Reciprocal Activation Between PLK1 and Stat3 Contributes to Survival and Proliferation of Esophageal Cancer Cells

GASTROENTEROLOGY 2012;142:521–530

BASIC AND TRANSLATIONAL—ALIMENTARY TRACT Reciprocal Activation Between PLK1 and Stat3 Contributes to Survival and Proliferation of Esophageal Cancer Cells YU ZHANG,* XIAO–LI DU,* CHENG–JI WANG,‡ DE–CHEN LIN,* XIA RUAN,* YAN–BIN FENG,* YAN–QIU HUO,* HAIYONG PENG,§ JING–LU CUI,* TONG–TONG ZHANG,* YONG–QUAN WANG,* HONGBING ZHANG,§ QI–MIN ZHAN,* and MING–RONG WANG*

BACKGROUND & AIMS: Aberrant activation of the signal transducer and activator of transcription (Stat)3 and overexpression of polo-like kinase (PLK)1 each have been associated with cancer pathogenesis. The mechanisms and significance of dysregulation of Stat3 and PLK1 in carcinogenesis and cancer progression are unclear. We investigated the relationship between Stat3 and PLK1 and the effects of their dysregulation in esophageal squamous cell carcinoma (ESCC) cells. METHODS: We used immunoblot, quantitative reverse-transcription polymerase chain reaction, immunochemistry, chromatin immunoprecipitation, mobility shift, and reporter assays to investigate the relationship between Stat3 and PLK1. We used colony formation, fluorescence-activated cell sorting, terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling, and xenograft tumor assays to determine the effects of increased activation of Stat3 and PLK1 in proliferation and survival of ESCC cells. RESULTS: Stat3 directly activated transcription of PLK1 in esophageal cancer cells and mouse embryonic fibroblast cell NIH3T3. PLK1 then potentiated the expression of Stat3; ␤-catenin was involved in PLK1-dependent transcriptional activation of Stat3. This mutual regulation between Stat3 and PLK1 was required for proliferation of esophageal cancer cells and resistance to apoptosis in culture and as tumor xenografts in mice. Furthermore, phosphorylation of Stat3 and overexpression of PLK1 were correlated in a subset of ESCC. CONCLUSIONS: Stat3 and PLK1 control each other’s transcription in a positive feedback loop that contributes to the development of ESCC. Increased activity of Stat3 and overexpression of PLK1 promote survival and proliferation of ESCC cells in culture and in mice. Keywords: Neoplasm; Signaling; Transcriptional Regulation; Cell Death.

S

ignal transducer and activator of transcription 3 (Stat3) is a latent cytoplasmic transcription factor. In response to extracellular signals, such as cytokines or growth factors, the tyrosine 705 of Stat3 is phosphory-

lated by tyrosine kinases. The activated Stat3 dimers then translocate into the nucleus and regulate the transcription of target genes.1,2 Stat3 is activated constitutively in many types of human cancers and plays crucial roles in regulating tumor cell proliferation, survival, invasion, angiogenesis, and immune evasion, which makes it an attractive therapeutic target.3– 8 Esophageal squamous cell carcinoma (ESCC) is an aggressive malignancy with a poor prognosis. It is ranked as the fourth deadliest cancer in China. Although persistent Stat3 activation has been found in ESCC tissues,9 the molecular mechanism underlying its aberrant activation and the significance of its dysfunction in the disease are largely unknown. Polo-like kinase 1 (PLK1) is a member of the highly conserved serine/threonine protein kinase family. PLK1 is a key regulator of cell division and is also a central player in maintaining genome stability during DNA replication and in modulating the DNA damage response.10 –12 It has been suggested that the deregulation of PLK1 leads to tumorigenesis.13 PLK1 is frequently up-regulated in the vast majority of human tumors but not in healthy, nondividing cells. Overexpression of PLK1 also has been associated with poor prognosis of patients in several tumor types.14,15 Specific smallmolecule inhibitors against PLK1 display prominent antitumor efficacy with minimal side effects in animal models and in clinical trails.15,16 However, the molecular mechanisms responsible for PLK1 overexpression and its role in tumor formation and development remain to be clarified. Abbreviations used in this paper: ChIP, chromatin immunoprecipitation; DN, dominant negative; EGFP, enhanced green fluorescent protein; EMSA, electrophoretic mobility shift assay; ESCC, esophageal squamous cell carcinoma; FITC, fluorescein isothiocyanate; JAK, Janus kinase; p-Stat3, phosphorylated Stat3; PCR, polymerase chain reaction; PLK1, Polo-like kinase 1; SC, subcutaneously; SD, standard deviation; SEM, standard error of mean; shRNA, short hairpin RNA; SIE, sisinducible element; siRNA, small interfering RNA; Stat3, signal transducer and activator of transcription 3; TUNEL, terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling. © 2012 by the AGA Institute 0016-5085/$36.00 doi:10.1053/j.gastro.2011.11.023

BASIC AND TRANSLATIONAL AT

*State Key Laboratory of Molecular Oncology, Cancer Institute (Hospital), §State Key Laboratory of Medical Molecular Biology, Department of Physiology and Pathophysiology, Institute of Basic Medical Sciences and School of Basic Medicine, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing, China; ‡Department of Thorax, Linzhou People’s Hospital, Henan, China

522

ZHANG ET AL

Our earlier work showed that PLK1 overexpression contributes to apoptosis resistance and proliferation in ESCC cells in vitro.17 Constitutively activated Stat3 also is known as a key regulator of cell proliferation and survival. Apparent functional overlap of Stat3 and PLK1 in regulating cell survival and proliferation, together with several potential binding sites of Stat3 found in the promoter of PLK1, prompted us to explore the possible link between Stat3 and PLK1 in their expression and significance in survival and proliferation of ESCC cells.

Materials and Methods Western Blot Analysis Immunoblotting was performed with the primary antibodies against Stat3, phosphorylated Stat3 (p-Stat3) (Tyr705) (Cell Signaling Technology, Danvers, MA), PLK1 (Upstate Biotechnology, Lake Placid, NY), myeloid leukemia-1 (Mcl-1), B-cell lymphoma-extra large (Bcl-xL), green fluorescent protein (GFP), v-myc avian myelocytomatosis viral oncogene homolog (MYC) (Santa Cruz Biotechnology, Santa Cruz, CA), or ␤-catenin (Amart, Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (Kangcheng, Shanghai, China) or ␤-actin (Sigma, St. Louis, MO) was used as a loading control. Signals were visualized with super enhanced chemiluminescence (ECL) detection reagent (Applygen, Beijing, China).

Immunohistochemical Analysis BASIC AND TRANSLATIONAL AT

Tissue microarrays containing 150 primary esophageal tumors and the corresponding normal epithelium were created, and immunohistochemical analysis was performed as described.17,18 Tissue microarrays or tissue slides were incubated with anti-Stat3 antibody, anti–phospho-Stat3 (Tyr705) antibody (Cell Signaling Technology), or anti-PLK1 antibody (Upstate Biotechnology). The results were evaluated separately by 2 independent observers. For p-Stat3, the nuclear staining intensity was graded on the following scales: 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). The evaluation criteria for PLK1 expression have been described previously.17 For an assessment of the proliferation of the subcutaneous (SC) tumors, the tissue sections were immunostained with an anti-Ki67 antibody (Santa Cruz Biotechnology) as described.18

Cell Culture and Treatments Mouse embryonic fibroblast cell line NIH3T3 (American Type Culture Collection) were maintained in Dulbecco’s modified Eagle medium. The human ESCC cell lines KYSE150 and KYSE510 were generously provided by Dr. Y. Shimada (Kyoto University) and cultured in RPMI 1640 medium. All media were supplemented with 10% fetal bovine serum (Invitrogen, San Diego, CA), penicillin (100 U/mL), and streptomycin (100 mg/mL). ESCC cells were incubated with Janus kinase (JAK)/Stat3 inhibitors AG490 (Calbiochem, San Diego, CA), JSI-124 (Sigma), or PLK1 inhibitor BI 2536 (Axon Medchem, Groningen, Netherlands) at the indicated concentrations and times. For synchronization, cells were treated with mimosine (Sigma) or nocodazole (Sigma) to induce arrest at G1 or prometaphase, respectively. Vehicle-treated cells were used as controls. For the animal experiments, BI 2536 was chemically synthesized by WuXi AppTec (Shanghai, China).

Apoptosis Detection Apoptotic cells were double-labeled with either Annexin V–fluorescein isothiocyanate (FITC) and Propidium iodide (PI)

GASTROENTEROLOGY Vol. 142, No. 3

using the rh Annexin V/FITC kit (Bender Medsystem, San Bruno, CA) or R-phycoerythrin (R-PE) Annexin and 7-Aminoactinomycin D (7-AAD) using the ApoScreen Annexin V Apoptosis Kit (Southern Biotech, Birmingham, AL) and were analyzed by flow cytometry. The percentage of Annexin V–positive cells was calculated. Data represent the mean ⫾ standard deviation (SD) obtained from 3 independent experiments. The terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling (TUNEL) assay using the DeadEnd Fluorometric TUNEL System (Promega, Madison, WI) was performed to detect intratumoral apoptosis as described.18 The FITC- deoxyuridine triphosphate (dUTP) was replaced by cy3– (dUTP) in the dUTP mixture, and 4, 6-diamidino-2-phenylindole (DAPI) was used for nuclear staining.

Small Interfering RNA The small interfering RNA (siRNA) target sequences used against human Stat3, PLK1, and ␤-catenin were as follows: 5=-GCAGCAGCTGAACAACATG-3=, 5=-AGATCACCCTCCTTAAATATT-3=, and 5=-GCAGTTGTAAACTTGATTATT-3=, respectively.19,20 A scrambled siRNA sequence, 5=-TTCTCCGAACGTGTCACGT-3=, was used as a negative control. The oligonucleotides were synthesized chemically by GeneChem (Shanghai, China). Stat3 short hairpin RNA (shRNA) and control constructs pGCpGC-Stat3-shRNA (denoted as sh-Stat3) and pGC-scramble, were generated by inserting the corresponding double-stranded oligonucleotides into pGCsi-U6/Neo/GFP (GeneChem).

Transfection Cells were transfected with siRNA and plasmid vectors using Lipofectamine 2000 (Invitrogen). All plasmid construct generation and stable clone selections are described in the Supplementary Materials and Methods section.

Immunofluorescence The expression of PLK1 in the cells was detected with anti-PLK1 antibody (Upstate Biotechnology) followed by incubation with a Cy3-conjugated anti-mouse immunoglobulin (Ig)G (Jackson ImmunoResearch Laboratories, West Grove, PA) as described previously.18 Nuclear DNA was stained with DAPI.

Quantitative Real-Time Reverse-Transcription Polymerase Chain Reaction Total RNA was isolated using the RNeasy Mini kit (Qiagen, Valencia, CA) and complementary DNA (cDNA) was synthesized using the ScriptTM RT Reagent Kit (TaKaRa, Osaka, Japan). Quantitative real-time polymerase chain reaction (PCR) was performed in triplicate using SYBR PremixEx Taq (TaKaRa) on an iCycler (Bio-Rad Laboratories, Hercules, CA). Gene expression levels were normalized to the internal control. Data represent the mean ⫾ standard error of mean (SEM). The primer sequences are provided in Supplementary Table 1.

Chromatin Immunoprecipitation A chromatin immunoprecipitation (ChIP) assay was performed with the EZ-ChIP kit (Upstate Biotechnology). Chromatin samples were immunoprecipitated with an anti–phosphoStat3 (Tyr705) antibody (Cell Signaling Technology). Anti-rabbit IgG (Santa Cruz Biotechnology) was used as a negative control. Precipitated DNA was amplified by PCR using primers provided in Supplementary Table 2. Nonimmunoprecipitated chromatin fragments were used as an input control. LA Taq (TaKaRa) was used to amplify the GC-rich genomic region.

March 2012

Electrophoretic Mobility Shift Assay

523

pershift experiment, nuclear extracts were preincubated with anti-Stat3 antibody (sc-482x; Santa Cruz Biotechnology) or antiStat1 antibody (sc-464x; Santa Cruz Biotechnology), and IgG antibody was used as a negative control. Protein–DNA complexes were detected using the LightShift Chemiluminescent EMSA Kit (Pierce).

Luciferase Reporter Assay A luciferase reporter assay was performed using the Dual-Luciferase Reporter Assay System (Promega). Transfection

BASIC AND TRANSLATIONAL AT

Nuclear extracts were prepared with NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce, Rockford, IL). An electrophoretic mobility shift assay (EMSA) was performed as described.21 The oligonucleotide 5=-CGCGCAGGCTTTTGTAACGTTCCCA-3= (PLK1-sis-inducible element [PLK1-SIE] element is underlined) was labeled with biotin and used as the probe. In competition experiments, 100-fold excess oligonucleotides, including PLK1-SIE, high affinity SIE (hSIE), and irrelevant fos intragenic regulatory element (FIRE),21 were used. For the su-

RECIPROCAL ACTIVATION OF PLK1 AND STAT3

Figure 1. Stat3 is constitutively activated in ESCC and positively regulates PLK1 expression. (A) The expression level of p-Stat3 (Tyr705) in ESCC tissues was detected by immunoblotting (left panel) or immunohistochemistry staining (right panel). T, tumor; N, the corresponding normal epithelia. (B) ESCC cells were serum-starved for 24 hours and then treated with or without 100 ␮mol/L AG490 for 24 hours. Apoptosis was determined by Annexin V–FITC/PI staining (left panel). Data are mean ⫾ SD. **P ⬍ .01. (C) KYSE510 cells were transfected with Stat3-siRNA for 24 hours and then synchronized with or without 400 ng/mL nocodazole for 24 hours. (D) KYSE510 cells were transfected with EGFP-tagged Stat3␤ (Stat3-DN) or empty vector for 48 hours. PLK1 expression was detected by immunofluorescence staining. Representative images are shown. Original magnification, ⫻630 (left panel). The percentage of PLK1 down-regulated cells among the transfected cells in 25 fields chosen randomly from 2 independent experiments were analyzed and plotted (right panel). Data are mean ⫾ SD. ***P ⬍ .001. (E) pBabe-Stat3C or empty vector stably transfected NIH3T3 cells were synchronized with nocodazole for 24 hours. (B, C, and E) The cell lysates were immunoblotted for the indicated proteins. (F) Quantitative reverse-transcription PCR analysis for ESCC cells transfected with Stat3-siRNA (left panel) or NIH3T3 cells stably expressed Stat3C (right panel). Data are mean ⫾ SEM. *P ⬍ .05; **P ⬍ .01.

524

ZHANG ET AL

efficiencies were normalized by co-transfection with a Renilla luciferase expression plasmid pRL-SV40 (Promega). The data are presented as the ratio of firefly luciferase activity to Renilla luciferase activity. The results are presented as the mean ⫾ SD obtained from 3 independent experiments performed in triplicate wells.

Colony Formation Assay The proliferation potential of cells was assessed by plating 500 cells in 6-well plates. After 2 weeks, cells were fixed with methanol and stained with crystal violet. The number of colonies was counted. Data represent the mean ⫾ SD from 3 independent experiments performed in triplicate wells.

Tumorigenicity Assay Log-phase cells were collected and injected SC into the flank regions of 4-week-old female athymic nude mice (Nu/Nu; Vital River, Beijing, China). A total of 2 ⫻ 106 cells were injected

GASTROENTEROLOGY Vol. 142, No. 3

per animal. Five or 6 independent SC experiments were performed for each group. For BI 2536 treatment, nude mice were implanted SC with 2 ⫻ 106 KYSE510 cells. When tumors reached a volume of about 50 mm3, the animals were randomized into treatment and control groups of 5 mice per group. BI 2536 was injected intravenously into the tail vein at the indicated dose and schedule. The SC tumors were measured weekly for 4 weeks, and the tumor volume (mm3) was calculated using the following formula: V ⫽ 1/6␲ ⫻ length ⫻ width2. The mice were killed, and the average weight of tumor tissues was obtained after 4 weeks.

Statistical Analysis Statistical analysis was performed using SPSS program (SPSS Inc, Chicago, IL). Experimental results were evaluated statistically using the Student t test, the Fisher exact test, the Kruskal–Wallis test, the Mann–Whitney test, a 1-way analysis of

BASIC AND TRANSLATIONAL AT

Figure 2. Stat3 activates PLK1 transcription. (A) The schematic diagram depicts 4 putative Stat3 binding sites in the human PLK1 promoter and primers used in the ChIP assay. (B) The ChIP assay was performed using the chromatin prepared from KYSE510 cells. (C) EMSAs with PLK1-SIE probes and nuclear extracts from Stat3C (3C) or empty vector (pB) stably transfected NIH3T3 cells synchronized with nocodazole, as well as ESCC cells treated with or without JSI-124. (D–F) PLK1 transcriptional activity was analyzed using luciferase reporter assay. (D) Schematic diagram of PLK1 reporter constructs. In the pGL3-PLK1-DM construct, the PLK1-SIE core sequence was deleted and is shown as a dashed line. (E) NIH3T3 fibroblasts were cotransfected with Stat3C, Stat3Y705F (YF), and empty vector pBabe along with pGL3-PLK1. The PLK1 promoter activity was measured at 48 hours after transfection. (F) ESCC cells were transfected with pGL3-PLK1 or pGL3-PLK1-DM. At 24 hours after transfection, the cells were synchronized with 100 ␮mol/L mimosine (Mimo) or 400 ng/mL nocodazole (Noco) for 24 hours, and then the PLK1 promoter activity was measured. Data are mean ⫾ SD. ***P ⬍ .001. nsd, no significant difference.

variance test, and the Pearson chi-square test. A P value of less than .05 was considered significant.

Results Stat3 Is Constitutively Activated in ESCC We examined phospho-Stat3 (Tyr705), an activated form of Stat3, in 4 ESCC tumor tissues and corresponding normal epithelial tissues using Western blot analysis. Increased levels of p-Stat3 were detected in 3 of 4 tumor samples (Figure 1A, left panel). Immunohistochemical analysis of the tissue microarrays showed that Stat3 was aberrantly activated in 37% of ESCC samples (48 of 130) and that it was expressed mainly in the nuclei of tumor cells, whereas normal esophageal epithelial tissue had lower levels of p-Stat3 expression (Figure 1A, right panel).

Stat3 Positively Regulates PLK1 Expression Through Direct Transcriptional Activation Blockade of JAK/STAT3 signaling with the JAK inhibitor AG490 led to marked apoptosis and a decrease in p-Stat3 (Tyr705) levels in ESCC cell line KYSE150 and KYSE510 harboring constitutive activation of Stat3 (Figure 1B, and Supplementary Figure 1A). During AG490induced apoptosis, the expression levels of Stat3-targeted antiapoptotic proteins Mcl-1 and Bcl-XL were reduced. Notably, PLK1, which we have found plays an important role in apoptosis resistance of ESCC cells,17 was down-regulated

Figure 3. PLK1 positively regulates Stat3 expression involving ␤-catenin. (A and B) ESCC cells were transfected with PLK1-siRNA for 48 hours. (A) Immunoblotting (left panel) and quantitative reverse-transcription PCR analysis (right panel). Data are mean ⫾ SEM. **P ⬍ .01. (B) Stat3 transcriptional activity was measured using reporter assay. Data are mean ⫾ SD. ***P ⬍ .001. (C) PLK1EGFP or empty vector transiently transfected NIH3T3 cells were synchronized with nocodazole for 24 hours, and then subjected to immunoblotting (left panel) or quantitative reverse-transcription PCR (right panel). Data are mean ⫾ SEM. **P ⬍ .01. (D-F) KYSE510 cells were transfected with (D) PLK1 siRNA, (E) ␤-catenin siRNA, or (F) co-transfected with ␤-catenin S37A mutant or empty vector along with PLK1 siRNA, and then the cell lysates were immunoblotted for the indicated proteins.

RECIPROCAL ACTIVATION OF PLK1 AND STAT3

525

dramatically upon AG490 treatment (Figure 1B, right panel, and Supplementary Figure 1A, right panel). Comparable results were obtained from cells treated with another highly selective inhibitor of the JAK/Stat3 pathway: JSI-124 (cucurbitacin I).22 Tyrosine phosphorylation of Stat3 was suppressed effectively by JSI-124, accompanied with lessened PLK1 expression (Supplementary Figure 1B). Similarly, knockdown of Stat3 by siRNA caused a reduction in PLK1 protein level (Figure 1C, left panel, and Supplementary Figure 1C). The expression level and kinase activity of PLK1 undergo cell-cycle– dependent changes.23 To rule out cell-cycle– dependent effects, we analyzed PLK1 expression using cells arrested at the prometaphase with nocodazole, in which the PLK1 expression level reaches its peak. Consistent with the earlier-described results, down-regulation of PLK1 was detected in the nocodazole-synchronized KYSE510 cells in which Stat3 was depleted by siRNA (Figure 1C, right panel). Furthermore, immunofluorescence analysis confirmed that PLK1 expression was greatly diminished in the KYSE510 cells with nuclear expression of enhanced green fluorescent protein (EGFP)-tagged Stat3-DN (dominant-negative variant of Stat3) at the single-cell level (Figure 1D).21 A reduced PLK1 level also was found in nocodazole-synchronized KYSE150 cells that ectopically expressed Stat3-DN (Supplementary Figure 1D). On the other hand, PLK1 protein expression was reinforced in nocodazole-synchronized NIH3T3 BASIC AND TRANSLATIONAL AT

March 2012

526

ZHANG ET AL

GASTROENTEROLOGY Vol. 142, No. 3

Figure 4. The reciprocal regulation of Stat3 and PLK1 is critical for resistance to apoptosis. (A) KYSE510 cells were transfected with siRNA against Stat3 or PLK1 for 48 hours. (B) KYSE510 cells were transiently transfected with pEGFP-PLK1 or empty vector, and treated with 10 ␮mol/L JSI-124 for 4 hours at 48 hours after transfection. (C) KYSE510 cells stably expressing Stat3C or empty vector were treated with 50 nmol/L BI 2536 for 24 hours. Apoptosis was determined by Annexin V–FITC/PI or Annexin V–PE/7-AAD double staining, and representative results are shown. Data are mean ⫾ SEM. **P ⬍ .01. Stat3 and PLK1 expression were determined by Western blot.

BASIC AND TRANSLATIONAL AT

cells transfected with a constitutively activated Stat3 mutant Stat3C (Figure 1E).24 Given that Stat3 functions as a transcription factor, we then checked whether Stat3 affects PLK1 transcription. Stat3C indeed up-regulated PLK1 messenger RNA (mRNA) level in NIH3T3 cells (Figure 1F, left panel). In contrast, marked reduction of PLK1 mRNA was found in Stat3siRNA–transfected ESCC cells (Figure 1F, right panel). Bioinformatics analysis showed that several potential Stat3 binding sites containing the canonic sequence TT(N)4 – 6AA25 are scattered throughout the human PLK1 promoter region (Figure 2A). Herein, ChIP assay results indicated that p-Stat3 directly bound to the -151/⫹94 bp region of the human PLK1 promoter in vivo, which harbors the core sequence TTTTGTAA (denoted as PLK1-SIE) of putative Stat3-binding site (Figure 2B). Next, we performed EMSAs to evaluate the binding activity of Stat3 to the PLK1-SIE element. A single shift band was observed in the nuclear extracts from Stat3Coverexpressed NIH3T3 cells, but not in the empty vector– transfected NIH3T3 cells. Furthermore, the shift band had disappeared completely by addition of an anti-Stat3 antibody, showing that the binding was Stat3-specific (Figure 2C, lines 1–3). Likewise, robust DNA binding activities were detected in both KYSE510 and KYSE150 cells (Figure 2C, lines 4 and 5). This binding activity was largely abolished by incubating the nuclear extracts of KYSE510 with Stat3 antibody, but not by anti-IgG or anti-Stat1 antibody (Figure 2C, lines 6 – 8), indicating that the majority of the PLK1-SIE binding activity consisted of Stat3 homodimers. Moreover, excess cold PLK1-SIE and hSIE probes, but not an irrelevant FIRE probe, effectively impaired the binding activity in KYSE510 cells, suggesting that the binding is PLK1-SIE specific (Figure 2C, lines

9 –12). In agreement with an earlier finding that JSI-124 can inhibit phosphorylated levels of Stat3,22 a drastic decrease in Stat3-DNA binding activity was observed in nuclear extracts from ESCC cells treated with JSI-124 compared with extracts from vehicle-treated cells (Figure 2C, lines 13–16). To validate that PLK1 is a direct transcriptional target of the Stat3 pathway, we assessed luciferase activity using the PLK1 reporter construct with or without the PLK1-SIE element (Figure 2D). Exogenous expression of Stat3C increased PLK1 reporter activity in a dose-dependent manner in NIH3T3 cells, whereas co-transfection with Stat3Y705F (Stat3-DN) 24 almost completely abrogated this activation (Figure 2E), confirming that transactivation is mediated specifically by Stat3. Moreover, deletion of the PLK1-SIE element significantly attenuated PLK1 promoter activity in Stat3 hyperactivated KYSE150 and KYSE510 cells, regardless of the cells synchronized at the G0/G1 phase with mimosine or prometaphase with nocodazole, in conjunction with the earlier-described observations, suggesting that the PLK1-SIE element is a functional Stat3 binding site and plays a pivotal role in PLK1 transcription activation (Figure 2F).

PLK1 Positively Regulates Stat3 Expression Involving ␤-Catenin To dissect whether PLK1 could stimulate Stat3 expression as well, we inhibited PLK1 expression using siRNA. As a result, protein and mRNA expression of Stat3 as well as p-Stat3 level were reduced in PLK1-depleted ESCC cells KYSE150 and KYSE510 (Figure 3A). In addition, PLK1 knockdown led to a significant decrease in Stat3 transcriptional activity in ESCC cells (Figure 3B). Furthermore, ectopic PLK1 expression enhanced the mRNA and

protein levels of Stat3 in NIH3T3 cells (Figure 3C). Taken together, these data indicate that PLK1 can positively activate Stat3 expression. To further explore the relevant molecular mechanism, we determined the role of ␤-catenin in PLK1-dependent Stat3 transcriptional activation. We confirmed that ␤-catenin protein level was decreased on PLK1 knockdown (Figure 3D), and ␤-catenin depletion by siRNA down-regulated the Stat3 expression in KYSE510 cells (Figure 3E). Then, we found that enforced expression of a constitutive activated mutant of ␤-catenin (S37A) indeed increased Stat3 expression level in PLK1 ablated KYSE510 cells, showing that ␤-catenin is involved in the PLK1-activated Stat3 transcription (Figure 3F).

Reciprocal Activation Between Stat3 and PLK1 Is Critical for Resistance of ESCC Cells to Apoptosis Based on the aforementioned observations, we focused on the biological significance of the reciprocal regulation mechanism between Stat3 and PLK1. Consistent with the results of inhibitor treatment and our previous data,17 depletion of Stat3 or PLK1 with siRNA drastically induced apoptosis as compared with that measured in parental or nonsilencing siRNA-transfected KYSE510 cells (Figure 4A). After that, we observed that overexpression of Figure 5. Disruption of PLK1 activity suppresses the growth of ESCC xenografts. (A) Immunostaining analysis for ESCC cells treated with or without 50 nmol/L BI 2536 for 24 hours. (B) Colony formation assays with KYSE510 cells exposed to 50 nmol/L BI 2536 or vehicle for only one time. Representative results are shown. (C and D) Nude mice bearing established KYSE510 xenograft tumors (average volume, ⬃50 mm3) were treated with 50 mg/kg BI 2536 or vehicle control twice weekly on 2 consecutive days for 4 cycles (n ⫽ 5 per group). (C) Tumor volumes were measured weekly and data are mean ⫾ SEM. **P ⬍ .01; ***P ⬍ .001. (D) Tumor weight was quantified at 4 weeks after drug administration. (E and F) KYSE510 xenograft tumors were excised from nude mice treated with 50 mg/kg BI 25636 or vehicle control for 48 hours. (E) Tumor lysates were immunoblotted for the indicated proteins. (F) Immunohistochemistry staining of PLK1 and Stat3 in SC tumor tissues sections Original magnification, ⫻400. Degree of intratumoral proliferation was determined by Ki67 staining, and apoptosis was measured by TUNEL assay Original magnification, ⫻200.

RECIPROCAL ACTIVATION OF PLK1 AND STAT3

527

PLK1 significantly protected KYSE510 cells from apoptosis induced by interruption of Stat3 activation with JSI124 (Figure 4B). Likewise, enforced Stat3C expression also markedly reversed the PLK1 inhibitor BI 2536 induced apoptosis in KYSE510 cells (Figure 4C).

Functional Interplay of Stat3 and PLK1 Contributes to Tumorigenicity of ESCC Cells We used the adenosine triphosphate competitive small-molecule inhibitor of PLK1, BI 2536, to assess the contribution of active PLK1 to tumorigenesis of ESCC. In accordance with the effect of PLK1 knockdown on Stat3, treatment with 50 nmol/L BI 2536 for 24 hours led to reduction of both p-Stat3 and total Stat3 levels in ESCC cells, even though the PLK1 level was increased partially owing to G2/M phase arrest (Figure 5A). BI 2536 –treated KYSE510 cells formed no colonies in vitro (Figure 5B). Furthermore, tail vein injection of 50 mg/kg BI 2536 for 4 weeks resulted in complete regression of KYSE510 xenograft tumor in vivo, whereas all vehicle-treated control animals showed progressive disease (Figure 5C and D). Western blot and immunohistochemical analysis showed that PLK1, Stat3, and p-Stat3 levels were decreased in KYSE510 xenografts after BI 2536 treatment for 48 hours (Figure 5E and F). Concurrently,

BASIC AND TRANSLATIONAL AT

March 2012

528

ZHANG ET AL

GASTROENTEROLOGY Vol. 142, No. 3

BASIC AND TRANSLATIONAL AT

Figure 6. The functional interaction of Stat3 and PLK1 contributes to tumorigenicity of KYSE510 cells. KYSE510 cells stably expressing Stat3-shRNA (sh-Stat3) were infected with pLXIN-PLK1-hyg (shStat3-PLK1) or empty vector pLXIN-hyg (sh-Stat3-Vec), and KYSE510 cells stably expressing scrambled shRNA (Ctrl) infected with empty vector pLXIN-hyg (Ctrl-Vec) were used as control. (A) Immunoblotting analysis for cells treated with 100 ␮mol/L mimosine for 24 hours. (B) Colony formation assays. Representative results are shown and colony number was plotted. Data are mean ⫾ SD. nsd, no significant difference. (C–E) The stable clone cells were implanted SC into athymic mice (Nu/Nu) (n ⫽ 5 per group), and SC tumors were excised at 4 weeks after inoculation. (C) Photograghs of SC tumors are shown and tumor weight was quantified. (D) Tumor lysates were immunoblotted for the indicated proteins. (E) Immunohistochemistry staining of Stat3 and PLK1 in SC tumor tissue sections Original magnification, ⫻400. Degree of intratumoral proliferation was determined by Ki67 staining, and apoptosis was detected by TUNEL assay Original magnification, ⫻200.

attenuated proliferation and massive apoptosis were revealed by Ki67 staining and TUNEL assay performed in SC tumor sections (Figure 5E and F). Subsequently, we investigated the effects of mutual interaction of deregulated Stat3 and PLK1 on tumorigenicity of ESCC cells. Knockdown of Stat3 expression by shRNA (sh-Stat3) in KYSE510 cells reduced total Stat3, p-Stat3, and PLK1 expression levels, proliferation potential in vitro, and tumorigenicity in vivo (Figure 6A–D). In addition, suppression of proliferation and enhancement of apoptosis were detected in the SC tumor tissues derived from Sh-Stat3 cells (Figure 6E). Notably, enforced PLK1 expression markedly restored the expression and activity of Stat3 in Stat3-depleted cells, which also re-instated their proliferation capability in vitro (Figure 6A and B). As expected, impaired tumorigenicity and diminished protein levels of Stat3 and PLK1 were significantly reverted by exogenous PLK1 expression in vivo (Figure 6C–E). Moreover, ectopically expressed PLK1 also protected cells from the suppression of proliferation and survival caused by Stat3 abrogation in SC tumor tissues (Figure 6E).

Constitutive Stat3 Activation Correlates With PLK1 Overexpression in ESCC Immunohistochemical staining for p-Stat3 (Tyr705) and PLK1 was performed using sequential sections from the same tissue microarrays. Among the 116 ESCC specimens in which p-Stat3 and PLK1 expression level could be evaluated simultaneously, 37% (43 of 116) of tumors showed positive staining for p-Stat3 in the nucleus, and 68% (79 of 116) of the samples showed PLK1 immunoreactivity in the nucleus and cytoplasm. Overexpression of both p-Stat3 and PLK1 was observed in 30% of ESCC, and none of these 2 proteins presented positive staining in 25% of tumors. PLK1 was overexpressed in 81% (35 of 43) of ESCC with Stat3 hyperactivation, whereas Stat3 was activated in 44% (35 of 79) of PLK1-overexpressed cases. Statistical analysis revealed a significant positive correlation between the expression of pStat3 and PLK1 (Table 1 and Supplementary Figure 2).

Discussion We present here that a positive reciprocal regulation exists between Stat3 and PLK1, thus providing insights into

RECIPROCAL ACTIVATION OF PLK1 AND STAT3

Table 1. Stat3 Phosphorylation Positively Correlates With PLK1 Expression in ESCC PLK1 p-Stat3

Negative

Positive

Total

Negative Positive Total

29 8 37

44 35 79

73 43 116

NOTE. P ⫽ .018, Pearson chi-square (2-sided).

the molecular mechanism underlying the dysregulation of Stat3 and PLK1 in ESCC cells. Furthermore, the functional interplay between Stat3 and PLK1 contributes to the pathogenesis of ESCC by promoting cell survival and proliferation. These findings are supported by a significant correlation between Stat3 activation and PLK1 overexpression in primary ESCC. PLK1 is considered a functional node in tumor formation and progression.26 To date, the mechanism through which PLK1 expression is regulated has not been studied extensively. Our previous results showed that only 37% of tumors with PLK1 overexpression show gene amplification in ESCC,17 suggesting that other mechanisms might be responsible for its increased expression. In this study, PLK1 was overexpressed in 81% of ESCC with Stat3 hyperactivation. In support of the potential interaction between PLK1 and Stat3, ChIP, EMSA, and reporter assay illustrated that Stat3 directly activates PLK1 transcription through binding to the PLK1-SIE element in the PLK1 promoter. Collectively, our data indicate that PLK1 is a novel Stat3 target gene and its overexpression may be at least partially owing to Stat3 excessive activation in ESCC. In the present study, we showed that PLK1 up-regulated Stat3 expression as well, which suggests that PLK1 is also a positive regulator of Stat3 expression. It has been reported that ␤-catenin can transcriptionally activate Stat3 expression.9 In addition, our most recent data suggested that PLK1 can stabilize the ␤-catenin protein level by protecting it from proteasomal degradation.27 Accordingly, we speculated that ␤-catenin might participate in the PLK1-mediated Stat3 transcriptional activation in ESCC cells. Indeed, overexpression of a constitutive activated ␤-catenin mutant (S37A) restored the Stat3 expression level that is impaired by PLK1 knockdown. Therefore, we identified an essential regulation loop connecting PLK1, ␤-catenin, and Stat3 in ESCC cells. It is widely recognized that cancer is a class of highly complex diseases with substantial heterogeneity owing to enormous genomic and epigenetic alterations as well as various environmental settings among different individuals.28,29 Even though overexpressed PLK1 was found in 81% of the ESCC specimens with Stat3 hyperactivation in our study, Stat3 was activated in only 44% of PLK1 overexpressed cases, suggesting that additional regulatory mechanisms of PLK1 expression other than Stat3 transcriptional activation may exist. In contrast to the direct transcriptional activation of PLK1 by Stat3, PLK1 indi-

529

rectly potentiates Stat3 through ␤-catenin and other unknown molecules. Disruption of the regulatory cascade from PLK1 to Stat3 during tumor development may partially contribute to the higher frequency of PLK1 overexpression than the rate of Stat3 activation in ESCC tissues. Inhibition of either Stat3 or PLK1 alone led to an increase in apoptosis and a significant decrease in proliferation in ESCC cells both in vitro and in vivo, indicating that dysfunction of either Stat3 or PLK1 contributes to the malignant manifestations of ESCC cells. Because expression of exogenous PLK1 significantly reversed the suppression of cell proliferation and survival imposed by abrogation of Stat3 activity, functional interaction of Stat3 and PLK1 may be critical for tumorigenicity of ESCC cells. Our results suggest that the reciprocal activation mechanism between PLK1 and Stat3 signaling may represent a positive regulatory circuit that mutually reinforces the PLK1 expression and Stat3 activity to further augment the proliferation and survival of ESCC cells. Consistent with observations at the cellular level, 30% of the ESCC tissues examined in this study were double positive for PLK1 overexpression and aberrant Stat3 activation. The positive reciprocal regulation between PLK1 and Stat3 thus may play a critical role in the development of a subset of human ESCC. In the present study, the blockade of Stat3 or PLK1 activity significantly suppressed the proliferation, cell survival, and tumorigenicity of ESCC cells, suggesting that Stat3 and PLK1 have potential as therapeutic targets for ESCC treatment. As a selective inhibitor of JAK/Stat3 signaling, JSI-124 has shown significant antiproliferative activity in several tumor cells both in vivo and in vitro.8,22 Likewise, BI 2536 has potent efficacy and good tolerability in various human cancer xenograft models as well as in the phase I clinical trials and currently is being evaluated in multiple phase II trials.15,16,30 Our data suggest that BI 2536 also may hold great promise for the treatment of ESCC. Furthermore, the combined inhibition of Stat3 and PLK1 might exert a synergistic anti-ESCC effect. In summary, our study shows a positive regulatory loop between Stat3 and PLK1. Aberrantly activated Stat3 and increased PLK1 expression may contribute to esophageal tumorigenesis by promoting malignant proliferation and cell survival. Further studies should be performed to explore the efficacy of disruption of the regulatory network between Stat3 and PLK1 in targeted therapy for ESCC with aberrant Stat3 activation or PLK1 expression.

Supplementary Materials Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at www.gastrojournal.org, and at doi: 10.1053/j.gastro.2011.11.023. References 1. Ihle JN. STATs: signal transducers and activators of transcription. Cell 1996;84:331–334. 2. Darnell JE Jr. STATs and gene regulation. Science 1997;277: 1630 –1635.

BASIC AND TRANSLATIONAL AT

March 2012

530

ZHANG ET AL

BASIC AND TRANSLATIONAL AT

3. Bromberg J. Stat proteins and oncogenesis. J Clin Invest 2002; 109:1139 –1142. 4. Levy DE, Lee CK. What does Stat3 do? J Clin Invest 2002;109: 1143–1148. 5. Yu H, Jove R. The STATs of cancer—new molecular targets come of age. Nat Rev Cancer 2004;4:97–105. 6. Huang S. Regulation of metastases by signal transducer and activator of transcription 3 signaling pathway: clinical implications. Clin Cancer Res 2007;13:1362–1366. 7. Yu H, Kortylewski M, Pardoll D. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol 2007;7:41–51. 8. Yue P, Turkson J. Targeting STAT3 in cancer: how successful are we? Expert Opin Investig Drugs 2009;18:45–56. 9. Yan S, Zhou C, Zhang W, et al. Beta-catenin/TCF pathway upregulates STAT3 expression in human esophageal squamous cell carcinoma. Cancer Lett 2008;271:85–97. 10. Petronczki M, Lenart P, Peters JM. Polo on the rise-from mitotic entry to cytokinesis with Plk1. Dev Cell 2008;14:646 – 659. 11. Takaki T, Trenz K, Costanzo V, et al. Polo-like kinase 1 reaches beyond mitosis— cytokinesis, DNA damage response, and development. Curr Opin Cell Biol 2008;20:650 – 660. 12. Archambault V, Glover DM. Polo-like kinases: conservation and divergence in their functions and regulation. Nat Rev Mol Cell Biol 2009;10:265–275. 13. Lu LY, Yu X. The balance of Polo-like kinase 1 in tumorigenesis. Cell Div 2009;4:4. 14. Eckerdt F, Yuan J, Strebhardt K. Polo-like kinases and oncogenesis. Oncogene 2005;24:267–276. 15. Strebhardt K, Ullrich A. Targeting polo-like kinase 1 for cancer therapy. Nat Rev Cancer 2006;6:321–330. 16. Schoffski P. Polo-like kinase (PLK) inhibitors in preclinical and early clinical development in oncology. Oncologist 2009;14:559 –570. 17. Feng YB, Lin DC, Shi ZZ, et al. Overexpression of PLK1 is associated with poor survival by inhibiting apoptosis via enhancement of survivin level in esophageal squamous cell carcinoma. Int J Cancer 2009;124:578 –588. 18. Zhang Y, Feng YB, Shen XM, et al. Exogenous expression of esophagin/SPRR3 attenuates the tumorigenicity of esophageal squamous cell carcinoma cells via promoting apoptosis. Int J Cancer 2008;122:260 –266. 19. Gao L, Zhang L, Hu J, et al. Down-regulation of signal transducer and activator of transcription 3 expression using vector-based small interfering RNAs suppresses growth of human prostate tumor in vivo. Clin Cancer Res 2005;11:6333– 6341. 20. Liu X, Lei M, Erikson RL. Normal cells, but not cancer cells, survive severe Plk1 depletion. Mol Cell Biol 2006;26:2093–2108.

GASTROENTEROLOGY Vol. 142, No. 3 21. Epling-Burnette PK, Liu JH, Catlett-Falcone R, et al. Inhibition of STAT3 signaling leads to apoptosis of leukemic large granular lymphocytes and decreased Mcl-1 expression. J Clin Invest 2001; 107:351–362. 22. Blaskovich MA, Sun J, Cantor A, et al. Discovery of JSI-124 (cucurbitacin I), a selective Janus kinase/signal transducer and activator of transcription 3 signaling pathway inhibitor with potent antitumor activity against human and murine cancer cells in mice. Cancer Res 2003;63:1270 –1279. 23. Uchiumi T, Longo DL, Ferris DK. Cell cycle regulation of the human polo-like kinase (PLK) promoter. J Biol Chem 1997;272:9166–9174. 24. Bromberg JF, Wrzeszczynska MH, Devgan G, et al. Stat3 as an oncogene. Cell 1999;98:295–303. 25. Aaronson DS, Horvath CM. A road map for those who don’t know JAK-STAT. Science 2002;296:1653–1655. 26. Strebhardt K. Multifaceted polo-like kinases: drug targets and antitargets for cancer therapy. Nat Rev Drug Discov 2010;9:643– 660. 27. Lin D, Zhang Y, Pan Q, et al. PLK1 is transcriptionally activated by NF-{kappa}B during cell detachment and enhances anoikis resistance through inhibiting {beta}-catenin degradation in esophageal cancer. Clin Cancer Res 2011;17:4285– 4295. 28. Chin L, Andersen JN, Futreal PA. Cancer genomics: from discovery science to personalized medicine. Nat Med 2011;17:297–303. 29. Lander ES. Initial impact of the sequencing of the human genome. Nature 2011;470:187–197. 30. Steegmaier M, Hoffmann M, Baum A, et al. BI 2536, a potent and selective inhibitor of polo-like kinase 1, inhibits tumor growth in vivo. Curr Biol 2007;17:316 –322.

Received July 15, 2011. Accepted November 8, 2011. Reprint requests Address requests for reprints to: Ming-Rong Wang, PhD, State Key Laboratory of Molecular Oncology, Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing 100021, China. e-mail: [email protected]; fax: (86) 1087778651. Conflicts of interest The authors disclose no conflicts. Funding Supported by a Chinese Hi-Tech R&D Program grant (2009AA022706) and the National Natural Science Foundation (30971482 and 81021061).

March 2012

Supplementary Materials and Methods Plasmid Constructs The full-length human PLK1 coding region was amplified from normal esophageal mucosa total cDNA using the forward primer: 5=-CCGCTCGAGGGAGATGAGTGCTGCAGTGAC-3= with an Xho I site, and the reverse primer: 5=-CCGGAATTCCTATTAGGAGGCCTTGAGACGG-3= with an EcoR I site. The amplified sequence was inserted into the pEGFP-C1 (BD Biosciences Clontech, Palo Alto, CA) to generate pEGFP-PLK1. The PLK1 coding sequence also was amplified by PCR using the forward primer: 5=-CCGCTCGAGGGAGCATGAGTGCTGCAGTGAC-3= with an Xho I site, and the reverse primer: 5=-ATTTGCGGCCGCCTATTAGGAGGCCTTGAGACGG-3= with a Not I site. The amplified sequence was subcloned into the pLXIN-hyg (BD Biosciences Clontech) to generate pLXIN-PLK1-hyg. The pSG5-Stat3␤ construct, which expresses a human DN isoform of Stat3 (denoted as Stat3-DN),1 was generously provided by Dr P. K. Epling-Burnette (H. Lee Moffitt Cancer Center and Research Institute, University of South Florida College of Medicine, Tampa, Florida).2 The Stat3␤ coding sequence was subcloned into the pEGFP-C1 to generate pEGFP-Stat3␤ by PCR amplification using the forward primer: 5=-CGAGCTCCCCCTGATTTTAGCAGGATGG-3= with a Sac I site and the reverse primer: 5=-GCGGGCCCTAGGCGCCTCAGTCGTATCT-3= with an Apa I site. Plasmid vectors of pBabeStat3C (constitutively activated Stat3 mutant) and pBabe-Stat3Y705F (Stat3-DN of mouse origin) as well as pBabe were provided by Dr J. Bromberg as generous gifts (Memorial Sloan-Kettering Cancer Center, New York, NY).3 Plasmid vector of pcDNA3.1-␤-catenin S37A-myc (constitutively activated ␤-catenin mutant) was kindly provided by Professor Ning-Zhi Xu (Cancer Institute [Hospital], Peking Union Medical College, Beijing, China).4 The putative Stat3 binding site TTTTGTAA (-21 to -14, denoted as PLK1-SIE in this article) in the human PLK1 promoter region (-151 to ⫹94) was amplified by

RECIPROCAL ACTIVATION OF PLK1 AND STAT3

530.e1

PCR using the forward primer: 5=-CGAGCTCCCGTGTCAATCAGGTTTTCC-3= and the reverse primer: 5=CCAAGCTTAGTCACTGCAGCACTCATGC-3=. The amplified sequence was cloned into pGL3-Basic (Promega) to generate the luciferase reporter plasmid pGL3-PLK1. The deletion mutant pGL3-PLK1-DM was derived from pGL3-PLK1 by deleting the core PLK1-SIE sequence (Figure 2D). The numbers listed for the PLK1 promoter region indicate the nucleotide position relative to the transcriptional initiation site.5 The luciferase reporter plasmid pGL3-Stat3, which contains the Stat3 promoter fragment, also was supplied by Professor Ning-Zhi Xu.4 All constructs were confirmed by sequencing.

Stable Transfectants Selection pBabe-Stat3C or pBabe constructs were transfected into NIH3T3 cells, and transfectants were selected with 2 ␮g/mL puromycin (Sigma). pGC-sh-Stat3 or pGCscramble constructs were transfected into KYSE510 cells, and stable clones were selected with 200 ␮g/mL G418 (Invitrogen). pLXIN-PLK1-hyg or pLXIN-hyg was infected into the Stat3 knockdown cells or control cells, and the stable transfectants were selected with 25 ␮g/mL Hygromycin (Calbiochem). (Supplementary Tables 1 and 2). References 1. Caldenhoven E, van Dijk TB, Solari R, et al. STAT3beta, a splice variant of transcription factor STAT3, is a dominant negative regulator of transcription. J Biol Chem 1996;271:13221–13227. 2. Epling-Burnette PK, Liu JH, Catlett-Falcone R, et al. Inhibition of STAT3 signaling leads to apoptosis of leukemic large granular lymphocytes and decreased Mcl-1 expression. J Clin Invest 2001; 107:351–362. 3. Bromberg JF, Wrzeszczynska MH, Devgan G, et al. Stat3 as an oncogene. Cell 1999;98:295–303. 4. Yan S, Zhou C, Zhang W, et al. Beta-catenin/TCF pathway upregulates STAT3 expression in human esophageal squamous cell carcinoma. Cancer Lett 2008;271:85–97. 5. Uchiumi T, Longo DL, Ferris DK. Cell cycle regulation of the human polo-like kinase (PLK) promoter. J Biol Chem 1997;272:9166 –9174.

530.e2

ZHANG ET AL

GASTROENTEROLOGY Vol. 142, No. 3

Supplementary Figure 1. Blockade of JAK/Stat3 signaling induces apoptosis accompanied with PLK1 down-regulation in ESCC cells. (A) KYSE150 and KYSE510 cells were serum-starved for 24 hours and then treated with or without 100 ␮mol/L AG490 for 24 hours. Apoptosis was determined by Annexin V–FITC/PI staining and representative results are shown (left panel). (B) KYSE510 cells were treated with 10 ␮mol/L JSI-124 for 4 hours. (C) KYSE150 cells were transfected with Stat3-siRNA for 48 hours. (D) KYSE150 cells were transiently transfected with pEGFP-Stat3-DN (Stat3␤) or empty vector. At 24 hours after transfection, the cells were synchronized with nocodazole for 24 hours. (A–D) Stat3, p-Stat3 (Tyr705), and PLK1 protein levels were detected by immunoblotting.

Supplementary Figure 2. Stat3 phosphorylation positively correlates with PLK1 expression in ESCC tissues. Representative results of p-Stat3 (Tyr705) and PLK1 immunostaining in sequential sections from the same tissue microarray. Original magnification, ⫻200. T35 (negative), T20 (moderate), and T87 (strong) are the case numbers.

March 2012

RECIPROCAL ACTIVATION OF PLK1 AND STAT3

Supplementary Table 1. Primer Sequences for Quantitative Reverse-Transcription PCR Analysis Gene Human Stat3 Human PLK1 Human GAPDH Mouse Stat3 Mouse PLK1 Mouse ␤-actin

Direction

Sequence (5=¡3=)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

ACCAGCAGTATAGCCGCTTC GCCACAATCCGGGCAATCT CGAGGACAACGACTTCGTGTT ACAATTTGCCGTAGGTAGTATCG CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT CACCTTGGATTGAGAGTCAAGAC AGGAATCGGCTATATTGCTGGT AGTGACTTGCTACAGCAGCTGACCA CCCACTTGCTGACCCAGAAGATGG AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT

NOTE. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or ␤-actin was amplified as an internal control.

530.e3