no reports have shown overexpression of CCNL1 in breast cancer. Our data showed that CCNL1 was significantly overexpressed in breast carcinoma compared with that in peri-tumor tissues (Fig. 1). More interestingly, our in vitro experiments showed that CCNL1 has a negative effect on cell growth in MDAMB-231 cells (Fig. 2A). We also found similar results in another breast cancer cell line, MCF-7 (data not shown). CCNL1 is stably located in nuclear speckles and the expression level is unchanged through all the processes of the cell cycle. CCNL1’s closely related cyclin family member CCNL-2 migrates and regulates its expression level depending on the period of the cell cycle [13]. These findings indicate that CCNL1 may have a special role in the regulation
B
*
40
Relative expression
Relative expression
* 75
50 * 25
*
30
20
10
0
0
iT
.1
P1 TIM
P1 IM
pc
ne
A3 DN
pc
k
ge Fu
oc M
.1
L1 CN iC 1 NL
CC pc
ne
A3 DN
pc
ge Fu
k oc M
TIMP1 Actin
CCNL1 Actin
Fig. 3. CCNL1 and TIMP1 expression levels in MDA-MB-231 cells. (A) TIMP1 expression was significantly induced when transfected with pcCCNL1 or iCCNL1 as shown by real-time RT-PCR (upper) and western blot (lower) assays. (B) CCNL1 expression was significantly induced when transfected with iTIMP1 as shown by real-time RT-PCR (upper) and western blot (lower) assays. Untreated cells or cells transfected with pcDNA3.1, or FuGENE reagent were used as controls. The experiment was performed in triplicate and repeated twice. Error bars represent the standard deviation, indicates P < 0.05 by Student’s t-test.
348
B 100
15
*
Relative expression
Relative expression
A
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
10
5
*
75
50
25
0
0
1 NL CC
d an 1 N L P1 CC IM pc pcT
pc
d an 1 N L P1 CC TIM pc pc
P1
M TI
pc
TIMP1
CCNL1
Actin
Actin
Fig. 4. CCNL1 and TIMP1 expression levels in MDA-MB-231 cells. (A) TIMP1 expression was significantly induced when co-transfected with pcCCNL1 and pcTIMP1 compared with transfection with the pcTIMP1 vector alone as shown by real-time RT-PCR (upper) and western blot (lower) assays. (B) CCNL1 expression was significantly induced when co-transfected with pcCCNL1 and pcTIMP1 compared with transfection with the pcCCNL1 vector alone as shown by real-time RT-PCR (upper) and western blot (lower) assays. The experiment was performed in triplicate and repeated twice. Error bars represent the standard deviation, indicates P < 0.05 by Student’s t-test.
of the cell cycle. In contrast to previous reports, our data are the first to show that CCNL1 can negatively regulate cell growth in breast carcinoma, and this provides a new window of opportunity to further investigate the molecular mechanisms of CCNL1 in cell cycle regulation. TIMP1 has been reported to be involved in several cancers, including breast cancer, and it can have positive effects such as stimulation of growth [11] and inhibition of apoptosis [7] Consistent with previous studies, our in vivo and in vitro data also indicate that TIMP1 plays an important role in promoting cell growth of breast cancer (Fig. 1 and S2A). Because our in vitro experiments showed opposite roles of CCNL1 and TIMP1 on the growth of breast cancer cells, the co-transfection of pcCCNL1, pcTIMP1, iCCNL1 and iTIMP1 was performed in MDA-MB-231 breast cancer cells to investigate if there is an interaction between these two genes. Interestingly, co-overexpression or co-repression of CCNL1 and TIMP1 did not affect the growth of MDA-MB-231 cells (S2B). When repression of CCNL1 and overexpression of TIMP1 occurred together, cell growth was more significantly promoted compared with that in transfection of iCCNL1 and pcTIMP1 individually (Fig. 2B). However, when repression of TIMP1 and overexpression of CCNL1 occurred together, cell growth was significantly inhibited, and this effect was weaker than overexpression of CCNL1 alone (Fig. 2B). Moreover, we also achieved similar results with MCF-7 cells (data not shown). These data indicate that there is a close interaction between CCNL1 and TIMP1 in breast cancer cells. It has been reported that CCNL1 contains an RS domain (Ser-Arg rich proteins) that may confer important pre-RNA splicing activity to CCNL1 [2,15]. To determine if CCNL1 and TIMP1 can regulate the expression of each other, CCNL1 and TIMP1 expression was measured after transfection experiments. Interestingly, transfecting MDA-MB-231 cells with iCCNL1 significantly induced TIMP1 expression (Fig. 3). However, transfection of pcTIMP1 did not affect CCNL1 expression (Fig. 3). The co-transfection of iCCNL1 and pcTIMP1 significantly induced the expression of TIMP1, which promotes cell growth. These data can explain why cell growth was more significantly promoted by repression of CCNL1 and overexpression of TIMP1 together. However, when cells were transfected
with iTIMP1 or pcCCNL1, they induced each other’s expression (Fig. 3). This may partly explain why the inhibition effect of cotransfection of iTIMP1 and pcCCNL1 on cell growth was weaker than transfection of pcCCNL1 and stronger than transfection of iTIMP1. More interestingly, with co-overexpression of CCNL1 and TIMP1, the expression of these two genes was considerably induced compared with overexpression of these two genes individually (Fig. 4). In addition, repression of TIMP or CCNL1 induced each other’s expression (Fig. 3). These data may explain why cotransfection of pcTIMP1 and pcCCNL1 or iTIMP1 and iCCNL1 did not affect the growth of MDA-MB-231 cells. Our data suggest that CCNL1 has a negative effect, while TIMP1 has a positive effect on the growth of the breast cancer cells. Moreover, there is a fine balance between the expression of CCNL1 and TIMP1, i.e., the expression levels of these two genes significantly affect each other’s expression. The overexpression of these two genes detected in human breast cancer tissues indicates a fine control of cancer cell growth, which contributes to the development of cancer. Although more detailed molecular mechanisms remain to be elucidated, our results provide new evidence of a negative cell cycle regulation by the function of CCNL1. These findings will contribute to our understanding of cancer biology, and they indicate the important role of CCNL1 in breast cancer development. Acknowledgments This work was supported by a grant from the Chinese Ministry of Science and Technology (Grant No. 2006CB910505) and a grant from the Jilin Provincial Science and Technology Department (Grant Nos. 2003055025 and 20106044). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2011.05.021. References [1] R. Redon, T. Hussenet, G. Bour, K. Caulee, B. Jost, D. Muller, J. Abecassis, S. du Manoir, Amplicon mapping and transcriptional analysis pinpoint cyclin L as a candidate oncogene in head and neck cancer, Cancer Res. 62 (2002) 6211– 6217. [2] L.A. Dickinson, A.J. Edgar, J. Ehley, J.M. Gottesfeld, Cyclin L is an RS domain protein involved in pre-mRNA splicing, J. Biol. Chem. 277 (2002) 25465– 25473. [3] H.H. Chen, Y.C. Wang, M.J. Fann, Identification and characterization of the CDK12/cyclin L1 complex involved in alternative splicing regulation, Mol. Cell. Biol. 26 (2006) 2736–2745. [4] H.H. Chen, Y.H. Wong, A.M. Geneviere, M.J. Fann, CDK13/CDC2L5 interacts with L-type cyclins and regulates alternative splicing, Biochem. Biophys. Res. Commun. 354 (2007) 735–740. [5] C. Sticht, C. Hofele, C. Flechtenmacher, F.X. Bosch, K. Freier, P. Lichter, S. Joos, Amplification of Cyclin L1 is associated with lymph node metastases in head and neck squamous cell carcinoma (HNSCC), Br. J. Cancer 92 (2005) 770–774. [6] D. Muller, R. Millon, S. Théobald, T. Hussenet, B. Wasylyk, S. du Manoir, J. Abecassis, Cyclin L1 (CCNL1) gene alterations in human head and neck squamous cell carcinoma, Br. J. Cancer 94 (2006) 1041–1044. [7] V. Lemaitre, J. D’Armiento, Matrix metalloproteinases in development and disease, Birth Defects Res. C Embryo Today 78 (2006) 1–10. [8] A.H. Baker, D.R. Edwards, G. Murphy, Metalloproteinase inhibitors: biological actions and therapeutic opportunities, J. Cell Sci. 115 (2002) 3719–3727. [9] C.A. Westbrook, J.C. Gasson, S.E. Gerber, M.E. Selsted, D.W. Golde, Purification and characterization of human T-lymphocyte-derived erythroid-potentiating activity, J. Biol. Chem. 259 (1984) 9992–9996. [10] S.A. Jensen, B. Vainer, A. Bartels, N. Brünner, J.B. Sørensen, Expression of matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of metalloproteinases 1 (TIMP-1) by colorectal cancer cells and adjacent stroma cells—associations with histopathology and patients outcome, Eur. J. Cancer 46 (2010) 3233– 3242. [11] D. Inagaki, T. Oshima, K. Yoshihara, S. Tamura, A. Kanazawa, T. Yamada, N. Yamamoto, T. Sato, M. Shiozawa, S. Morinaga, M. Akaike, S. Fujii, K. Numata, C. Kunisaki, Y. Rino, K. Tanaka, M. Masuda, T. Imada, Overexpression of tissue inhibitor of metalloproteinase-1 gene correlates with poor outcomes in colorectal cancer, Anticancer Res. 30 (2010) 4127–4130.
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349 [12] P. Loyer, J.H. Trembley, J.A. Grenet, A. Busson, A. Corlu, W. Zhao, M. Kocak, V.J. Kidd, J.M. Lahti, Characterization of cyclin L1 and L2 interactions with CDK11 and splicing factors: influence of cyclin L isoforms on splice site selection, J. Biol. Chem. 283 (2008) 7721–7732. [13] A. Herrmann, K. Fleischer, H. Czajkowska, G. Müller-Newen, W. Becker, Characterization of cyclin L1 as an immobile component of the splicing factor compartment, J. FASEB 21 (2007) 3142–3152.
349
[14] S.O. Würtz, A.S. Schrohl, H. Mouridsen, N. Brünner, TIMP-1 as a tumor marker in breast cancer—an update, Acta Oncol. 47 (2008) 580–590. [15] S. Tannukit, X. Wen, H. Wang, M.L. Paine, TFIP11, CCNL1 and EWSR1 protein– protein interactions, and their nuclear localization, Int. J. Mol. Sci. 9 (2008) 1504–1514. [16] M. Kozak, A short leader sequence impairs the fidelity of initiation by eukaryotic ribosomes, Gene Expr. 1 (1991) 111–115.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
A fine balance between CCNL1 and TIMP1 contributes to the development of breast cancer cells Li Peng a,b,1, Ma Yanjiao a,b,1, Wang Ai-guo c, Gong Pengtao a, Li Jianhua a, Yang Ju a, Ouyang Hongsheng a,⇑, Zhang Xichen a,⇑ a b c
College of Animal Science and Veterinary Medicine, Jilin University, 5333 Xi’an Road, Changchun 130062, PR China College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agriculture University, Daqing, Heilongjiang 163319, PR China Laboratory Animal Center, Dalian Medical University, Dalian, Liaoning 116000, PR China
a r t i c l e
i n f o
Article history: Received 25 April 2011 Available online 8 May 2011 Keywords: CCNL1 TIMP1 Breast cancer Gene expression
a b s t r a c t Cyclin L1 (CCNL1) and tissue inhibitor of matrix metalloproteinase-1 (TIMP1) are candidate genes involved in several types of cancer. However, the expression of CCNL1 and the relationship between CCNL1 and TIMP1 in breast cancer cells is unknown. Using patients’ breast cancer tissues, the expression of CCNL1 and TIMP1 was measured by cDNA microarray and further confirmed by real-time RT-PCR and western blotting. Overexpression or repression of CCNL1 and TIMP1, individually or together, was performed in breast cancer MDA-MB-231 cells by transient transformation methods to investigate their role in breast cancer cell growth. Simultaneously, mRNA and protein expression levels of CCNL1 and TIMP1 were also measured. CCNL1 and TIMP1 expression was significantly elevated in breast cancer tissues compared with that in peri-breast cancer tissues of patients by cDNA microarray and these results were further confirmed by real-time RT-PCR and western blotting. Interestingly, in vitro experiments showed a stimulatory effect of TIMP1 and an inhibitory effect of CCNL1 on growth of MDA-MB-231 cells. Coexpression or co-repression of these two genes did not affect cell growth. Overexpression of CCNL1 and TIMP1 individually induced overexpression of each other. These data demonstrate that there is a fine balance between CCNL1 and TIMP1, which may contribute to breast cancer development. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Cyclin L1 (CCNL1) has recently been identified as a new nuclear protein that is located in the 3q25-28 region of the genome [1] and belongs to the cyclin family. It contains a C-terminal arginine and serine-rich (RS) domain and a characteristic cyclin box [2]. The RS domain and nuclear speckles localization are considered to be the main factors that contribute to pre-mRNA splicing activity of CCNL1 [3,4]. In head and neck squamous cell carcinoma (HNSCC), CCNL1 plays a critical role in loco-regional progression and may serve as an indicator for occult advanced tumor stages [5]. Therefore, CCNL1 is considered as a candidate oncogene and biomarker of HNSCC [1,6]. Tissue inhibitor of matrix metalloproteinase-1 (TIMP1) is a naturally occurring inhibitor of matrix metalloproteinases (MMPs), a large family of proteases involved in many physiological and pathological processes such as embryonic development, tissue morpho⇑ Corresponding authors. Fax: +86 431 87981351. E-mail addresses: [email protected] (O. Hongsheng), [email protected] (Z. Xichen). 1 These authors contributed equally to this work. 0006-291X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.05.021
genesis, wound healing, inflammation and cancer invasion [7]. Four TIMPs (TIMP1 to 4) have been identified and they differ in tissue distribution and ability to inhibit different MMPs [8]. TIMP1 was first identified for its growth stimulating activity in erythroid progenitors [9], and its mitogenic ability has since been demonstrated in many cell types [10,11]. Further reports have suggested that TIMP1 plays a role in multiple processes including cell proliferation, apoptosis, angiogenesis and cellular signaling [10,11]. As a result of these clinical findings and experimental data, it has been suggested that the TIMP proteins may inhibit as well as promote tumor growth and development, dependent on the tumor environment and the TIMP1 expression level. For breast cancer, a high TIMP1 expression is associated with increased histological grade, lymph-node and distant metastasis and decreased survival and a poor prognosis [5,6,12,13]. TIMP1 is also considered a tumor marker in breast carcinoma patients [14]. However, it is unknown if CCNL1 is related to the development and progress of breast cancer. The relationship between CCNL1 and TIMP1 in breast cancer cells is also unknown. In this study, the expression of CCNL1 and TIMP1 in breast cancer patients and their relationship was investigated in vitro in MDA-MB-231 cells, which is a breast cancer cell line.
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
2. Materials and methods 2.1. Patients Ten breast carcinomas developed in the stage of Phase IIb T2N1M0 according to the TNM Classification of Malignant Tumors (TNM) and their adjacent peri-tumor tissues were collected from patients who had surgery without previous radiation or chemotherapy at The Affiliated Clinical Hospital of Jilin University. The patients were aged from 35 to 58 years (mean, 44 years). The tissue samples were snap-frozen and stored in liquid nitrogen until the RNA or protein was extracted. 2.2. cDNA microarray A cDNA microarray chip (22K Human Genome Array Chip; CapitalBio, Co., Ltd., Beijing, CHN) was used in this experiment. Total RNA was extracted using Trizol reagent (Invitrogen, Gaithersburg, MD, USA) from tumors or peri-tumor tissues of patients and further purified by a NucleoSpinÒ RNA clean-up kit (TaKaRa, Otsu, Shiga, Japan). RNA samples were reverse-transcribed to cDNAs, which were amplified and marked by fluorescence (Amplification labeling kit, GE Healthcare, Buckinghamshire HP8 4SP, UK). After hybridization, washing and chip scanning (JINGXIN LuxScan 10KA dual-channel laser scanner, CapitalBio, Co., Ltd., Beijing, CHN), the results were analyzed by SAM (Significance Analysis of Microarrays, version 3.0; Stanford University, Stanford city, US) software to determine differentially expressed genes. 2.3. Plasmid construction Human CCNL1 and TIMP1 full-length cDNA were generated by RT-PCR from total RNA of MDA-MB-231 cells. The primers are listed in Table 1. The purified PCR products were then directly subcloned into the multicloning site of the pMD-18T vector (TaKaRa, Otsu, Shiga, Japan). The genes were then digested by EcoR I and Hind III restriction enzymes and subcloned into the multicloning site of a pcDNA3.1 (+) vector (Invitrogen, Carlsbad, US). These plasmids were called pcCCNL1 and pcTIMP1. In addition, to enhance the expression of CCNL1 and TIMP1, the key sequence of KOZAK (GCCACC) [16] was inserted ahead of the initiation codon (ATG) of the genes. All constructed genes were sequenced in their entirety to verify the correct sequence, orientation and reading frame. For repression of gene expression, two interference DNAs were designed (iCCNL1 and iTIMP1) according to the sequence of CCNL1 (Genebank No. NM-003254) and TIMP1 (Genebank No. NM020307). 2.4. Cell culture and transfection MDA-MB-231 cells were provided by Boster Co. and grown in special medium (Boster Co., Hunan, CHN) in a humidified atmosphere of 5% CO2 at 37 °C. For transfection, 80–90% confluency MDA-MB-231 cells were covered by 2 ml of complete medium.
345
At the same time, 2 lg plasmid and 6 ll FuGENE HD Transfection Reagent (Roche, Mannheim, Germany) were diluted in 100 ll Dulbecco’s modified Eagle’s medium (DMEM) without serum. After a 5-min incubation, diluted DNA and FuGENE HD Transfection Reagent were mixed gently and cultured for an additional 15 min at room temperature. This combination was then added to the cultured cells and the cells were cultured in a CO2 incubator for 36 h. The transfected cells were then used for further experiments. 2.5. MTT assay To explore the possible role of CCNL1 and TIMP1 on cell growth, an MTT assay was performed in transfected MDA-MB-231 cells. Thirty-six hours after transfection, the cells were collected and diluted to 2 103 cells/ml in medium and seeded into 96-cell culture wells (0.2 ml per well) and the wells with medium only were set up as controls. After defined times of cell culture, 20 ll MTT reagent was added to each well and continually cultured for another 4 h, and then 150 ll DMSO was added to each well and mixed by shaken for 10 min. Absorbance values at a 490 nm wavelength were measured by enzyme-linked immunosorbent assay. 2.6. Quantitative real-time RT-PCR Total RNA was extracted using the Simply P Total RNA Extraction kit (BioFlux, Hangzhou, China) from tissues and cells and quantitated by an ultraviolet spectrophotometer. Two micrograms of total RNA was reverse-transcribed to cDNA using the BioRT one step RT-PCR kit (BioFlux, Hangzhou, China). Two microliters of cDNA was used for quantitative PCR amplification using the standard SYBR Green I PCR protocol provided by the manufacturer on an ABI Prism 7000 quantitative real-time PCR instrument. Primers are listed in Table 2. Gene expression levels were measured in at least three independent experiments and normalized to the expression level of b-actin. 2.7. Western blot Tissues and cells were lysed in lysis buffer (50 mmol/l Tris–HCl pH 8.0; 0.150 mmol/l NaCl; 1% Triton X-100; 100 lg/ml PMSF) and the protein concentration was measured using a BCA protein assay kit (Pierce, Rockford, US). For western blot analysis, 20 lg protein samples were boiled in 5 sample buffer for 10 min and were then resolved by 12% SDS–PAGE. After transferring and blocking, membranes were probed with first and then second antibodies (anti-human CCNL1 (Abcam, Cambridge, USA), anti-human TIMP1 (Abcam, Cambridge, USA), coat anti-mouse antibodies (Santa Cruz, Biotechnology, Santa Cruz, CA). Destination straps were detected by a DAB kit (Bioer Tech, Hangzhou, China). 2.8. Statistical analysis The results are expressed as mean ± standard error (SEM). Statistical analysis was carried out using two-way ANOVA. Where sig-
Table 1 The primers for full-length CCNL1 and TIMP1 cloning.
Notes: The sequences underlined were EcoR I or Hind III restriction sites and the sequence boxed was KOZAK sequence.
346
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
Table 2 The primers and probes for quantitative real-time RT-PCR assay. Gene
Primer and probe
Sequences
The length of production
CCNL1
CF (forward) CR (reverse) CP (probe)
AAGAAGCAGGTCCCGCAGT TGGCTGCATCTGAGTGATCC FTGAAAGCCCTCGAAGACATCATAATCATGGP
179 bp
TIMP1
TF (forward) TR (reverse) TP (probe)
50 -TGGCATCCTGTTGTTGCTGT-30 50 -GGTGGTCTGGTTGACTTCTGGT-30 FCCAGCAGGGCCTGCACCTGTGTP
142 bp
nificant overall differences were detected by ANOVA, the Student’s two-tailed unpaired t-test was used to compare differences between treatments. A p value of less than 0.05 was considered to be significant. We used the statistical analysis program SPSS 10.0. 3. Results 3.1. CCNL1 and TIMP1 are significantly elevated in breast cancer cells From breast cancer tissues of 10 patients, microarray data showed 303 differentially expressed genes (S1A), and among them we found that CCNL1 and TIMP1 expression was simultaneously significantly elevated in breast cancer tissues compared with that in peri-tumor tissues (S1B). These results were further confirmed by quantitative real-time RT-PCR (Fig. 1A and, S1C and D) and western blot (Fig. 1B).
growth of breast cancer cells and may play an important role in breast cancer development. 3.3. CCNL1 inhibits the growth of MDA-MB-231 cells CCNL1 has been shown to be a molecular marker and an oncogene for HNSCC [5]. Interestingly, we also found overexpression of the CCNL1 gene in breast cancer tissues (Fig. 1). To investigate if CCNL1 contributes to breast cancer development, overexpression and repression of CCNL1 were performed in MDA-MB-231 cells. Overexpression of CCNL1 significantly inhibited cell growth, while repression of CCNL1 promoted cell growth (Fig. 2A). The in vivo and in vitro data showed that CCNL1 has a negative effect on breast cancer cell growth and may play an important role in controlling the growth of breast cancer. 3.4. Cell growth is controlled by the expression levels of TIMP1 and CCNL1
3.2. TIMP1 promotes the growth of MDA-MB-231 cells TIMP1 has been shown to have an important role in promoting cell growth of breast cancer [5,6,12,13]. We also found that there was overexpression of the TIMP1 gene in breast cancer tissues (Fig. 1). To confirm TIMP1’s effect on cell growth, overexpression and repression of TIMP1 were performed in MDA-MB-231 cells. Overexpression of TIMP1 significantly promoted cell growth, while repression of TIMP1 had no effect on cell growth (S2A). Our in vivo and in vitro data showed that TIMP1 has a positive effect on the
A
Although CCNL1 had a negative influence on breast cancer cell growth, CCNL1 was also overexpressed in breast cancer tissues (Fig. 1). To determine the relationship between CCNL1 and TIMP1, regulation of the expression of these two genes was performed in MDA-MB-231 cells. When MDA-MB-231 cells were transfected with pcTIMP1 and iCCNL1 together, cell growth was significantly promoted (Fig. 2B). However, when pcCCNL1 and iTIMP1 were transfected into MDA-MB-231 cells together, cell growth was significantly inhibited (Fig. 2B). These data further confirmed the
Cancer tissues M
1T
2T
3T
Peri-tumor tissues
4T
5T
1N
2N
3N
4N
5N CCNL1
TIMP1
B
Cancer tissues
1T
2T
Peri-tumor tissues
1N
2N CCNL1 TIMP1 Actin
Fig. 1. Overexpression of CCNL1 and TIMP1 genes in breast cancer tissues. RT-PCR (A) and western blot (B) assay for the expression of CCNL1 and TIMP1 in breast tumor and peri-tumor tissues of breast cancer patients. The numbers indicate separate breast cancer patients. T, tumor tissue; N, peri-tumor tissue.
347
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
A
stimulatory effect of TIMP1 and inhibitory effect of CCNL1 in breast cancer cells. Not surprisingly, the co-expression of TIMP1 and CCNL1 in MDA-MB-231 cells did not affect cell growth (S2B). Additionally, repression of TIMP1 and CCNL1 in MDA-MB-231 cells did not affect cell growth (S2B).
0.5 MDA-MB- 231 cell with pcCCNL1 MDA-MB- 231 cell with iCCNL1
*
0.4 OD490nm value
MDA-MB- 231 cell without plasmid
*
MDA-MB- 231 cell with pcDNA3.1
0.3
3.5. CCNL1 and TIMP1 regulate the expression of each other
* *
2 0.2 0
*
*
*
6
7
8
01 0.1
0.0 0
1
2
3
4
5
9
Days
B
0.6 MDA-MB- 231 cell with pcCCNL1 and iTIMP1 MDA-MB- 231 cell with iCCNL1 and pcTIMP1
0.5
*
MDA-MB- 231 cell without plasmid
OD490nm value
*
MDA-MB- 231 cell with pcDNA3.1
0.4
*
0.3
* *
*
0.2
4. Discussion
*
0.1
0.0 0
1
2
3
CCNL1 has been reported to regulate gene expression [15]. To determine if these two genes can affect the expression of each other, expression levels of these two genes was measured after transfection of pcCCNL1, pcTIMP1, iCCNL1 and iTIMP1 individually or by combination into MDA-MB-231 cells. Interestingly, overexpression as well as repression of CCNL1 induced the overexpression of TIMP1 in mRNA and protein expression levels (Fig. 3A). Even the expression of TIMP1 was more increased when transfected with iCCNL1 than with pcCCNL1 (Fig. 3A). CCNL1 expression was significantly increased when transfected with iTIMP1. However, the expression of CCNL1 did not change when transfected with pcTIMP1 (Fig. 3B). Interestingly, the expression of TIMP1 and CCNL1 was significantly elevated when co-transfected with pcTIMP1 and pcCCNL1 compared with transfection with pcTIMP1 or pcCCNL1 alone (Fig. 4A and B). These data indicate that the expression levels of CCNL1 and TIMP1 are regulated by each other.
4
Days
5
6
7
8
9
Fig. 2. The growth of MDA-MB-231 cells influenced by regulation of the expression of TIMP1 and/or CCNL1. MTT was used for the growth curve assay and the cells transfected with or without pcDNA3.1 were used as controls. (A) The cell growth was significantly induced by transient transfection of iCCNL1 from day 5 and was significantly inhibited by transient transfection of the pcCCNL1 vector from day 6. (B) The cell growth was significantly induced by simultaneous transient transfection of the iCCNL1 and pcTIMP1 vectors from day 4 and was significantly inhibited by simultaneous transient transfection of the pcCCNL1 vector and iTIMP1 from day 7. The experiment was performed in triplicate and repeated twice. Error bars represent the standard deviation, indicates P < 0.05 by Student’s t-test.
A 100
CCNL1 has been found to be overexpressed in a variety of human cancers, particularly in human head and neck carcinoma. However, no reports have shown overexpression of CCNL1 in breast cancer. Our data showed that CCNL1 was significantly overexpressed in breast carcinoma compared with that in peri-tumor tissues (Fig. 1). More interestingly, our in vitro experiments showed that CCNL1 has a negative effect on cell growth in MDAMB-231 cells (Fig. 2A). We also found similar results in another breast cancer cell line, MCF-7 (data not shown). CCNL1 is stably located in nuclear speckles and the expression level is unchanged through all the processes of the cell cycle. CCNL1’s closely related cyclin family member CCNL-2 migrates and regulates its expression level depending on the period of the cell cycle [13]. These findings indicate that CCNL1 may have a special role in the regulation
B
*
40
Relative expression
Relative expression
* 75
50 * 25
*
30
20
10
0
0
iT
.1
P1 TIM
P1 IM
pc
ne
A3 DN
pc
k
ge Fu
oc M
.1
L1 CN iC 1 NL
CC pc
ne
A3 DN
pc
ge Fu
k oc M
TIMP1 Actin
CCNL1 Actin
Fig. 3. CCNL1 and TIMP1 expression levels in MDA-MB-231 cells. (A) TIMP1 expression was significantly induced when transfected with pcCCNL1 or iCCNL1 as shown by real-time RT-PCR (upper) and western blot (lower) assays. (B) CCNL1 expression was significantly induced when transfected with iTIMP1 as shown by real-time RT-PCR (upper) and western blot (lower) assays. Untreated cells or cells transfected with pcDNA3.1, or FuGENE reagent were used as controls. The experiment was performed in triplicate and repeated twice. Error bars represent the standard deviation, indicates P < 0.05 by Student’s t-test.
348
B 100
15
*
Relative expression
Relative expression
A
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349
10
5
*
75
50
25
0
0
1 NL CC
d an 1 N L P1 CC IM pc pcT
pc
d an 1 N L P1 CC TIM pc pc
P1
M TI
pc
TIMP1
CCNL1
Actin
Actin
Fig. 4. CCNL1 and TIMP1 expression levels in MDA-MB-231 cells. (A) TIMP1 expression was significantly induced when co-transfected with pcCCNL1 and pcTIMP1 compared with transfection with the pcTIMP1 vector alone as shown by real-time RT-PCR (upper) and western blot (lower) assays. (B) CCNL1 expression was significantly induced when co-transfected with pcCCNL1 and pcTIMP1 compared with transfection with the pcCCNL1 vector alone as shown by real-time RT-PCR (upper) and western blot (lower) assays. The experiment was performed in triplicate and repeated twice. Error bars represent the standard deviation, indicates P < 0.05 by Student’s t-test.
of the cell cycle. In contrast to previous reports, our data are the first to show that CCNL1 can negatively regulate cell growth in breast carcinoma, and this provides a new window of opportunity to further investigate the molecular mechanisms of CCNL1 in cell cycle regulation. TIMP1 has been reported to be involved in several cancers, including breast cancer, and it can have positive effects such as stimulation of growth [11] and inhibition of apoptosis [7] Consistent with previous studies, our in vivo and in vitro data also indicate that TIMP1 plays an important role in promoting cell growth of breast cancer (Fig. 1 and S2A). Because our in vitro experiments showed opposite roles of CCNL1 and TIMP1 on the growth of breast cancer cells, the co-transfection of pcCCNL1, pcTIMP1, iCCNL1 and iTIMP1 was performed in MDA-MB-231 breast cancer cells to investigate if there is an interaction between these two genes. Interestingly, co-overexpression or co-repression of CCNL1 and TIMP1 did not affect the growth of MDA-MB-231 cells (S2B). When repression of CCNL1 and overexpression of TIMP1 occurred together, cell growth was more significantly promoted compared with that in transfection of iCCNL1 and pcTIMP1 individually (Fig. 2B). However, when repression of TIMP1 and overexpression of CCNL1 occurred together, cell growth was significantly inhibited, and this effect was weaker than overexpression of CCNL1 alone (Fig. 2B). Moreover, we also achieved similar results with MCF-7 cells (data not shown). These data indicate that there is a close interaction between CCNL1 and TIMP1 in breast cancer cells. It has been reported that CCNL1 contains an RS domain (Ser-Arg rich proteins) that may confer important pre-RNA splicing activity to CCNL1 [2,15]. To determine if CCNL1 and TIMP1 can regulate the expression of each other, CCNL1 and TIMP1 expression was measured after transfection experiments. Interestingly, transfecting MDA-MB-231 cells with iCCNL1 significantly induced TIMP1 expression (Fig. 3). However, transfection of pcTIMP1 did not affect CCNL1 expression (Fig. 3). The co-transfection of iCCNL1 and pcTIMP1 significantly induced the expression of TIMP1, which promotes cell growth. These data can explain why cell growth was more significantly promoted by repression of CCNL1 and overexpression of TIMP1 together. However, when cells were transfected
with iTIMP1 or pcCCNL1, they induced each other’s expression (Fig. 3). This may partly explain why the inhibition effect of cotransfection of iTIMP1 and pcCCNL1 on cell growth was weaker than transfection of pcCCNL1 and stronger than transfection of iTIMP1. More interestingly, with co-overexpression of CCNL1 and TIMP1, the expression of these two genes was considerably induced compared with overexpression of these two genes individually (Fig. 4). In addition, repression of TIMP or CCNL1 induced each other’s expression (Fig. 3). These data may explain why cotransfection of pcTIMP1 and pcCCNL1 or iTIMP1 and iCCNL1 did not affect the growth of MDA-MB-231 cells. Our data suggest that CCNL1 has a negative effect, while TIMP1 has a positive effect on the growth of the breast cancer cells. Moreover, there is a fine balance between the expression of CCNL1 and TIMP1, i.e., the expression levels of these two genes significantly affect each other’s expression. The overexpression of these two genes detected in human breast cancer tissues indicates a fine control of cancer cell growth, which contributes to the development of cancer. Although more detailed molecular mechanisms remain to be elucidated, our results provide new evidence of a negative cell cycle regulation by the function of CCNL1. These findings will contribute to our understanding of cancer biology, and they indicate the important role of CCNL1 in breast cancer development. Acknowledgments This work was supported by a grant from the Chinese Ministry of Science and Technology (Grant No. 2006CB910505) and a grant from the Jilin Provincial Science and Technology Department (Grant Nos. 2003055025 and 20106044). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2011.05.021. References [1] R. Redon, T. Hussenet, G. Bour, K. Caulee, B. Jost, D. Muller, J. Abecassis, S. du Manoir, Amplicon mapping and transcriptional analysis pinpoint cyclin L as a candidate oncogene in head and neck cancer, Cancer Res. 62 (2002) 6211– 6217. [2] L.A. Dickinson, A.J. Edgar, J. Ehley, J.M. Gottesfeld, Cyclin L is an RS domain protein involved in pre-mRNA splicing, J. Biol. Chem. 277 (2002) 25465– 25473. [3] H.H. Chen, Y.C. Wang, M.J. Fann, Identification and characterization of the CDK12/cyclin L1 complex involved in alternative splicing regulation, Mol. Cell. Biol. 26 (2006) 2736–2745. [4] H.H. Chen, Y.H. Wong, A.M. Geneviere, M.J. Fann, CDK13/CDC2L5 interacts with L-type cyclins and regulates alternative splicing, Biochem. Biophys. Res. Commun. 354 (2007) 735–740. [5] C. Sticht, C. Hofele, C. Flechtenmacher, F.X. Bosch, K. Freier, P. Lichter, S. Joos, Amplification of Cyclin L1 is associated with lymph node metastases in head and neck squamous cell carcinoma (HNSCC), Br. J. Cancer 92 (2005) 770–774. [6] D. Muller, R. Millon, S. Théobald, T. Hussenet, B. Wasylyk, S. du Manoir, J. Abecassis, Cyclin L1 (CCNL1) gene alterations in human head and neck squamous cell carcinoma, Br. J. Cancer 94 (2006) 1041–1044. [7] V. Lemaitre, J. D’Armiento, Matrix metalloproteinases in development and disease, Birth Defects Res. C Embryo Today 78 (2006) 1–10. [8] A.H. Baker, D.R. Edwards, G. Murphy, Metalloproteinase inhibitors: biological actions and therapeutic opportunities, J. Cell Sci. 115 (2002) 3719–3727. [9] C.A. Westbrook, J.C. Gasson, S.E. Gerber, M.E. Selsted, D.W. Golde, Purification and characterization of human T-lymphocyte-derived erythroid-potentiating activity, J. Biol. Chem. 259 (1984) 9992–9996. [10] S.A. Jensen, B. Vainer, A. Bartels, N. Brünner, J.B. Sørensen, Expression of matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of metalloproteinases 1 (TIMP-1) by colorectal cancer cells and adjacent stroma cells—associations with histopathology and patients outcome, Eur. J. Cancer 46 (2010) 3233– 3242. [11] D. Inagaki, T. Oshima, K. Yoshihara, S. Tamura, A. Kanazawa, T. Yamada, N. Yamamoto, T. Sato, M. Shiozawa, S. Morinaga, M. Akaike, S. Fujii, K. Numata, C. Kunisaki, Y. Rino, K. Tanaka, M. Masuda, T. Imada, Overexpression of tissue inhibitor of metalloproteinase-1 gene correlates with poor outcomes in colorectal cancer, Anticancer Res. 30 (2010) 4127–4130.
L. Peng et al. / Biochemical and Biophysical Research Communications 409 (2011) 344–349 [12] P. Loyer, J.H. Trembley, J.A. Grenet, A. Busson, A. Corlu, W. Zhao, M. Kocak, V.J. Kidd, J.M. Lahti, Characterization of cyclin L1 and L2 interactions with CDK11 and splicing factors: influence of cyclin L isoforms on splice site selection, J. Biol. Chem. 283 (2008) 7721–7732. [13] A. Herrmann, K. Fleischer, H. Czajkowska, G. Müller-Newen, W. Becker, Characterization of cyclin L1 as an immobile component of the splicing factor compartment, J. FASEB 21 (2007) 3142–3152.
349
[14] S.O. Würtz, A.S. Schrohl, H. Mouridsen, N. Brünner, TIMP-1 as a tumor marker in breast cancer—an update, Acta Oncol. 47 (2008) 580–590. [15] S. Tannukit, X. Wen, H. Wang, M.L. Paine, TFIP11, CCNL1 and EWSR1 protein– protein interactions, and their nuclear localization, Int. J. Mol. Sci. 9 (2008) 1504–1514. [16] M. Kozak, A short leader sequence impairs the fidelity of initiation by eukaryotic ribosomes, Gene Expr. 1 (1991) 111–115.