- Email: [email protected]
A Li-Fraumeni syndrome family with retained heterozygosity for a germline TP53 mutation in two tumors
Cancer Genetics and Cytogenetics 145 (2003) 60–64
A Li-Fraumeni syndrome family with retained heterozygosity for a germline TP53 mutation in two tumors Marie Trkovaa, Lenka Foretovab, Roman Kodetc, Petra Hedvicakovaa, Zdenek Sedlaceka,* a
Institute of Biology and Medical Genetics, Second Medical School, Charles University, Prague, Czech Republic b Division of Cancer Genetics and Epidemiology, Masaryk Memorial Cancer Institute, Brno, Czech Republic c Institute of Pathology and Molecular Medicine, Second Medical School, Charles University, Prague, Czech Republic Received 25 November 2002; received in revised form 10 January 2003; accepted 14 January 2003
Abstract
We identified a missense germline mutation (Gly245Ser) in one of the mutation hot spots of the TP53 gene in two affected members of a Li-Fraumeni syndrome family. We also analyzed their tumors, a liposarcoma and a colorectal carcinoma. Both tumors exhibited p53 protein accumulation but none of them showed loss of the wild-type allele of the TP53 gene. We reviewed all published cases of tumors in germline TP53 mutation carriers where loss of heterozygosity data were available and identified 84 tumors with loss of the wild-type allele, 57 tumors with retention of heterozygosity, and 9 tumors with loss of the allele harboring the germline mutation. Among the tumors showing p53 accumulation, we observed a significant difference in the fraction of tumors showing p53 protein accumulation between the tumors with loss of the wild-type allele and those with retention of TP53 heterozygosity. This supports the idea that the pathogenesis of tumors in germline TP53 mutation carriers does not have to be associated with loss of the wild-type TP53 allele. The product of the normal allele can potentially be inactivated by a variety of other mechanisms or, as suggested by the analysis, many of these tumors may even preserve the activity of the wild-type p53 protein. 쑖 2003 Elsevier Inc. All rights reserved.
1. Introduction A rare dominant and highly penetrant cancer predisposition syndrome leading to familial clustering of soft-tissue sarcomas, osteosarcomas, brain tumors, leukemia, adrenocortical tumors, and premenopausal breast cancer was first described in 1969 [1]. The disorder, now termed Li-Fraumeni syndrome (LFS), is diagnosed using strict clinical criteria [2], and is caused in the majority of cases by germline mutations in tumor suppressor gene TP53 coding the p53 protein [3,4]. Rare germline mutations have also been described in LFS in the CHK2 gene, which codes a checkpoint kinase acting in the same pathway upstream of the p53 protein [5]. Recent data suggest that leukemia may be a less common manifestation in germline TP53 mutation carriers [6,7], and that about one quarter of cancers in families with germline TP53 mutations fall outside of the group of the six classic component tumors of LFS [6].
* Corresponding author. Institute of Biology and Medical Genetics, Second Medical School, Charles University, V uvalu 84, 15006 Prague, Czech Republic. Tel.: ⫹420-224435995; fax ⫹420-224435994. E-mail address: [email protected] (Z. Sedlacek). 0165-4608/03/$ – see front matter 쑖 2003 Elsevier Inc. All rights reserved. doi: 10.1016/S0165-4608(03)00031-1
According to the classical two-hit hypothesis [8], tumors develop in carriers of germline mutations in tumor suppressor genes after inactivation of the single functional allele of the gene in a somatic cell. While the first hit (the germline mutation) is often a point mutation in the respective gene, the second hit is usually a partial deletion or total loss of the homologous chromosome, and can be observed as loss of heterozygosity (LOH) for the gene and nearby DNA markers. It has been known for a long time that the TP53 gene often shows LOH in sporadic tumors [9,10]. The analysis of a limited series of tumors from germline TP53 mutation carriers indicated, however, that the wild-type allele was lost in only about one half of the tumors [11,12]. In this report we describe a study of two tumors in a LiFraumeni syndrome family. We have found that none of the tumors has lost the wild-type p53 allele. This prompted us to review all the tumors described in germline TP53 mutation carriers compiled in the Database of Germline p53 Mutations [13]. We show that the wild-type TP53 allele is very often retained in these tumors, and based on p53 protein stability data, we argue that in some of the tumors it may continue to produce functional p53 protein.
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
2. Materials and methods 2.1. Family A cancer family with extended pedigree asked for counseling at the Masaryk Memorial Cancer Institute. The spectrum of tumors, early age of cancer onset, and autosomal dominant inheritance pattern (Fig. 1) were strongly suggestive of the Li-Fraumeni syndrome. The cancer diagnoses were confirmed from pathology reports. After obtaining informed consent from the individuals concerned, we performed DNA testing in three family members, two affected females (II.7 and II.8) and one asymptomatic female with 50% risk (II.4). Archival tumor material was available from liposarcoma of II.7 and colorectal carcinoma of II.8.
61
heterozygosity at the site of the germline mutation and for the analysis of p53 protein accumulation in tumors of published germline mutation carriers. For the study of influence of mutation type on the above phenomena, the germline mutations were divided into two groups: the first group consisted of missense mutations and small in-frame deletions, and the second group included nonsense and splicing mutations and frameshift deletions. The data were statistically evaluated using Fisher’s exact test, except for the comparisons of age of tumor onset, which were evaluated using the Mann-Whitney test.
3. Results
2.2. TP53 gene and p53 protein analysis
3.1. The germline TP53 mutation in the family
Isolation of genomic DNA from peripheral blood lymphocytes and from archival paraffin-embedded tumor samples, amplification of exons 5–9 of the TP53 gene, and direct sequencing of the PCR products as well as p53 protein immunohistochemistry with the DO-7 antibody (Dako) were performed as described [12]. Amplification of partly degraded archival tumor DNA around the site of the germline TP53 mutation was possible using primers e7F and c245B (GAGTCTTCCAGTGTGATGATGG), which generated a shorter PCR product. The polymorphism in codon 72 of the TP53 gene was amplified using primers c72F (TGGTTCACTGAAGACCCAGGTC) and c72B (GGAAGGGACAGAAGATGACAGG).
A heterozygous TP53 mutation in codon 245 in exon 7, which changes GGC→AGC and results in glycine-to-serine amino acid substitution (Gly245Ser), was identified initially by direct sequencing of PCR products in patient II.8 (Fig. 2). The same mutation was then also found in her affected sister, II.7, and her unaffected maternal halfsister, II.4. Analysis of the Arg72Pro polymorphism in exon 4 of the TP53 gene showed that both II.7 and II.8 were heterozygous.
2.3. Database analysis and statistics The January 2002 version of the Database of Germline p53 Mutations [13] was used for the analysis of loss of
3.2. TP53 Gly245Ser mutation and Arg72Pro polymorphism status and p53 protein accumulation in tumors Archival tumor samples from the liposarcoma of patient II.7 and colorectal carcinoma of II.8 were tested by DNA analysis for zygosity of the Gly245Ser mutation and
Fig. 1. Pedigree of the family. Filled symbols represent individuals with tumors. Types of tumors and the age of onset in years (in parentheses) are indicated. Stars represent individuals analyzed.
62
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
p53 protein revealed strong positivity in the majority of tumor cells (Fig. 3A). The stromal cells, such as endothelial cells and pericytes, were negative. The colorectal tumor of patient II.8 was at stage T3, grade III (World Health Organization), tubular adenocarcinoma changing with depth into a solid trabecular adenocarcinoma (Fig. 3B). Sequencing revealed a heterozygous pattern both at the site of the germline mutation and in codon 72 of the TP53 gene. About 50%–60% of tumor cell nuclei were moderately-to-strongly stained using the anti-p53 antibody while the surrounding normal tissue was negative (Fig. 3B).
3.3. LOH at the site of germline mutation in tumors of published mutation carriers
Fig. 2. Nucleotide and deduced amino acid sequences of codons 244–246 around the germline TP53 mutation in a normal control and in the peripheral blood of individual II.8.
Arg72Pro polymorphism. Both tumors were analyzed by immunohistochemistry for p53 protein accumulation. The liposarcoma of patient II.7 consisted of myxoid matrix intertwined by a plexiform network of capillaries. Foci of polygonal and fusiform cells, multivacuolated lipoblasts, and more mature adipocytes were also present (Fig. 3A). Sequencing of parts of exons 4 and 7 of the TP53 gene from the tumor DNA showed retention of heterozygosity both at the site of the germline mutation and in codon 72 (data not shown). Immunohistochemical detection of the
The January 2002 version of the Database of Germline p53 Mutations contained records of 977 tumors; in 150 of these, the zygosity at the site of the germline mutation was reported. Loss of the wild-type (LWT) allele was observed in 84 tumors (56%), 57 tumors (38%) retained heterozygosity at the site of the germline mutation (RHZ), and 9 tumors (6%) showed loss of the mutated allele (LM). The three groups of tumors differed significantly in their fraction, which showed accumulation of the p53 protein in tumor cells. Protein stability data were available for 29 tumors from the LWT group and only two of them (7%) did not accumulate the p53 protein. On the contrary, of 18 tumors studied from the RHZ group, 7 (39%) were not positive for the anti-p53 antibody. This difference was statistically significant (P ⫽ 0.018). Six of the nine tumors from the LM category were analyzed immunohistochemically, and all were positive.
Fig. 3. (A) Immunohistochemical detection of the p53 protein in the myxoid liposarcoma of II.7. A representative microscopic field showing poorly differentiated mesenchymal cells in a myxoid stroma with nuclei positive with anti-p53 antibody (darkly stained, LSAB+ visualizing system with DAB, Dako). Lipoblast with multivacuolated cytoplasm is well seen near the center. The cells forming vessels are negative. To show the outlines of the tissue pattern the section was lightly counterstained with hematoxylin. (B) Immunohistochemical detection of the p53 protein in the tubular adenocarcinoma of the colon of II.8. The figure shows an irregular glandular pattern of an infiltrating tumor in the newly formed stroma (a portion of the tumor infiltrating the submucosa). The tumor cell nuclei are variably stained with anti-p53 antibody as is seen by the various shades of the dark precipitate. Some tumor cell nuclei are only lightly stained by the haematoxylin counterstain. Stromal cells of the intertwined fibrous tissue and endothelial cells of the capillaries are negative.
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
When the types of germline TP53 mutations were compared among the three groups of tumors above, the LWT group had a higher proportion of truncating mutations (19/84 [23%]) than the RHZ group (7/57 [12%]), but this difference was not statistically significant (P ⫽ 0.125). All tumors in the LM group were found in carriers of missense germline TP53 mutations. The spectra of primary tumor sites did not differ significantly among the LWT, RHZ, and LM groups, with the possible exception of gastric cancer, which was more represented in the RHZ group (5/57 [9%]) than in the LWT group (1/84 [1%]; P ⫽ 0.040). The numbers of various tumors were too low, however, to allow reliable comparisons. Similarly, we failed to observe any differences in the age of tumor onset or in the spectra of mutated TP53 codons between tumors of the LWT and RHZ groups.
4. Discussion Analysis of the TP53 gene revealed a germline mutation in codon 245 in the index patient and two additional members of the family described in this report. The mutation is in one of the CpG dinucleotide–containing mutation hot spots in the TP53 gene. Codon 245 is together with codon 175 the third most frequently mutated codon of the TP53 gene in germline mutation carriers. Both of these codons were reportedly mutated in 10 independent families, while codons 273 and 248 were mutated in 19 and 21 families, respectively [13]. Of the 10 mutations affecting codon 245, the substitution GGC→AGC (Gly245Ser) observed in our family was the most frequent and occurred in 8 of the 10 reported families. The mutation was found to lead to loss of p53 function in vitro both by the apoptotic assay and by the yeast-based transactivation assay [14]. Although the present family conforms to the strict criteria of the Li-Fraumeni syndrome, the index patient suffered from colorectal cancer, which is not a typical tumor for this disorder [2,6,7]. There are only 25 occurrences of this tumor among the 977 cancers reported in families with germline TP53 mutations. While the mean age of tumor onset in these families is 32.0 years for all tumors, the colorectal cancers appear significantly later, at 43.3 years (P ⫽ 0.025). This is much earlier, however, than the mean onset of sporadic tumors of this type (~70 years of age). The mean age of onset of colorectal carcinoma is 37.8 years in confirmed and obligatory TP53 mutation carriers and 49.2 years in family members with unknown mutation status, indicating that tumors in some of the individuals with unknown mutation status may be phenocopies. The analysis of the TP53 codons 245 (germline mutation) and 72 (common polymorphism) in both the liposarcoma and the colorectal tumor in our family showed that both tumors retained heterozygosity for the wild-type TP53 allele. In previous studies, LOH was observed in only 44–50% of tumors in germline TP53 mutation carriers [11,12]. Our
63
analysis of 150 tumors published up until now showed that a total of only 56% of tumors in germline TP53 mutation carriers lost the wild-type allele and were hemi- or homozygous for the germline mutation, while 38% of tumors retained the wild-type allele. It must be emphasized that the retention of heterozygosity observed in two codons of the TP53 gene does not imply that the other TP53 allele in the tumor was not mutated by a different independent point mutation or other small-extent DNA defect. As the tumor’s genetic constitution was analyzed on archival material in most studies published so far, searching for this potential second mutation in the TP53 gene was often difficult or impossible. The analysis of the p53 protein accumulation in these tumors, however, argues against this mechanism. There was a significantly higher fraction of tumors with no p53 protein accumulation in the group of tumors with retention of TP53 heterozygosity compared with those with loss of the wild-type allele: 39% in the former and 7% in the latter group. As coexpression of wild-type p53 protein was shown to promote destabilization of the mutant p53 protein [15], the above difference supports the idea that the tumors retaining heterozygosity at the site of the germline TP53 mutation may in fact preserve the activity of the wild-type p53 protein. The difference in the fraction of tumors showing loss of the wild-type allele between carriers of missense and truncating germline TP53 mutations was not statistically significant in our study. We did, however, observe a trend described earlier of truncating mutations being associated more often with loss of the wild-type allele and missense mutations being associated with retention of heterozygosity, which may reflect the gain-of-function or dominant-negative nature of the missense mutations [16]. In accordance with this hypothesis, all tumors that retained heterozygosity but showed p53 protein accumulation were found in carriers of missense germline TP53 mutations (11 tumors in the database and the tumors described here), while none of the tumors retaining heterozygosity for truncating mutations showed p53 protein accumulation. Finally, nine tumors in germline TP53 mutation carriers reported in the literature (the remaining 6% of tumors) had lost the allele carrying the germline TP53 mutation. Of these, six tumors were analyzed immunohistochemically and all showed p53 protein accumulation in tumor cells. The analysis of the genetic constitution of tumors in the present family and of other tumors published in germline TP53 mutation carriers clearly indicated that the development of tumors in these individuals often may be based on a mechanism of the TP53 gene silencing other than a simple loss of the homologous chromosomal segment carrying the wild-type allele. It is possible that a second independent mutation, an epigenetic alteration, or a DNA defect not disclosed by sequence analysis of the coding region of the TP53 gene can inactivate the wild-type allele without causing loss of heterozygosity at the site of the germline mutation. Alternatively, the expression of the wild-type allele can be preserved in the tumor, but its activity can be blocked by
64
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
the gain-of-function or dominant-negative effect of the mutated allele. In an alternative scenario, the activity of the protein product of the wild-type allele can be abolished by another mechanism such as binding to viral oncogenes, degradation by excess of MDM2, incorrect posttranslational modification, impaired interaction with other proteins, or mislocalization within the cell [17]. All the mechanisms mentioned above may act both in the tumors retaining heterozygosity and in those showing loss of the germline mutation. It may be possible, however, that none of the above phenomena is effective and that tumor development is caused only by the reduced dose of the p53 protein [18]. The effects of haploinsufficiency of the TP53 gene in some tumors of human germline TP53 mutation carriers may relate to a similar situation in tumors in the p53⫹/⫺ mice (with no dominantnegative mutations), where about 50% of tumors show loss of the wild-type allele and 50% retain heterozygosity with no independent mutation on the active allele [19]. The complex behavior of the wild-type TP53 allele in tumors of germline TP53 mutation carriers and its possible dependence on the type of the germline mutation may be of importance for prognosis and for targeted therapeutic interventions in these individuals.
Acknowledgments We thank the Laboratory of Functional Genomics and Proteomics, Masaryk University, Brno, for DNA sequencing. This work was supported by grant NC/6513-3 from the Internal Grant Agency of the Ministry of Health of the Czech Republic.
References [1] Li FP, Fraumeni JF. Soft-tissue sarcomas, breast cancer and other neoplasms: a familial syndrome? Ann Intern Med 1969;71:747–52. [2] Li FP, Fraumeni JF, Mulvihill JJ, Blattner WA, Dreyfus MG, Tucker MA, Miller RW. A cancer family syndrome in twenty-four kindreds. Cancer Res 1988;48:5358–62. [3] Malkin D, Li FP, Strong LC, Fraumeni JF, Nelson CE, Kim DH, Kassel J, Gryka MA, Bischoff FZ, Tainsky MA, Friend SH. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas and other neoplasms. Science 1990;250:1233–8. [4] Srivastava S, Zou Z, Pirollo K, Blattner W, Chang EH. Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 1990;348:747–9.
[5] Bell DW, Varley JM, Szydlo TE, Kang DH, Wahrer DC, Shannon KE, Lubratovich M, Verselis SJ, Isselbacher KJ, Fraumeni JF, Birch JM, Li FP, Garber JE, Haber DA. Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome. Science 1999; 286:2528–31. [6] Nichols KE, Malkin D, Garber JE, Fraumeni JF Jr, Li FP. Germ-line p53 mutations predispose to a wide spectrum of early-onset cancers. Cancer Epidemiol Biomarkers Prev 2001;10:83–7. [7] Birch JM, Alston RD, McNally RJ, Evans DG, Kelsey AM, Harris M, Eden OB, Varley JM. Relative frequency and morphology of cancers in carriers of germline TP53 mutations. Oncogene 2001; 20:4621–8. [8] Knudson AG Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 1971;68:820–3. [9] Baker SJ, Fearon ER, Nigro JM, Hamilton SR, Preisinger AC, Jessup JM, vanTuinen P, Ledbetter DH, Barker DF, Nakamura Y, White R, Vogelstein B. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science 1989;244:217–21. [10] Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T, Collins FS, Weston A, Modali R, Harris CC, Vogelstein B. Mutations in the p53 gene occur in diverse human tumour types. Nature 1989; 342:705–8. [11] Varley JM, Thorncroft M, McGown G, Appleby J, Kelsey AM, Tricker KJ, Evans DG, Birch JM. A detailed study of loss of heterozygosity on chromosome 17 in tumours from Li-Fraumeni patients carrying a mutation to the TP53 gene. Oncogene 1997;14:865–71. [12] Sedlacek Z, Kodet R, Seemanova E, Vodvarka P, Wilgenbus P, Mares J, Poustka A, Goetz P. Two Li-Fraumeni syndrome families with novel germline p53 mutations: loss of the wild-type p53 allele in only 50% of tumours. Br J Cancer 1998;77:1034–9. [13] Sedlacek Z, Kodet R, Poustka A, Goetz P. A database of germline p53 mutations in cancer-prone families. Nucleic Acids Res 1998;26214–5; Available at: http://www.lf2.cuni.cz/projects/germline_mut_p53.htm. Accessed June 15, 2002. [14] Camplejohn RS, Sodha N, Gilchrist R, Lomax ME, Duddy PM, Miner C, Alarcon-Gonzalez P, Barnes DM, Eeles RA. The value of rapid functional assays of germline p53 status in LFS and LFL families. Br J Cancer 2000;82:1145–8. [15] Nagata Y, Anan T, Yoshida T, Mizukami T, Taya Y, Fujiwara T, Kato H, Saya H, Nakao M. The stabilization mechanism of mutant-type p53 by impaired ubiquitination: the loss of wild-type p53 function and the hsp90 association. Oncogene 1999;18:6037–49. [16] Birch JM, Blair V, Kelsey AM, Evans DG, Harris M, Tricker KJ, Varley JM. Cancer phenotype correlates with constitutional TP53 genotype in families with the Li-Fraumeni syndrome. Oncogene 1998;17:1061–8. [17] Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature 2000;408:307–10. [18] Cook WD, McCaw BJ. Accommodating haploinsufficient tumor suppressor genes in Knudson’s model. Oncogene 2000;19:3434–8. [19] Venkatachalam S, Shi YP, Jones SN, Vogel H, Bradley A, Pinkel D, Donehower LA. Retention of wild-type p53 in tumors from p53 heterozygous mice: reduction of p53 dosage can promote cancer formation. EMBO J 1998;17:4657–67.
A Li-Fraumeni syndrome family with retained heterozygosity for a germline TP53 mutation in two tumors Marie Trkovaa, Lenka Foretovab, Roman Kodetc, Petra Hedvicakovaa, Zdenek Sedlaceka,* a
Institute of Biology and Medical Genetics, Second Medical School, Charles University, Prague, Czech Republic b Division of Cancer Genetics and Epidemiology, Masaryk Memorial Cancer Institute, Brno, Czech Republic c Institute of Pathology and Molecular Medicine, Second Medical School, Charles University, Prague, Czech Republic Received 25 November 2002; received in revised form 10 January 2003; accepted 14 January 2003
Abstract
We identified a missense germline mutation (Gly245Ser) in one of the mutation hot spots of the TP53 gene in two affected members of a Li-Fraumeni syndrome family. We also analyzed their tumors, a liposarcoma and a colorectal carcinoma. Both tumors exhibited p53 protein accumulation but none of them showed loss of the wild-type allele of the TP53 gene. We reviewed all published cases of tumors in germline TP53 mutation carriers where loss of heterozygosity data were available and identified 84 tumors with loss of the wild-type allele, 57 tumors with retention of heterozygosity, and 9 tumors with loss of the allele harboring the germline mutation. Among the tumors showing p53 accumulation, we observed a significant difference in the fraction of tumors showing p53 protein accumulation between the tumors with loss of the wild-type allele and those with retention of TP53 heterozygosity. This supports the idea that the pathogenesis of tumors in germline TP53 mutation carriers does not have to be associated with loss of the wild-type TP53 allele. The product of the normal allele can potentially be inactivated by a variety of other mechanisms or, as suggested by the analysis, many of these tumors may even preserve the activity of the wild-type p53 protein. 쑖 2003 Elsevier Inc. All rights reserved.
1. Introduction A rare dominant and highly penetrant cancer predisposition syndrome leading to familial clustering of soft-tissue sarcomas, osteosarcomas, brain tumors, leukemia, adrenocortical tumors, and premenopausal breast cancer was first described in 1969 [1]. The disorder, now termed Li-Fraumeni syndrome (LFS), is diagnosed using strict clinical criteria [2], and is caused in the majority of cases by germline mutations in tumor suppressor gene TP53 coding the p53 protein [3,4]. Rare germline mutations have also been described in LFS in the CHK2 gene, which codes a checkpoint kinase acting in the same pathway upstream of the p53 protein [5]. Recent data suggest that leukemia may be a less common manifestation in germline TP53 mutation carriers [6,7], and that about one quarter of cancers in families with germline TP53 mutations fall outside of the group of the six classic component tumors of LFS [6].
* Corresponding author. Institute of Biology and Medical Genetics, Second Medical School, Charles University, V uvalu 84, 15006 Prague, Czech Republic. Tel.: ⫹420-224435995; fax ⫹420-224435994. E-mail address: [email protected] (Z. Sedlacek). 0165-4608/03/$ – see front matter 쑖 2003 Elsevier Inc. All rights reserved. doi: 10.1016/S0165-4608(03)00031-1
According to the classical two-hit hypothesis [8], tumors develop in carriers of germline mutations in tumor suppressor genes after inactivation of the single functional allele of the gene in a somatic cell. While the first hit (the germline mutation) is often a point mutation in the respective gene, the second hit is usually a partial deletion or total loss of the homologous chromosome, and can be observed as loss of heterozygosity (LOH) for the gene and nearby DNA markers. It has been known for a long time that the TP53 gene often shows LOH in sporadic tumors [9,10]. The analysis of a limited series of tumors from germline TP53 mutation carriers indicated, however, that the wild-type allele was lost in only about one half of the tumors [11,12]. In this report we describe a study of two tumors in a LiFraumeni syndrome family. We have found that none of the tumors has lost the wild-type p53 allele. This prompted us to review all the tumors described in germline TP53 mutation carriers compiled in the Database of Germline p53 Mutations [13]. We show that the wild-type TP53 allele is very often retained in these tumors, and based on p53 protein stability data, we argue that in some of the tumors it may continue to produce functional p53 protein.
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
2. Materials and methods 2.1. Family A cancer family with extended pedigree asked for counseling at the Masaryk Memorial Cancer Institute. The spectrum of tumors, early age of cancer onset, and autosomal dominant inheritance pattern (Fig. 1) were strongly suggestive of the Li-Fraumeni syndrome. The cancer diagnoses were confirmed from pathology reports. After obtaining informed consent from the individuals concerned, we performed DNA testing in three family members, two affected females (II.7 and II.8) and one asymptomatic female with 50% risk (II.4). Archival tumor material was available from liposarcoma of II.7 and colorectal carcinoma of II.8.
61
heterozygosity at the site of the germline mutation and for the analysis of p53 protein accumulation in tumors of published germline mutation carriers. For the study of influence of mutation type on the above phenomena, the germline mutations were divided into two groups: the first group consisted of missense mutations and small in-frame deletions, and the second group included nonsense and splicing mutations and frameshift deletions. The data were statistically evaluated using Fisher’s exact test, except for the comparisons of age of tumor onset, which were evaluated using the Mann-Whitney test.
3. Results
2.2. TP53 gene and p53 protein analysis
3.1. The germline TP53 mutation in the family
Isolation of genomic DNA from peripheral blood lymphocytes and from archival paraffin-embedded tumor samples, amplification of exons 5–9 of the TP53 gene, and direct sequencing of the PCR products as well as p53 protein immunohistochemistry with the DO-7 antibody (Dako) were performed as described [12]. Amplification of partly degraded archival tumor DNA around the site of the germline TP53 mutation was possible using primers e7F and c245B (GAGTCTTCCAGTGTGATGATGG), which generated a shorter PCR product. The polymorphism in codon 72 of the TP53 gene was amplified using primers c72F (TGGTTCACTGAAGACCCAGGTC) and c72B (GGAAGGGACAGAAGATGACAGG).
A heterozygous TP53 mutation in codon 245 in exon 7, which changes GGC→AGC and results in glycine-to-serine amino acid substitution (Gly245Ser), was identified initially by direct sequencing of PCR products in patient II.8 (Fig. 2). The same mutation was then also found in her affected sister, II.7, and her unaffected maternal halfsister, II.4. Analysis of the Arg72Pro polymorphism in exon 4 of the TP53 gene showed that both II.7 and II.8 were heterozygous.
2.3. Database analysis and statistics The January 2002 version of the Database of Germline p53 Mutations [13] was used for the analysis of loss of
3.2. TP53 Gly245Ser mutation and Arg72Pro polymorphism status and p53 protein accumulation in tumors Archival tumor samples from the liposarcoma of patient II.7 and colorectal carcinoma of II.8 were tested by DNA analysis for zygosity of the Gly245Ser mutation and
Fig. 1. Pedigree of the family. Filled symbols represent individuals with tumors. Types of tumors and the age of onset in years (in parentheses) are indicated. Stars represent individuals analyzed.
62
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
p53 protein revealed strong positivity in the majority of tumor cells (Fig. 3A). The stromal cells, such as endothelial cells and pericytes, were negative. The colorectal tumor of patient II.8 was at stage T3, grade III (World Health Organization), tubular adenocarcinoma changing with depth into a solid trabecular adenocarcinoma (Fig. 3B). Sequencing revealed a heterozygous pattern both at the site of the germline mutation and in codon 72 of the TP53 gene. About 50%–60% of tumor cell nuclei were moderately-to-strongly stained using the anti-p53 antibody while the surrounding normal tissue was negative (Fig. 3B).
3.3. LOH at the site of germline mutation in tumors of published mutation carriers
Fig. 2. Nucleotide and deduced amino acid sequences of codons 244–246 around the germline TP53 mutation in a normal control and in the peripheral blood of individual II.8.
Arg72Pro polymorphism. Both tumors were analyzed by immunohistochemistry for p53 protein accumulation. The liposarcoma of patient II.7 consisted of myxoid matrix intertwined by a plexiform network of capillaries. Foci of polygonal and fusiform cells, multivacuolated lipoblasts, and more mature adipocytes were also present (Fig. 3A). Sequencing of parts of exons 4 and 7 of the TP53 gene from the tumor DNA showed retention of heterozygosity both at the site of the germline mutation and in codon 72 (data not shown). Immunohistochemical detection of the
The January 2002 version of the Database of Germline p53 Mutations contained records of 977 tumors; in 150 of these, the zygosity at the site of the germline mutation was reported. Loss of the wild-type (LWT) allele was observed in 84 tumors (56%), 57 tumors (38%) retained heterozygosity at the site of the germline mutation (RHZ), and 9 tumors (6%) showed loss of the mutated allele (LM). The three groups of tumors differed significantly in their fraction, which showed accumulation of the p53 protein in tumor cells. Protein stability data were available for 29 tumors from the LWT group and only two of them (7%) did not accumulate the p53 protein. On the contrary, of 18 tumors studied from the RHZ group, 7 (39%) were not positive for the anti-p53 antibody. This difference was statistically significant (P ⫽ 0.018). Six of the nine tumors from the LM category were analyzed immunohistochemically, and all were positive.
Fig. 3. (A) Immunohistochemical detection of the p53 protein in the myxoid liposarcoma of II.7. A representative microscopic field showing poorly differentiated mesenchymal cells in a myxoid stroma with nuclei positive with anti-p53 antibody (darkly stained, LSAB+ visualizing system with DAB, Dako). Lipoblast with multivacuolated cytoplasm is well seen near the center. The cells forming vessels are negative. To show the outlines of the tissue pattern the section was lightly counterstained with hematoxylin. (B) Immunohistochemical detection of the p53 protein in the tubular adenocarcinoma of the colon of II.8. The figure shows an irregular glandular pattern of an infiltrating tumor in the newly formed stroma (a portion of the tumor infiltrating the submucosa). The tumor cell nuclei are variably stained with anti-p53 antibody as is seen by the various shades of the dark precipitate. Some tumor cell nuclei are only lightly stained by the haematoxylin counterstain. Stromal cells of the intertwined fibrous tissue and endothelial cells of the capillaries are negative.
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
When the types of germline TP53 mutations were compared among the three groups of tumors above, the LWT group had a higher proportion of truncating mutations (19/84 [23%]) than the RHZ group (7/57 [12%]), but this difference was not statistically significant (P ⫽ 0.125). All tumors in the LM group were found in carriers of missense germline TP53 mutations. The spectra of primary tumor sites did not differ significantly among the LWT, RHZ, and LM groups, with the possible exception of gastric cancer, which was more represented in the RHZ group (5/57 [9%]) than in the LWT group (1/84 [1%]; P ⫽ 0.040). The numbers of various tumors were too low, however, to allow reliable comparisons. Similarly, we failed to observe any differences in the age of tumor onset or in the spectra of mutated TP53 codons between tumors of the LWT and RHZ groups.
4. Discussion Analysis of the TP53 gene revealed a germline mutation in codon 245 in the index patient and two additional members of the family described in this report. The mutation is in one of the CpG dinucleotide–containing mutation hot spots in the TP53 gene. Codon 245 is together with codon 175 the third most frequently mutated codon of the TP53 gene in germline mutation carriers. Both of these codons were reportedly mutated in 10 independent families, while codons 273 and 248 were mutated in 19 and 21 families, respectively [13]. Of the 10 mutations affecting codon 245, the substitution GGC→AGC (Gly245Ser) observed in our family was the most frequent and occurred in 8 of the 10 reported families. The mutation was found to lead to loss of p53 function in vitro both by the apoptotic assay and by the yeast-based transactivation assay [14]. Although the present family conforms to the strict criteria of the Li-Fraumeni syndrome, the index patient suffered from colorectal cancer, which is not a typical tumor for this disorder [2,6,7]. There are only 25 occurrences of this tumor among the 977 cancers reported in families with germline TP53 mutations. While the mean age of tumor onset in these families is 32.0 years for all tumors, the colorectal cancers appear significantly later, at 43.3 years (P ⫽ 0.025). This is much earlier, however, than the mean onset of sporadic tumors of this type (~70 years of age). The mean age of onset of colorectal carcinoma is 37.8 years in confirmed and obligatory TP53 mutation carriers and 49.2 years in family members with unknown mutation status, indicating that tumors in some of the individuals with unknown mutation status may be phenocopies. The analysis of the TP53 codons 245 (germline mutation) and 72 (common polymorphism) in both the liposarcoma and the colorectal tumor in our family showed that both tumors retained heterozygosity for the wild-type TP53 allele. In previous studies, LOH was observed in only 44–50% of tumors in germline TP53 mutation carriers [11,12]. Our
63
analysis of 150 tumors published up until now showed that a total of only 56% of tumors in germline TP53 mutation carriers lost the wild-type allele and were hemi- or homozygous for the germline mutation, while 38% of tumors retained the wild-type allele. It must be emphasized that the retention of heterozygosity observed in two codons of the TP53 gene does not imply that the other TP53 allele in the tumor was not mutated by a different independent point mutation or other small-extent DNA defect. As the tumor’s genetic constitution was analyzed on archival material in most studies published so far, searching for this potential second mutation in the TP53 gene was often difficult or impossible. The analysis of the p53 protein accumulation in these tumors, however, argues against this mechanism. There was a significantly higher fraction of tumors with no p53 protein accumulation in the group of tumors with retention of TP53 heterozygosity compared with those with loss of the wild-type allele: 39% in the former and 7% in the latter group. As coexpression of wild-type p53 protein was shown to promote destabilization of the mutant p53 protein [15], the above difference supports the idea that the tumors retaining heterozygosity at the site of the germline TP53 mutation may in fact preserve the activity of the wild-type p53 protein. The difference in the fraction of tumors showing loss of the wild-type allele between carriers of missense and truncating germline TP53 mutations was not statistically significant in our study. We did, however, observe a trend described earlier of truncating mutations being associated more often with loss of the wild-type allele and missense mutations being associated with retention of heterozygosity, which may reflect the gain-of-function or dominant-negative nature of the missense mutations [16]. In accordance with this hypothesis, all tumors that retained heterozygosity but showed p53 protein accumulation were found in carriers of missense germline TP53 mutations (11 tumors in the database and the tumors described here), while none of the tumors retaining heterozygosity for truncating mutations showed p53 protein accumulation. Finally, nine tumors in germline TP53 mutation carriers reported in the literature (the remaining 6% of tumors) had lost the allele carrying the germline TP53 mutation. Of these, six tumors were analyzed immunohistochemically and all showed p53 protein accumulation in tumor cells. The analysis of the genetic constitution of tumors in the present family and of other tumors published in germline TP53 mutation carriers clearly indicated that the development of tumors in these individuals often may be based on a mechanism of the TP53 gene silencing other than a simple loss of the homologous chromosomal segment carrying the wild-type allele. It is possible that a second independent mutation, an epigenetic alteration, or a DNA defect not disclosed by sequence analysis of the coding region of the TP53 gene can inactivate the wild-type allele without causing loss of heterozygosity at the site of the germline mutation. Alternatively, the expression of the wild-type allele can be preserved in the tumor, but its activity can be blocked by
64
M. Trkova et al. / Cancer Genetics and Cytogenetics 145 (2003) 60–64
the gain-of-function or dominant-negative effect of the mutated allele. In an alternative scenario, the activity of the protein product of the wild-type allele can be abolished by another mechanism such as binding to viral oncogenes, degradation by excess of MDM2, incorrect posttranslational modification, impaired interaction with other proteins, or mislocalization within the cell [17]. All the mechanisms mentioned above may act both in the tumors retaining heterozygosity and in those showing loss of the germline mutation. It may be possible, however, that none of the above phenomena is effective and that tumor development is caused only by the reduced dose of the p53 protein [18]. The effects of haploinsufficiency of the TP53 gene in some tumors of human germline TP53 mutation carriers may relate to a similar situation in tumors in the p53⫹/⫺ mice (with no dominantnegative mutations), where about 50% of tumors show loss of the wild-type allele and 50% retain heterozygosity with no independent mutation on the active allele [19]. The complex behavior of the wild-type TP53 allele in tumors of germline TP53 mutation carriers and its possible dependence on the type of the germline mutation may be of importance for prognosis and for targeted therapeutic interventions in these individuals.
Acknowledgments We thank the Laboratory of Functional Genomics and Proteomics, Masaryk University, Brno, for DNA sequencing. This work was supported by grant NC/6513-3 from the Internal Grant Agency of the Ministry of Health of the Czech Republic.
References [1] Li FP, Fraumeni JF. Soft-tissue sarcomas, breast cancer and other neoplasms: a familial syndrome? Ann Intern Med 1969;71:747–52. [2] Li FP, Fraumeni JF, Mulvihill JJ, Blattner WA, Dreyfus MG, Tucker MA, Miller RW. A cancer family syndrome in twenty-four kindreds. Cancer Res 1988;48:5358–62. [3] Malkin D, Li FP, Strong LC, Fraumeni JF, Nelson CE, Kim DH, Kassel J, Gryka MA, Bischoff FZ, Tainsky MA, Friend SH. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas and other neoplasms. Science 1990;250:1233–8. [4] Srivastava S, Zou Z, Pirollo K, Blattner W, Chang EH. Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 1990;348:747–9.
[5] Bell DW, Varley JM, Szydlo TE, Kang DH, Wahrer DC, Shannon KE, Lubratovich M, Verselis SJ, Isselbacher KJ, Fraumeni JF, Birch JM, Li FP, Garber JE, Haber DA. Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome. Science 1999; 286:2528–31. [6] Nichols KE, Malkin D, Garber JE, Fraumeni JF Jr, Li FP. Germ-line p53 mutations predispose to a wide spectrum of early-onset cancers. Cancer Epidemiol Biomarkers Prev 2001;10:83–7. [7] Birch JM, Alston RD, McNally RJ, Evans DG, Kelsey AM, Harris M, Eden OB, Varley JM. Relative frequency and morphology of cancers in carriers of germline TP53 mutations. Oncogene 2001; 20:4621–8. [8] Knudson AG Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 1971;68:820–3. [9] Baker SJ, Fearon ER, Nigro JM, Hamilton SR, Preisinger AC, Jessup JM, vanTuinen P, Ledbetter DH, Barker DF, Nakamura Y, White R, Vogelstein B. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science 1989;244:217–21. [10] Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T, Collins FS, Weston A, Modali R, Harris CC, Vogelstein B. Mutations in the p53 gene occur in diverse human tumour types. Nature 1989; 342:705–8. [11] Varley JM, Thorncroft M, McGown G, Appleby J, Kelsey AM, Tricker KJ, Evans DG, Birch JM. A detailed study of loss of heterozygosity on chromosome 17 in tumours from Li-Fraumeni patients carrying a mutation to the TP53 gene. Oncogene 1997;14:865–71. [12] Sedlacek Z, Kodet R, Seemanova E, Vodvarka P, Wilgenbus P, Mares J, Poustka A, Goetz P. Two Li-Fraumeni syndrome families with novel germline p53 mutations: loss of the wild-type p53 allele in only 50% of tumours. Br J Cancer 1998;77:1034–9. [13] Sedlacek Z, Kodet R, Poustka A, Goetz P. A database of germline p53 mutations in cancer-prone families. Nucleic Acids Res 1998;26214–5; Available at: http://www.lf2.cuni.cz/projects/germline_mut_p53.htm. Accessed June 15, 2002. [14] Camplejohn RS, Sodha N, Gilchrist R, Lomax ME, Duddy PM, Miner C, Alarcon-Gonzalez P, Barnes DM, Eeles RA. The value of rapid functional assays of germline p53 status in LFS and LFL families. Br J Cancer 2000;82:1145–8. [15] Nagata Y, Anan T, Yoshida T, Mizukami T, Taya Y, Fujiwara T, Kato H, Saya H, Nakao M. The stabilization mechanism of mutant-type p53 by impaired ubiquitination: the loss of wild-type p53 function and the hsp90 association. Oncogene 1999;18:6037–49. [16] Birch JM, Blair V, Kelsey AM, Evans DG, Harris M, Tricker KJ, Varley JM. Cancer phenotype correlates with constitutional TP53 genotype in families with the Li-Fraumeni syndrome. Oncogene 1998;17:1061–8. [17] Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature 2000;408:307–10. [18] Cook WD, McCaw BJ. Accommodating haploinsufficient tumor suppressor genes in Knudson’s model. Oncogene 2000;19:3434–8. [19] Venkatachalam S, Shi YP, Jones SN, Vogel H, Bradley A, Pinkel D, Donehower LA. Retention of wild-type p53 in tumors from p53 heterozygous mice: reduction of p53 dosage can promote cancer formation. EMBO J 1998;17:4657–67.